Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method.
A multiple fluorescence, kit technology, applied in fluorescence/phosphorescence, biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of long time and time consuming for detection, and reduce detection costs and work. The effect of reducing false positive interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0034]A multiplex fluorescent PCR kit for detecting pathogenic Vibrio in water, the kit consists of multiplex fluorescent PCR reaction mother solution, bacteria enrichment reagent (containing PEG8000 with a final mass percentage concentration of 20%, sodium chloride with a final concentration of 200mM ), DNA extraction reagent (containing tris hydrochloride at a final concentration of 20mM, potassium chloride at a final concentration of 100mM, ethylenediaminetetraacetic acid at a final concentration of 2.5mM, and NP40 at a final concentration of 1% by mass), Concentration of 5U / ul Taq DNA polymerase, wherein the multiplex fluorescent PCR reaction master solution is prepared according to the following volume ratio: multiplex 10× fluorescent PCR reaction buffer (containing tris hydrochloride at a final concentration of 100mM, the final concentration 500mM Potassium Chloride, Glycerin with a final concentration of 50% by mass, dATP, dGTP, dTTP and dGTP at a final concentration of ...
Embodiment 2
[0036] 1. Select the following pathogenic microorganisms, the experimental group: Vibrio alginolyticus, Vibrio mimicus, Vibrio river, Vibrio vulnificus; control group: Vibrio cholerae O1 group, Vibrio cholerae O139 group, Vibrio parahaemolyticus, Shigella Bacteria and Salmonella, the above-mentioned pathogenic strains were isolated and cultured from environmental samples: Vibrio alginolyticus, Vibrio mimicus, Vibrio river, Vibrio vulnificus, Vibrio cholerae O1 group, Vibrio cholerae O139 group, Vibrio parahaemolyticus, Chi Shigella and Salmonella were collected, isolated and cultivated in various water bodies in Ningbo around March 2011 by Zhou Donggen and other comrades of our research institute. The contact number is 0574-87169626.
[0037] 2. Sample preparation in the simulated environment: each concentration of 0.5ml was 1×10 5 CFU / ml of Vibrio alginolyticus, Vibrio mimicus, Vibrio river, Vibrio vulnificus, Vibrio cholerae O1, Vibrio cholerae O139, Vibrio parahaemolyticus,...
Embodiment 3
[0044] 3 drinking water samples to be tested were detected in the same manner as steps 3, 4, 5, 6, and 7 in Example 2, and the result was that the CY5 channel of 1 drinking water sample to be tested showed an S-shaped amplification curve, and the Ct value was 32, Have a Vibrio infection.
[0045] Ningbo Institute of Inspection and Quarantine Science and Technology
[0046] A multiplex fluorescent PCR kit and detection method for detecting Vibrio in water
[0047] 12
[0048] PatentIn version 3.5
[0049]
[0050] 1
[0051] 19
[0052] DNA
[0053] Artificial sequence
[0054]
[0055] 1
[0056] GTTAACGGCT GGAGCTGTC 19
[0057]
[0058] 2
[0059] 20
[0060] DNA
[0061] Artificial sequence
[0062]
[0063] 2
[0064] ACGGTCAAACAACGATCGGA 20
[0065]
[0066] 3
[0067] 24
[0068] DNA
[0069] Artificial sequence
[0070]
[0071] 3
[0072] CGGCAAACTT GGTTCCAACT GCCG 24
[0073]
[0074] 4
[0075] 20
[0076] DNA
[0077] A...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More