1024results about How to "Strong specificity" patented technology

Methods and devices to attenuate tumor necrosis factor (TNF) and other pro-inflammatory mediators in the CNS to treat neurological, neurodegenerative, neuropsychiatric disorders, pain and brain injury are described. More particularly, TNF blocking agents that target intracellular signals and downstream effects associated with the production and secretion of TNF are described. Devices described include therapy delivery devices comprising a reservoir capable of housing a TNF blocking agent and a catheter operably coupled to the device and adapted to deliver the TNF blocking agent to a target site within a subject.

Some aspects of this disclosure provide compositions, methods, and kits for improving the specificity of RNA-programmable endonucleases, such as Cas9. Also provided are variants of Cas9, e.g., Cas9 dimers and fusion proteins, engineered to have improved specificity for cleaving nucleic acid targets. Also provided are compositions, methods, and kits for site-specific nucleic acid modification using Cas9 fusion proteins (e.g., nuclease-inactivated Cas9 fused to a nuclease catalytic domain). Such Cas9 variants are useful in clinical and research settings involving site-specific modification of DNA, for example, genomic modifications.

The present invention relates to sensitive, rapid and convenient assays for detection and/or quantification of one or several analyte(s) in solution using so called proximity probes. The proximity probes comprise a binding moiety and a nucleic acid. The nucleic acid from one proximity probe is only capable of interaction with the nucleic acid from the other proximity probe when these are in close proximity, i.e. have bound to the analytes for which they are specific. The present invention relates to methods and kits for proximity probing and are performed in solution without the need of a solid phase.

The invention discloses a colloidal gold immunochromatography device for combined detection of a novel coronavirus COVID-19 antigen and antibody and a use method thereof. Through simultaneously detecting a novel coronavirus COVID-19 antigen and a specific IgM antibody and IgG antibody thereof, the immunology reaction state of the organism can be accurately judged, so that an accurate detection result is given according to the detection result, the detection rate of the new coronavirus is improved, a false negative result is avoided, missing detection is prevented, the detection accuracy is further improved, and help is provided for clinical diagnosis and treatment of the new coronavirus pneumonia. The colloidal gold immunochromatography device is high in specificity, high in detection speed and easy and convenient to operate, does not need special equipment or operation of professionals, and can be applied to preliminary screening of various places such as communities, primary hospitals, airports, customs and even families.

The present invention provides compounds for modulating protein kinase enzymatic activity for modulating cellular activities such as proliferation, differentiation, programmed cell death, migration and chemoinvasion. More specifically, the invention provides appropriately functionalized 5,6-fused bicyclics which inhibit, regulate and/or modulate kinase receptor, particularly c-Met, KDR, and flt-3, signal transduction pathways related to the changes in cellular activities as mentioned above, compositions which contain these compounds, and methods of using them to treat kinase-dependent diseases and conditions.

T cell receptors (TCRS) that have higher affinity for a ligand than wild type TCRs are provided. These high affinity TCRs are formed by mutagenizing a T cell receptor protein coding sequence to generate a variegated population of mutants of the T cell receptor protein coding sequence; transforming the T cell receptor mutant coding sequence into yeast cells; inducing expression of the T cell receptor mutant coding sequence on the surface of yeast cells; and selecting those cells expressing T cell receptor mutants that have higher affinity for the peptide/MHC ligand than the wild type T cell receptor protein. The high affinity TCRs can be used in place of an antibody or single chain antibody.

A device for detecting a cardiac event is disclosed. Detection of an event is based on a test applied to a parameter whose value varies according to heart rate. Both the parameter value and heart rate (RR interval) are filtered with an exponential average filter. From these filtered values, the average change in the parameter and the RR interval are also computed with an exponential average filter. Before computing the average change in the parameter, large changes in the parameter over short times, which may be caused by body position shifts, are attenuated are removed, so that the average change represents an average of small/smooth changes in the parameter's value that are characteristic of acute ischemia, one of the cardiac events that may be detected. The test to detect the cardiac event depends on the heart rate, the difference between the parameter's value and its upper and lower normal values, and its average change over time, adjusted for heart rate changes. The upper and lower normal parameter values as a function of heart rate are determined from long term stored data of the filtered RR values and parameter values. Hysteeresis related data and transitory deviations from normal (e.g. vasospasm related data) are excluded from the computation of normal upper and lower parameter bounds.

The invention relates to a test strip used for detecting immune colloidal gold remaining in kanamycin. The test strip comprises a sample pad, a combination pad, a cellulose nitrate membrane, a water absorbing pad and a PVC back lining, wherein, the sample pad, the combination pad, the cellulose nitrate membrane and the water absorbing pad are continuously stuck on the PVC back lining in sequence,lapping is arranged between the combination pad and the cellulose nitrate membrane, and lapping is arranged between the cellulose nitrate membrane and the water absorbing pad; an anti-kanamycin monoclonal antibody-colloidal gold label is coated on the combination pad, and a detection line formed by a kanamycin-carrier protein (bovine serum albumin) coupling compound and a quality controlling lineformed by a rabbit anti mouse are coated on the cellulose nitrate membrane. The test strip of the invention has the advantages that the specificity is strong, the sensitivity is high, the detection time is short (10 minutes), the test strip can be operated on site, the detection cost is low, the operation is simple, and the test strip is not required to be operated by professionals.

The invention discloses a method for preparing L-2-aminobutyric acid by an enzyme method and mainly solves the problems that the yield is low, the cost is high and the process condition is not suitable for industrial production in the conventional enzyme catalysis preparation method. A technical scheme of the invention is that: the method for preparing the L-2-aminobutyric acid by the enzyme method is characterized by comprising the following steps of: converting L-threonine which is taken as a starting material into 2-ketobutyrate by using threonine deaminase; and then converting the 2-ketobutyrate into the L-2-aminobutyric acid by using leucine dehydrogenase, and adding hydrogenlyase used for coenzyme generation in the reaction. The method for preparing the L-2-aminobutyric acid by the enzyme catalysis preparation method has the advantages of high efficiency, low cost and easy implementation of industrial large-scale production.

The invention relates to a method for preparing a reagent kit for fast detecting campylobacter jejuni and campylobacter coli and a method for detecting campylobacter jejuni and campylobacter coli by loop mediate disothermal amplification technology. The reagent kit contains loop mediate disothermal amplification reaction liquid, Bst DNA polymerase and developer; the reaction liquid consists of reaction buffer liquid, dNTP, bitter salt, upstream inner primer 5- ACAGCTATACCACTTGAACCATTTAAAGTGAACCTGA TGTTTTACCT-3, downstream inner primer 5-ACAAACATCCCGCCTCATAGTTTAAT CTCTTCTAAGCTTGCATCT-3, upstream outer primer 5-TTCCAAATTATG ATGGTTCAGA-3, downstream outer primer 5-TGGACCTTTAATAAACTGCATAA-3 and lycine; the method for detecting campylobacter jejuni and campylobacter coli comprises the steps of: extracting bacterial DNA, loop mediate disothermal amplifying of the campylobacter jejuni and campylobacter coli, and development detecting. The invention has the following advantages, including high speed, strong specificity, high sensitivity and low cost.

ELISA, Western Blot, and a peptide-based ELISA were applied to clinical specimens from patients with clinical symptoms of tick borne diseases, including Lyme disease. Peptides from different components of Borrelia during different cycles, including peptides from outer surface protein, leukocyte function associated antigens, immunodominant antigens, variable major proteins, and peptides from decorin-binding proteins of Borrelial subspecies (B. sensu stricto. B. afzelii, B. garinii) were used. Antibodies against specific peptides from Babesia and Ehrlichia were also measured.

The invention discloses riemerella anatipestifer detection kit and method based on a loop-mediated isothermal amplification technology. Based on six specific regions of a 16S rRNA conserved region of riemerella anatipestifer, two specific primers and two specific outer primers are designed in the kit and can specifically distinguish the riemerella anatipestifer and other serotype salmonellae so as to ensure the high specificity and the reliability of a detection result of loop-mediated isothermal amplification. The invention detects the riemerella anatipestifer on the basis of the loop-mediated isothermal amplification technology, can amplify a target sequence rapidly, efficiently and specifically under the isothermal condition, has simple and convenient operation and does not use expensive instruments and reagents; an amplification product can be developed directly by using a fluorescent dye and a result can be judged with naked eyes; the detection cost is low; and the invention is particularly suitable for small and medium size units and field tests.

The invention relates to a Bacillus subtilis ANSB 060CGMCC No.3440 used for degrading aflatoxins, and culture method and application thereof. The invention also provides a method for degrading aflatoxins B1, G1 and M1 by fermentation liquor of the strain. By the method, the Bacillus subtilis is reacted with the aflatoxin B1 for 2 hours, has a degradation rate of over 70 percent on the aflatoxin B1, and has the degradation rate of over 80 percent after the reaction performed for 12 hours; and the Bacillus subtilis has the degradation rates of over 80 percent and over 60 percent on the aflatoxin G1 and aflatoxin M1 respectively. The Bacillus subtilis has high detoxification activity, strong specificity, mild action effect, and no damage to nutrient in feeds, and is suitable for removing the aflatoxins in the feeds.

The invention relates to a bacillus subtilis ANSB01G CGMCC No. 4297 for simultaneously degrading zearalenone and cellulose and a culturing method thereof. The invention also relates to a method for degrading the zearalenone and the cellulose by using a fermentation liquor of a bacterial strain; by using the method, the degradation rate of the zearalenone can reach 83% while the zearalenone reacts with the bacillus subtilis for 72 hours; and the enzyme activity of the cellulose of the fermentation liquor of the bacillus subtilis is 198.9 U/g. The bacillus subtilis provided by the invention has the advantages of high activity, strong specificity, mild action effect and no damage to nutrition constituents in a feed during degrading the zearalenone; moreover, by using the bacillus subtilis, the cellulose can be also degraded to increase the feed conversion rate.

The invention describes a new Imaging modality based on Linear Velocity Imaging Tomography; its applications include differentiating between malignant and benign tissues, the ability to correlate an ECG trace with actual disorders of the heart and Imaging Brain communications.

A method of analysing ions is disclosed comprising performing an initial multi-dimensional survey scan comprising separating parent ions according to a first physico-chemical property (e.g. ion mobility) and then separating the parent ions according to a second physico-chemical property (e.g. mass to charge ratio). A plurality of parent ions of interest are then determined from the initial multi-dimensional survey scan. Once parent ions of interest have been determined, the plurality of parent ions of interest are sequentially selected based upon the first and second physico-chemical properties during a single cycle of separation. The parent ions of interest may then be fragmented and corresponding fragment ions may then be mass analysed.

Described are implantable devices and methods for treating various disorders of the pelvic floor by delivering one or more drugs to at least two pudendal nerves or nerve portions. One, two or more drug delivery regimes are provided on a continuous, alternating, intermittent or other basis to first and second pudendal nerves or nerve portions in an amount and manner effective to treat a number of disorders, including, but not limited to, urinary and/or fecal voiding dysfunctions such as constipation, incontinence disorders such as urge frequency and urinary retention disorders, sexual dysfunctions such as orgasmic and erectile dysfunction, pelvic pain, prostatitis, prostatalgia and prostatodynia.

The invention belongs to the technical field of biology and discloses a group of circRNA markers for early diagnosis of lung adenocarcinoma and application thereof. The circRNA marker disclosed by the invention comprises four kinds of circRNA, namely circRNA-100323, circRNA-69774, circRNA-403738 and circRNA-404449. The invention has the beneficial effects that a group of novel molecular bio-markers with diagnostic values on lung adenocarcinoma are provided. According to verifications of clinical sample cases, the group of circRNA markers have high diagnostic specificity and sensitivity on early diagnosis of lung adenocarcinoma.

The present invention provides a PCR reagent kit used for detecting quantificationally fluorescence of aspergillus. Said reagent kit contains primers such as 5'-CGGAAGGATCATTACCGAGTGA-3' (SEQ NO.1), 5'-CCCGCCGAAGCAACAAG-3' (SEQ NO.2) and a fluorescence probe 5'FAM-CCAACCTCCCACCCGTGTCTATYGT-BHQ-1 3' (SEQ NO.3). Said reagent kit in accordance with the present invention amplifies specifically gene in the interzone ITS I of aspergillus and generates a production with a size of 79 bp, is capable of quickly and correctly detecting a variety of common pathogenic aspergillus (such as aspergillus fumigatus, aspergillus flavus, aspergillus terreus, aspergillus niger and aspergillus nidulans) with a detection limit of 5-10 CFU/ml, and then is applied for a clinical diagnoses of invasive aspergillus infection with excellent sensitivity and specificity.

The invention relates to a traditional Chinese medicine bactericide for preventing and controlling soft rot of konjak, and belongs to the filed of insect pests and plant disease prevention and control and biological pesticide. The traditional Chinese medicine bactericide comprises the following components by weight percentage: 12 to 36 percent of garlic extract, 3 to 12 percent of Chinese goldthread rhizome extract, 3 to 10 percent of Flos Lonicerae leave extract, 3 to 5 percent of wettable powder accessory ingredient for farm chemical, and the balance being packing carrier for the farm chemical. The components are compounded into the traditional Chinese medicine bactericide wettable powder which has obvious sterilizing effect on pathogen of the soft rot of konjak, namely Erwinia Aroideae Holland for preventing and controlling the soft rot of konjak. The traditional Chinese medicine bactericide wettable powder is environment-friendly, has strong specificity, is better than chemical agents to prevent and control the soft rot of konjak, has more than 65 percent of relative prevention effect, and can improve the yield of konjak when applied to konjak production, as proved by experiments.

The invention discloses a method for detecting DNA (deoxyribonucleic acid) glycosylase activity on basis of single quantum dot level.In detection, DNA glycosylase hOGG1 specifically recognizes and excises damaged guanine to leave an abasic site, apurinic endonuclease-1 further excises the abasic site to leave a nucleotide gap, and DNA polymerase beta polymerizes Cy5-dGTP at the gap to generate a double-tagging double-strand nucleotide substrate; by specific reaction between biotin and streptavidin, the DNA substrate is combined to the surface, covered with the streptavidin, of quantum dots to form a QD-DNA-Cy5 compound; due to reduction of spatial distance, fluorescence resonance energy transfer occurs between the quantum dots and Cy5, and Cy5 fluorescence signals can be observed in the unimolecular level.The method has the advantages of simplicity, quickness and sensitivity, and the lower limit of detection can reach 1.8*10<-6>U/microliter.

The invention discloses a preparation method of a reagent board for rapidly detecting aflatoxin B1, belonging to the field of mycotoxin detection and particularly relating to a preparation method of a reagent board for rapidly detecting aflatoxin B1 in grains and edible oil. The reagent board comprises an upper plastic template, a lower plastic template and a back lining; a sample pad, a colloidal gold combining pad, a nitrocellulose membrane and a water sucking pad are sequentially and tightly attached on the back lining; a detection line and a quality control line are sequentially sprayed on the nitrocellulose membrane in the direction of from the sample pad to the water sucking pad, and a reaction result can be represented by using a color visible to the unaided eye. The reagent board can be used for performing semi-quantitative and intuitive detection, the whole operation process only takes 40 minutes, no any expensive experimental device is needed for assistance, thereby the invention is good for sample screening on a large scale and suitable for industry and business departments, inspection and quarantine organizations and grain and oil production and processing enterprises to carry out rapid detection on the aflatoxin in the grains and the edible oil on a large scale.

The invention discloses primers and probes for detecting human EGFR gene mutations as well as a use method, relating to the detection of gene mutation. The method of the invention comprises the following steps: (1) providing the primers and the probes; (2) processing the sample to be detected and extracting a template; (3) preparing a reaction system of fluorescent PCR amplification mutation gene sequence; (4) amplifying the mutable gene target sequence by the primers and the probes in the step (1); (5) detecting the fluorescence intensity of FAM and HEX or ROX of the reaction system as the judgment standard of results by adopting hybridization of a dual ring probes and an amplification product. The primers, the probes and the method of the invention can simultaneously detect 29 deletion mutations of EGFR gene, and features high sensitivity, strong specificity, strong selective capacity and fast detection speed demonstrated by completing the whole detection process in only 90 minutes.

The present invention relates to a chimeric inhibitor protein of a protease comprising an inhibiting polypeptidic sequence and at least one polypeptidic sequence of a substrate-enzyme interaction site specific for a protease. Other objects of the invention are to provide a purified and isolated DNA sequence encoding the chimeric inhibitor protein of a protease, an expression vector characterized in that it comprises said purified and isolated DNA sequence, a eukaryotic or prokaryotic host cell transformed with this expression vector and a method of producing a chimeric inhibitor protein.

The invention discloses a loop-mediated isothermal amplification detection primer group, a detection method and a kit of vibrio parahaemolyticus. The detection primer group is as follows: an upstream outer primer F3: 5'-GCAAAGAAACGCTTGGCG-3', a downstream outer primer B3: 5'-TGCATAGCAATGTTGTCGCT-3', an upstream inner primer FIP: 5'-TCTCTCGGGTGGTGGATGGGTTTCGTTACACTCCGTTCGC-3'; a downstream inner primer BIP: 5'-ATGGTTTGCTACTCTCGCACCCTCGGCTGACAAATGGCTCTA-3'. The detection method disclosed by the invention has the advantages of high sensitivity, high specificity, good accuracy rate and short detection time, only 12 hours are taken from sample treatment to result report, no PCR instrument or electrophoresis instrument is needed, the operation process is simple, and compared with other PCR techniques, the loop-mediated isothermal amplification detection primer group is relatively high in specificity and is applicable to detection of primary testing organizations and food companies.

This invention provides novel compositions and methods for the detection, and/or quantification, of the presence and/or activity of one or more kinases and/or phosphatases. In certain embodiments this invention a device for the detection of kinase and/or phosphatase activity where the device comprises a Raman active surface comprising features that enhance Raman scattering having attached thereto a plurality of kinase and/or phosphatase substrate molecules.

The invention discloses a composite membrane reinforced by an inclusion complex of ring molecules and a polymer. The composite membrane is mainly formed by a polymer layer consisting of a linear polymer or a branch polymer and an inclusion complex layer formed by serially sleeving the ring molecules on partial chain links of the polymer which are compounded and accumulated layer by layer. The preparation of the composite membrane mainly comprises the following steps: a polymer component and a ring molecule component are dissolved into a solvent respectively to be prepared into a solution; and a substrate material is alternately immersed into the solution prepared by the polymer component and the ring molecule component, is kept stand for a period of time, and is taken out to remove excessive adhesive substances, and a multi-layer membrane system can be obtained by circulating the process. Compared with the prior art, a supermolecular multi-layer membrane greatly strengthens the mechanical property and the friction-resistant performance of the multi-layer membrane by introducing a self-assembling inclusion component of the polymer and the ring molecules, and has broad varieties of selectable polymers and broad application prospect.

The present invention discloses a method which adopts the aptamer rapidly to detect the malachite green in water products. The sample to be detected, the malachite green aptamer and the report sequence with detection markers are mixed; after the report sequence and the malachite green are competitively combined with the malachite green aptamer, the markers on the report sequence is detected, and the content of the malachite green in the sample to be detected is calculated. The kit and the fast detecting test paper, which are prepared according to the method, can better satisfy the current urgent needs for detecting the malachite green residue in the water products, can be used in the detection of the customs and the food sanitation department, and can be easily promoted and applied in a large scale.

The invention discloses a test paper for detecting metalaxyl residue and application thereof. The test paper comprises a sample absorption pad (1), a conjugate release pad (2), a reaction membrane (3), a water absorption pad (4) and a base plate (7), wherein the reaction membrane comprises a detection line (5) coated with a metalaxyl semiantigen-carrier protein conjugate and a quality control line (6) coated with a goat anti-mouse antiantibody, and the conjugate release pad (2) is coated with a metalaxyl monoclonal antibody-colloidal gold marker. The invention also provides a method for applying the metalaxyl test paper in detection of metalaxyl residue in tea, tobacco and vegetable. The test paper provided by the invention can be used for detecting metalaxyl residue in tea, tobacco and vegetable, has the characteristics of simple operation, high sensitivity, a fast detection speed, low cost, etc., and is applicable to screening and on-site monitoring of a great number of samples.

An externally-applied Chinese medicine in the form of liquid for treating eczema and relative dermatopathy is prepared from 24 Chinese-medicinal materials including honeysuckly flower, wild chrysanthemum flower, wolfberry fruit, red sage root, etc through immersing in alcohol.