593 results about "Vibrio parahaemolyticus" patented technology

The present invention demonstrated the potential use of Lactobacillus johnsonii D115 as a probiotic, as a prophylactic agent or as a surface treatment of materials against human and animal pathogens such as Brachyspira pilosicoli, Brachyspira hyodysenteriae, Shigella sonnei, Vibrio cholera, Vibrio parahaemolyticus, Campylobacter jejuni, Streptococcus pneumoniae, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Yersinia enterocolitica, Escherichia coli, Klebbsiella pneumoniae, Staphylococcus aureus, Salmonella spp., Bacillus cereus, Aspergillus niger and Fusarium chlamydosporum. The proteineous antimicrobial compound was partially characterized and found to be heat tolerant up to 121° C. for 15 min, and acid tolerant up to pH1 for 30 min at 40° C. The compound is also stable to enzymatic digestion, being able to retain more than 60% antimicrobial activity when treated with pepsin and trypsin.

The invention relates to bacillus amyloliquefaciens NCPSJ7 and further relates to an application of the strain in treating plant diseases, diseases before and after harvesting fruits and vegetables as well as in preventing food-borne pathogenic bacteria and putrefying bacteria. The strain is preserved in China Center for Type Culture Collection (CCTCC) on March 22, 2013, wherein the preservation number is CCTCC NO: M2013098 and the strain is named as bacillus amyloliquefaciens NCPSJ7. The thallus and fermentation liquor of the strain disclosed by the invention has the effects of treating plant diseases caused by plant pathogenic fungus including antagonistic peach root rotten disease, fusarium wilt of cucumber, botrytis cinerea, jujube anthracnose, pear black spot, pear blue mould, apple brown rot, apple altermaria leaf spot, watermelon fusarium wilt and the like, as well as diseases after harvesting fruits and vegetables and food-borne pathogenic bacteria and putrefying bacteria including antagonistic staphylococcus aureus, salmonella paratyphi A, vibrio parahaemolyticus, yeast and the like; moreover, the bacillus amyloliquefaciens is broad in spectrum and antibacterial and great in potential in developing novel, efficient and natural biological control and biological preservative and fresh-keeping preparation.

The invention relates to a kit checking vibrio parahaemolyticus with mediated isothermal amplification technology and the method. Said kit comprises LAMP reacting liquid A, downstream inner primer DNA polymerase B and coloured solution; and the upstream inner primer in LAMP reacting liquid A is tctggtcagcaagcagcagttttttcgccgaccacatttctca; downstream inner primer is acccgtactatccaactgcgcttttggcgcgtacttagcaagg; upstream outer primer is ccaagcgtttcgtcacca; downstream outer primer is caaagctttgtgcgaactcg. The checking method comprises extracting bacteria DNA, mediated isothermal amplification for vibrio parahaemolyticus, and coloring detection. The invention is characterized by fast speed, strong specificity, high sensitivity and low cost.

The invention relates to a pathogenic microorganism DNA detection chip and the chip comprises a carrier and a nucleic acid probe on the carrier. The nucleic acid probe is provided with a target detection probe used for detecting target gene of pathogenic microorganism. The pathogenic microorganism comprises but not limits to vibrio cholerae, pathogenic escherichia coli, campylobacter jejuni, Yersinia enterocolitica, parahemolytic vibrio, salmonella, and shigella and Listeria monocytogenes. The invention also relates to a preparation method of the pathogenic microorganism DNA detection chip and provides applications of the pathogenic microorganism DNA detection chip in detection of pathogenic microorganism. Also a pathogenic microorganism DNA detection chip kit is provided.

The invention discloses a loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus. The LAMP kit is composed of LAMP reaction liquid, a standard positive template and a negative quality control standard substance. The LAMP reaction liquid contains a Bst DNA polymerase big fragment, a primer, LAMP10*buffer, dNTPs solution, MgSO4 solution and glycine betaine. The primer is divided into a forward primer and a reverse primer. The LAMP kit has the advantages of being good in specificity, high in sensitivity, rapid and convenient, high in repeatability, capable of judging results by using eyes and the like, can conduct rapid qualitative detection on vibrio parahaemolyticus in industrial foods, and can replace continuously-used traditional culture method and serological diagnosis method.

The invention discloses a bacteriophage for preventing and treating a prawn vibrio parahaemolyticus disease and an expanding culture method thereof. Vibrio parahaemolyticus infected by South American white prawn are used for successfully screening out a strong lytic bacteriophage in seawater, titer of the bacteriophage is up to 1010 to 1012pfu / mL, fermentation period is 8 to 12h, treatment effects are obvious, and the bacteriophage for preventing and treating the prawn vibrio parahaemolyticus disease is of great significance for treatment of diseases causes by the vibrio parahaemolyticus and development of bacteriophage microecological preparations. A storage unit code of the bacteriophage is China Center for Type Culture Collection, address is China Center for Type Culture Collection in Wuhan University Campus, Wuchang Luojia Mountain, Wuhan City, preserved date is December 9, 2016, preservation number is CCTCC NO: M 2016740, a preservation test result is survival, name is vibrio parahaemolyticus bacteriophage VP11, and classification is named as Vibrio parahaemolyticus bacteriophage VP11.

The present invention relates to a method to detect bibrio parahemolyticus belonging to the technical field of biology, which is characterized in that: DNA template is prepared by centrifugating pure bacterial culture, discarding supernatant fluid, adding 100MuL sterile water for water bathing, ice bathing, centrifugation, removal of supernatant fluid as standby for expansion of the template. In addition, the method adopts primer 5.0 software to design four primer sequences of LAMP primer for bibrio parahemolyticus tlh gene M36437. Besides, loop-mediated isothermal amplification of bibrio parahemolyticus is applied. In detail, it is necessary to prepare a 25uL reaction system and carry out incubation and inactivation. Outcome detection refers to that turbidity of the reaction system is observed with naked eyes. Compared with prior arts, the detecting method of the present invention has the advantages of convenience, reliability, high sensitivity, short time and lower cost as a simple conventional detecting method, particularly adapts to grass-roots inspection and quarantine authorities and breed aquatics and brings great significance to improve food sanitation and boost development of international food trade.

The invention relates to a quick, sensitive and high-throughput intestines source pathogenic bacterium detection method. The detection method provided by the invention integrates two powerful molecular biological techniques: polymerase chain reaction PCR and a micro-array, and directly fixes a probe of PCR hybridization in a hybridization cabin of the micro-array on a same chip with a PCR reaction chamber. The detection method comprises the following steps of enriching bacteria; extracting a DNA solution; carrying out PCR amplification; hybridizing; cleaning; and judging the result. The method provided by the invention can quickly detect genes of vibrio parahaemolyticus, Shigella, staphylococcus aureus, listeria monocytogenes and salmonella in high throughput, and the detection efficiency of front-line inspection and quarantine personnel of import and export ports can be greatly improved, thereby not only reducing the workload, but also solving the undetected positive result problem probably caused by conventional detection method to the maximum extent. Therefore, food safety incidents are prevented to the maximum extent.

The invention discloses an oligonucleotide primer for detecting common pathogenic bacteria by adopting a fluorescent quantitation PCR (Rich Client Platform) technology, a method thereof for detecting common pathogenic bacteria and the application thereof. The method comprises the following steps of: providing 10 pairs of specific oligonucleotide primer sequences at annealing temperature of 50-60 DEG C without differing 5 DEG C; and simultaneously, quickly, accurately and effectively identifying and quantificationally detecting various pathogenic bacteria at the same time. A detection range comprises bacillus cereus, enterobacter sakazakii, vibrio parahaemolyticus, enterohemorrhagic escherichia coli O157, salmonella, Listeria monocytogenes, Shigella, campylobacter jejuni, pseudomonas aeruginosa, klebsiella pneumoniae, and the like. The invention also can be used for the fields of disease diagnosis, environmental monitoring, water-quality and food supervision and detection, food poisoning pathogenicbacteria detection, bacteriological classification, epidemiological investigation, biological agent detection, and the like, is convenient, quick, accurate and effective and has wide application range.

The present invention relates to a detection chip for performing gene detection to various vibrio and its detection and applications. The invention provides 16S rRNA sequences corresponding to each vibrio of vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, vibrio parahaemolyticus, brilliant vibrio and Fisher vibrio; heat shock protein hsp60 probe sequence; virulence gene probe sequence; 16S rRNA forward primer sequence; 16S rRNA reverse primer sequence; heat shock protein hsp60 forward primer sequence; heat shock protein hsp60 reverse primer sequence; virulence gene forward primer sequence and virulence gene reverse primer sequence. The present invention has specific, sensitive and high-throughput features, can simultaneously detect six kinds of bacteria virulence genes, and the invention will effectively guide the production as an important disease early-warning detection method used in clinical diagnosis of aquatic animals.

The present invention provides a gene chip for quickly detecting pathogens from food source, discloses the preparation method of said gene chip and provides 26 oligonucleotide probe sequences for detection. Said gene chip can quickly, accurately and high-effectively detect and identify the class of the pathogens in food, and its detection range includes staphylococcus aureus, Shiga's bacillus, salmonella, colibacillus 0157, bacillus proteus, mononuclear hyperplastic listerella, enterocolitis yersinia, aeruginous pseudomonads, vibrio parahaemolyticus, vibrio cholerae, bacillus cereus, beta hemolytic streptococcus, coconut fermentation pseudomonads, boticin, vibrio jejuni and bacillus perfringens, etc.

The invention relates to a multiplex PCR based primer pair and kit for detecting intestinal pathogens, particularly relates to a multiplex PCR based primer pair and kit for detecting 14 intestinal pathogens, and belongs to the technical field of PCR application. The 14 intestinal pathogens comprise vibrio cholerae (group O1 phage, group O139 phage and group non-O1 / O139 phage), listeria monocytogenes, enteropathogenic escherichia coli (EPEC), enterohemorrhagic escherichia coli (EHEC), enterotoxigenic escherichia coli (ETEC), enteroinvasive escherichia coli (EIEC), enteroaggregative escherichia coli (EAEC), shigella, intestinal virus EV71, enterohemorrhagic escherichia coli O157:H7, clostridium difficile, vibrio parahaemolyticus, salmonella enteritidis and salmonella typhimurium. The multiplex PCR based primer pair and kit can change the situation that only a few intestinal pathogens can be detected in one time and can be used for detecting 14 intestinal pathogens and 26 genes simultaneously.

The invention discloses a vibrio parahaemolyticus flagellin monoclonal antibody and an antigen capture ELISA (enzyme-linked immunosorbent assay) kit. The vibrio parahaemolyticus flagellin monoclonal antibody is produced by secreting of a hybridoma cell strain with the preservation number of CGMCC (China General Microbiological Culture Collection) No.6061. The vibrio parahaemolyticus flagellin monoclonal antibody can be used for detecting vibrio parahaemolyticus. The invention also discloses a vibrio parahaemolyticus flagellin capture ELISA (enzyme-linked immunosorbent assay) kit.

The invention discloses anti-vibrio parahaemolyticus chicken egg yolk antibody and the preparation method. The anti-vibrio parahaemolyticus chicken egg yolk antibody is prepared and obtained through the steps of preparation and inactivation of vibrio parahaemolyticus antigen, immunization of hens, collection of immunized eggs, coarse extraction of anti-vibrio parahaemolyticus chicken egg yolk antibody from the egg yolk liquid of the immunized eggs and purification. The invention also provides the application of the anti-vibrio parahaemolyticus chicken egg yolk antibody in food safety detection reagents and disease immune diagnostic reagents related with the preparation of vibrio parahaemolyticus and medicines and healthy products or feed additives for preventing and curing the related diseases of vibrio parahaemolyticus. The anti-vibrio parahaemolyticus chicken egg yolk antibody (IgY) prepared and provided by the invention has the advantages that the specificity and the purity are high, the anti-vibrio parahaemolyticus chicken egg yolk antibody has good effects when being used for preparing immunology testing reagents and medicines and feed additives for treating the related diseases of vibrio parahaemolyticus, the cost is low, the production volume is high, and the anti-vibrio parahaemolyticus chicken egg yolk antibody is easy to be industrialized.

The invention discloses a gene chip of aquatic product cultivation pathogenic bacterium, comprising a solid phase carrier which is modified chemically, a detection probe and a quality control probe are distributed on the solid phase carrier in a dot matrix way; the detection probe comprises specificity 16S rDNA sequences and / or gyrB gene sequences of vibrio, comma bacillus, vibrio harveyi, vibrio alginolyicus, vibrio anguillarum, vibrio parahemolyticus, nocardia, nacardia seriolea, aeromonas, hydrophilic aeromonas, streptococcus and dolphin streptococcus, which are to be detected, the quality control probe includes PCR positive, chip fixed positive control, chip hybridizing negative control, chip hybridizing positive control and chip hybridizing blank control; the gene chip has the advantages of small volume and high flux, can detect known and unknown germs of the vibrio, the nocardia, the aeromonas and the streptococcus, and can detect specific germs with multiple kinds, and the simpleness and rapidness and specificity of the germs can be detected, and automatic detection can be carried out after detection software is additionally arranged.

The invention provides a gene chip of main pathogenic microorganism in drinking water and a testing kit, which mainly aims at 11 kinds of bacteria of colibacillus / Shigella, salmonella, vibrio cholera, vibrio parahaemolyticus, staphylococcus aureus, enterococcus faecails, pseudomonas aeruginosa, legionella pneumophilia, pneumobacillus, yersinia enterocolitica and the like, and L.interrogans. The gene chip comprises a solid phase carrier and a oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe contains gyrB gene with tremendous evolutionary advantage, ITS gene and DNA segment selected from 16srRNA gene or complementary DNA segment. The gene chip and the testing kit of the invention can test the main pathogenic microorganism in drinking water, and has the characteristics of simple operation, high throughput, high accuracy, strong repeatability and the like, and can be used for clinical test for the water quality monitoring department.

The invention relates to a complex enrichment medium used for salmonella, vibrio parahaemolyticus and comma bacillus and a method for preparing the same. The formulation components of the complex enrichment medium in weight portion are as follows: 0.5 to 1.5 portions of buffer peptone water, 1000 portions of distilled water, 1.0 to 5.0 portions of glucose, 1.0 to 5.0 portions of mannitol, 0.03 to 0.06 portion sodium pyruvate, 0.5 to 2.5 portions of anhydrous sodium sulfite, 1.0 to 10.0 portions of sodium citrate, 5.0 to 25.0 portions of sodium chloride, 1 to 5 portions of cholate, and 0.0005 to 0.0025 portion of potassium tellurite. The method comprises the following steps: firstly, adding the buffer peptone water and the like into the distilled water, and sterilizing the mixture after heating and melting; and secondly, cooling the mixture to 50 DEG C, and then adding the potassium tellurite into the mixture to be mixed evenly. The complex enrichment medium can integrate two steps of primary enrichment and selective enrichment of bacterial detection to shorten the enrichment time to 24 hours, can perform enrichment on three target pathogens at the same time, and can inhibit the growth of other microorganisms.

The invention discloses a multiple PCR detection kit for 11 intestinal pathogen nucleic acid and application of the detection kit. The detection kit comprises primers for amplifying 11 intestinal pathogens which include vibrio cholerae serotype O1, vibrio cholerae serotype O139, salmonella, Shigella, vibrio parahaemolyticus, Yersinia enterocolitica, enterophathogenic escherichia coli (EPEC), enteroinvasive escherichia coli (EIEC), enteroaggregative escherichia coli (EAEC), enterotoxigenic escherichia coli (ETEC) and escherichia coli O157:H7. The multiple PCR detection kit has the advantages that the kit is capable of performing multiple detection, high in sensitivity and fast and convenient to use; specific primer sequences are used to guarantee detecting result reliability; the detection method is simple to operate, time saving, labor saving, high in detection throughput, low in reagent consumable cost, capable of directly detecting the nucleic acid extracted from encephalitis pathogens, low in detection platform and staff technical level requirements and capable of being widely popularized in conventional detection.

The invention discloses a microbial preparation, an aquatic feed and an aquaculture method and relates to the technical field of aquaculture. The microbial preparation comprises bdellovibrio and probiotic. Optimally, the probiotic is selected from any one of lactobacillus bulgaricus, lactobacillus delbrueckii, enterococcus faecalis, lactobacillus casei, lactobacillus acidophilus, rhodopseudomonaspalustris, clostridium butyricum, bacillus laterosporus, bacillus pumilus, bacillus coagulans, bacillus licheniformis, bacillus subtilis and lactobacillus plantarum. The microbial preparation has thecharacteristics of capability of increasing food intake of aquaculture animals, capability of promoting growth rate, survival rate and immunity of organisms, and the like. Besides, the microbial preparation is capable of effectively preventing and treating the problems of diseases caused by pathogenic bacteria, such as vibrio parahaemolyticus, vibrio harveyi, luminous vibrio, vibrio alginolyticus,vibrio campbellii, vibrio fluvialis, vibrio vulnificus, aeromonas, vibrio cholerae, pseudomonas and salmonella.

The invention relates to the technical field of microbes, and provides a novel vibrio parahaemolyticus phage as well as a composition, a preparation method and application thereof. The novel vibrio parahaemolyticus phage specifically refers to a vibrio parahaemolyticus phage VP46 of which the collection number is CCTCC NO:M2016290, a vibrio parahaemolyticus phage VP48 of which the collection number is CCTCC NO:M2016291 or a vibrio parahaemolyticus phage VP7 of which the collection number is CCTCC NO:M2016289. The phage is a strictly virulent phage, is highly toxic to host bacteria, has a widerhost range, and is highly toxic to the host bacteria at a low concentration; DNA (Deoxyribonucleic Acid) of the phage cannot encode proteins which may cause a potential health risk; the phage survives stably in a culture solution at room temperature, and survives for more than 12 months at a temperature of below 4 DEG C; the phage can be well proliferated on a non-pathogenic bacterial host; and large-scale industrial production can be realized.

The invention discloses a vibrio parahaemolyticus detection method based on a graphene oxide / ferroferric oxide / colloidal gold composite nanoparticle enhanced Raman effect. A graphene oxide / ferroferric oxide / colloidal gold (GO / Fe3O4@Au) composite nanoparticle is used as an active enhanced base, and a sulfhydrylization modified vibrio parahaemolyticus aptamer is added into the prepared GO / Fe3O4@Au composite nanoparticle, so that the vibrio parahaemolyticus aptamer is fixed on the base. A detected matter is mixed with the GO / Fe3O4@Au composite nanoparticle modified by the vibrio parahaemolyticus aptamer, and then the other vibrio parahaemolyticus aptamer modified by a Raman signal TAMRA is used for hatching; and Raman spectrum detection is carried out. By specifically combining the aptamer with vibrio parahaemolyticus, the detection of the vibrio parahaemolyticus in foods is realized. The method is high in sensitivity, high in specificity and convenient to operate, and has a wide application prospect in the field of food safety detection.

The invention relates to a microorganism detection device and a method for detecting. A multiple PCR rapid detection reagent kit for pathogenic bacteria in aquatic products is characterized in that the kit comprises 10*PCR buffer, 1.0-3.0mmol / L MgC1 2, 240 mu mol / L dNTP each, 60-200nmol / L salmonella primers, 60-200l / Lvibrio parahaemolyticus primers, 200nmol / L Listeria monocytogenes primers and 1.3-3.0 U Taq enzyme. The method has comparatively good specificity, simultaneous detection for salmonella, vibrio parahaemolyticus and Listeria monocytogenes in the water products can be realized conveniently, rapidly, and sensitively, the detection limit for artificially contaminated water products is 10cfu / mL, and the method provides ideal methods for rapidly detecting food-borne pathogenic bacteria of non-polluted water products and is provided with good application prospect.

The invention discloses a composite enrichment medium for salmonella, staphylococcus aureus, escherichia coli, listeria monocytogenes and vibrio parahaemolyticus and a preparation method for the composite enrichment medium. The composite enrichment medium comprises the following components in parts by weight: 5-10 parts of ox brain extract powder, 5-15 parts of ox heart extract powder, 5-15 parts of peptones, 2.5-7.5 parts of sodium chloride, 1-3 parts of glucose, 1.5-3.5 parts of disodium hydrogen phosphate, 1-3 parts of mannitol, 1-3 parts of sodium pyruvate, 1-3 parts of glycine, 1-3 parts of aesculin, and 1000 parts of distilled water, and a pH value of the composite enrichment medium is 7.2-7.5. A preparation method for the composite enrichment medium comprises the following steps: adding the components into distilled water according to the formula, stirring and dissolving the components, regulating the pH value of the mixture, and sterilizing the mixture at high pressure. The five bacteria are main pathogenic bacteria which are needed to be detected according to the national food hygienic standard. The composite enrichment medium can be used for realizing rapid proliferation of the five pathogenic bacteria. After carrying out bacteria enrichment for 16 hours, the concentration of the thallus can be increased to 10<6>CFU / mL-10<9>CFU / mL from 1CFU / mL, so that the thallus can be directly used for carrying out high flux detection on multiple PCRs (polymerase chain reactions), gene chips and micro-fluidic chips, and thus, screening of the five pathogenic bacteria is completed.

The invention relates to a gene chip and an application, which belongs to the biological detection field. The invention designs a set of detection probes by aiming at 11 types of common infectious diarrheal disease pathogen microorganism in clinic, and the gene chip containing the set of the probe. The detection probes comprises a vibrio parahaemolyticus probe, a vibrio vulnificus, a vibrio cholera probe, a vibrio alginolyticus probe, a vibrio furnissii probe, a shigella probe, an escherichia coli probe, an aeromonas probe, a salmonella probe, a campylobacteria probe, and a proteusbacillus vulgaris probe; the above mentioned probe sequence is shown as SEQ ID No: 1-117. The gene chip and probe can detect 11 types of common infectious diarrheal disease pathogen, the detection flux is high, the specialty is strong, the sensitivity is high, and the detection is rapid and effective.

The invention discloses a gene chip for detecting ten types of pathogenic bacteria in sea areas. The gene chip comprises a solid phase slide on which a quality control probe and a detection probe are arranged, wherein the nucleotide sequence components of the detection probe are shown in SEQ ID NO.1-SEQ ID NO.27. The gene chip is capable of simultaneously detecting enterobacter cloacae, edwardsiella tarda, streptococcus faecalis, vibrio fortis, vibrio harveyi, vibrio parahaemolyticus, vibrio splendidus, vibrio vulnificus, vibrio anguillarum and shewanella smarisflavi just in the presence of DNA (deoxyribose Nucleic Acid) without need of live bacteria. The gene chip has remarkable advantages of high throughput, parallelism, miniaturization, automation, rapidness, sensitiveness, quantification, small use amount, and the like.

The invention discloses RPA specific primers and a kit for detecting vibrio parahaemolyticus in food and application and belongs to the technical field of biology. The sequences of the RPA specific primers are shown as SEQ ID No:1 and SEQ ID No:2; the sequences of internal amplification control is shown as SEQ ID No:8. The RPA specific primers disclosed by the invention are low in time cost, i.e., a PCR (Polymerase Chain Reaction) reaction usually takes up 2 to 3 hours, but an RPA technology only needs 20 minutes to complete amplification; amplification can be realized at a normal temperature: constant-temperature reaction at 37DEG C is needed only and no special thermal cycle equipment is needed. The results are easy to judge; unlike a dispersion zone of an LAMP (Loop-Mediated Isothermal Amplification) product, the RPA only needs one pair of primers to complete amplification, and the amplified product has a strip with specific size according to design sites of the primers and also comprises the internal amplification control which can be used for indicating the false negative of the RPA reaction.

The present invention is preparation and usage of outer membrane protein subunit morbid vibrio vaccine for seawater fish. The vaccine is prepared through extracting two or more of Vibrio alginolyticus, Vibrio Hrveyi, Vibrio vulnificus, Vibrio parahaemolyticus, etc, and adding immunostimulating complex. The vaccine preparing process includes culturing vibrio, extracting outer membrane protein and preparing vaccine. The vaccine containing partial pathogen and no infecting component has stable immunological specificity and no hidden danger of restoring toxici. The vaccine is used in preventing fishes' skin ulcer, eyeball turbidity and other vibrio caused diseases and may be used widely for immunizing seawater fish.

The invention discloses a preparation method of immunogold rapid test paper for vibrio parahaemolyticus. The method comprises the following steps of: (a) preparing a vibrio parahaemolyticus antigen; (b) preparing a vibrio parahaemolyticus inactivated vaccine; (c) preparing a polyvalent antiserum with a vaccine immune experimental rabbit; (d) purifying the antiserum; (e) marking with colloidal gold; and (f) preparing an immunogold test strip. A detection technology in which the immunogold rapid test paper for vibrio parahaemolyticus is adopted has the advantages of easiness, sensitivity, rapidness, specificity and the like; the customs clearance speed of port imported and exported goods can be increased greatly; and meanwhile, the test paper has the advantages of low price, no need of instrument, easiness and rapidness for operationing and easiness in judging results.

The invention relates to genetic engineering of Scylla paramamosain, and provides a Scylla paramamosain anti-lipopolysaccharide factor, and a preparation method and application thereof. The preparation method comprises the following steps: building a recombinant expression vector for the Scylla paramamosain anti-lipopolysaccharide factor; introducing the recombinant expression vector into host cells, and carrying out induced expression on the host cells to obtain an expression product; and separating and purifying the expression product to obtain a recombinant protein, namely the Scylla paramamosain anti-lipopolysaccharide factor. The Scylla paramamosain anti-lipopolysaccharide factor has obvious growth inhibition and sterilization effects on Gram-negative bacteria such as Shigella flexneri, Vibrio alginolyiicus, Vibrio parahaemolyticus, Pseudomonas stutzeri and Pseudomonas fluorescens and Gram-positive bacteria such as Corynebacterium glutamicum, and has a potential application value in the preparation of antibacterial medicaments and antimicrobial additives for animal feed.

The present invention relates to one kind of gene chip for detecting six kinds of diarrhea pathogens, and the gene chip includes solid carrier and oligonucleotide probe fixed on the carrier. The oligonucleotide probe includes DNA or cDNA segments selected from nucleotide sequences corresponding to the genomes of Shigella, haemorrhagic colibacillus, invasive colibacillus, Vibrio parahaemolyticus, Vibrio cholreae and salmonella. The said chip together with sample treating reagent, hybridizing reagent, color reagent and the specification constitutes the detection kit. The present invention has high detection efficiency and high detection accuracy.