Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method.

A multiple fluorescence, kit technology, applied in fluorescence/phosphorescence, biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of long time and time consuming for detection, and reduce detection costs and work. The effect of reducing false positive interference

Inactive Publication Date: 2012-12-12
NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, the traditional detection method of pathogenic Vibrio is still isolated and identified through microbial culture, which is not perfect enough. It needs to go through multiple screening steps, requires a variety of media, and takes a long time; there is also a monoclonal antibody using Vibrio The detection method requires picking a single colony and then using immunological methods to identify it after a large number of bacteria. The specificity is high, but the time required for the detection of the two methods is relatively long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034]A multiplex fluorescent PCR kit for detecting pathogenic Vibrio in water, the kit consists of multiplex fluorescent PCR reaction mother solution, bacteria enrichment reagent (containing PEG8000 with a final mass percentage concentration of 20%, sodium chloride with a final concentration of 200mM ), DNA extraction reagent (containing tris hydrochloride at a final concentration of 20mM, potassium chloride at a final concentration of 100mM, ethylenediaminetetraacetic acid at a final concentration of 2.5mM, and NP40 at a final concentration of 1% by mass), Concentration of 5U / ul Taq DNA polymerase, wherein the multiplex fluorescent PCR reaction master solution is prepared according to the following volume ratio: multiplex 10× fluorescent PCR reaction buffer (containing tris hydrochloride at a final concentration of 100mM, the final concentration 500mM Potassium Chloride, Glycerin with a final concentration of 50% by mass, dATP, dGTP, dTTP and dGTP at a final concentration of ...

Embodiment 2

[0036] 1. Select the following pathogenic microorganisms, the experimental group: Vibrio alginolyticus, Vibrio mimicus, Vibrio river, Vibrio vulnificus; control group: Vibrio cholerae O1 group, Vibrio cholerae O139 group, Vibrio parahaemolyticus, Shigella Bacteria and Salmonella, the above-mentioned pathogenic strains were isolated and cultured from environmental samples: Vibrio alginolyticus, Vibrio mimicus, Vibrio river, Vibrio vulnificus, Vibrio cholerae O1 group, Vibrio cholerae O139 group, Vibrio parahaemolyticus, Chi Shigella and Salmonella were collected, isolated and cultivated in various water bodies in Ningbo around March 2011 by Zhou Donggen and other comrades of our research institute. The contact number is 0574-87169626.

[0037] 2. Sample preparation in the simulated environment: each concentration of 0.5ml was 1×10 5 CFU / ml of Vibrio alginolyticus, Vibrio mimicus, Vibrio river, Vibrio vulnificus, Vibrio cholerae O1, Vibrio cholerae O139, Vibrio parahaemolyticus,...

Embodiment 3

[0044] 3 drinking water samples to be tested were detected in the same manner as steps 3, 4, 5, 6, and 7 in Example 2, and the result was that the CY5 channel of 1 drinking water sample to be tested showed an S-shaped amplification curve, and the Ct value was 32, Have a Vibrio infection.

[0045] Ningbo Institute of Inspection and Quarantine Science and Technology

[0046] A multiplex fluorescent PCR kit and detection method for detecting Vibrio in water

[0047] 12

[0048] PatentIn version 3.5

[0049]

[0050] 1

[0051] 19

[0052] DNA

[0053] Artificial sequence

[0054]

[0055] 1

[0056] GTTAACGGCT GGAGCTGTC 19

[0057]

[0058] 2

[0059] 20

[0060] DNA

[0061] Artificial sequence

[0062]

[0063] 2

[0064] ACGGTCAAACAACGATCGGA 20

[0065]

[0066] 3

[0067] 24

[0068] DNA

[0069] Artificial sequence

[0070]

[0071] 3

[0072] CGGCAAACTT GGTTCCAACT GCCG 24

[0073]

[0074] 4

[0075] 20

[0076] DNA

[0077] A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a quadruple fluorescent PCR kit for detection of pathogenic vibrios in a water body and a detection method. According to the method, innovative bacterium enrichment reagent technology, DNA extraction reagent technology, specific fluorescent probe hybridization PCR detection technology and multiplex PCR technology are employed, bacterium enrichment culture of a sample is not needed, false positive interference is minimized as much as possible on the premise that high sensitivity is maintained, and four kinds of vibrios can be detected at one time. The invention mainly has the following beneficial effects: no need for bacterium enrichment of the sample in advance; high sensitivity and good specificity in detection of bacteria; reduction of the false positive incidence in conventional PCR amplification; and realization of rapid, accurate and specific detection of vibrio vulnificus, vibrio alginolyticus, vibrio mimicus and vibrio flurialis at one time.

Description

technical field [0001] The invention relates to the detection of Vibrio, in particular to a multiple fluorescent PCR kit and detection method for detecting Vibrio in water. Background technique [0002] At present, the traditional detection method of pathogenic Vibrio is still isolated and identified through microbial culture, which is not perfect enough. It needs to go through multiple screening steps, requires a variety of media, and takes a long time; there is also a monoclonal antibody using Vibrio The detection method requires picking a single bacterial colony and then using immunological methods to identify it. The specificity is high, but the time required for the detection of the two methods is relatively long. In terms of molecular biology testing, the FDA standard is still to design a PCR program for the purpose of detecting a pathogenic Vibrio. Domestic detection reagents design PCR detection method can only detect 3 kinds of Vibrio at the same time, and the focu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04G01N21/64
CPCY02A50/30
Inventor 孙大为周冬根李红龙再浩倪敏君张升杨天赐
Owner NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products