1999 results about "RNA" patented technology

The technology described herein relates to 5'-modified nucleosides, nucleotides, oligonucleotides and double-stranded RNAs, e.g., siRNAs, and kits comprising them and methods of their use for inhibiting target genes.

The invention provides a full-length gene sequence modeling method and system based on a neural network, and the method comprises the steps: constructing a first expression matrix for initial single-cell RNA sequencing data, and carrying out the quality control transformation of the first expression matrix to obtain a second expression matrix; inputting the second expression matrix into a preset binning embedding module to obtain a binning embedding matrix; maintaining and loading a gene pathway set through a knowledge base and a mapping module to obtain a binary mask matrix, and performing mask processing on the binning embedded matrix based on the binary mask matrix to obtain a pathway mask matrix; the path mask matrix is input into a preset attention state space model, the attention state space model comprises an encoder module, a jump connection module and a decoder module which are arranged in sequence, and a reconstruction tensor is output through the decoder module. According to the scheme, an efficient and extensible whole-gene annotation method is provided, and whole-gene expression input can be processed while the calculation efficiency is kept.

The invention discloses a system for detecting viral nucleic acid on the basis of a CRISPR (clustered regularly spaced short palindromic repeat) technology and an FET (field effect transistor) chip and application of the system, and relates to a method for detecting the viral nucleic acid on the basis of clustered CRISPR (clustered regularly spaced short palindromic repeat) and related proteins (Cas) and a field effect transistor (FET). The CRISPR-FET (clustered regularly interspaced short palindromic repeats-field effect transistor) detection system comprises a non-amplified CRISPR system, a reporter RNA (ribonucleic acid) and gold nanoparticles (AuNPs) connection system, a separation system and a field effect transistor chip detection system. The CRISPR-FET detection method provided by the invention has high sensitivity and high specificity on virus nucleic acid detection, and the lower limit of detection reaches a single copy (100 copies / [mu] L).

The invention provides a nucleotide mutation site prediction model construction and disease-related point mutation identification method. Specifically, the invention provides a deep learning model-fused nucleotide mutation site prediction model construction method and a disease-related point mutation identification method. According to the method, DNA point mutation and RNA point mutation can be recognized from transcriptome sequencing data in a high-sensitivity and high-specificity mode, and basic data is provided for explaining mutation generation mechanisms and functions on the whole transcriptome and genome level.

The invention discloses chiral ionizable lipid nanoparticles and a preparation method thereof, and belongs to the technical field of biomedical materials. The chiral ionizable lipid nanoparticle comprises chiral amino acid derived lipid, ionizable lipid, auxiliary lipid, cholesterol, a phospholipid polyethylene glycol derivative and an RNA (Ribonucleic Acid) drug, the preparation method comprises the following steps: dissolving chiral amino acid derived lipid in methanol, respectively dissolving ionizable lipid, auxiliary lipid, cholesterol and phospholipid polyethylene glycol derivative in ethanol, and mixing to obtain a total lipid organic phase; dissolving an RNA drug in DEPC water to obtain an RNA aqueous solution, and mixing the RNA aqueous solution with an acidic buffer solution to obtain an RNA aqueous phase; quickly mixing the total lipid organic phase and the RNA water phase, and standing and incubating; adding the mixed solution into a 3500 Da dialysis bag, taking 1 * phosphate buffer solution (PBS, pH = 7.4) as an external water phase, and dialyzing to obtain the chiral ionizable lipid nanoparticles. The lipid nanoparticles provided by the invention can enhance the RNA uptake efficiency, and have good application prospects in the treatment of systemic inflammation and other diseases.

The invention relates to a high-throughput cis-acting element screening carrier and a screening method. Specifically, the invention provides a plasmid vector system containing bar codes, each bar code in the system is in one-to-one correspondence with a candidate cis-acting element, and the activation multiple of the candidate cis-acting element can be obtained by measuring the abundance of the bar codes; in order to eliminate the influence of a bar code on the vector on a detection result, an exogenous intron which can be cut off during transcription is inserted into a coding region in the vector and is used for distinguishing vector DNA and RNA obtained by transcription. The screening method of the biological cis-acting element has high efficiency, wide applicability and high throughput, and has outstanding application value in biological research and breeding.

A protein interface prediction method based on three-track coding comprises the following steps: combining a fine-tuned protein language model SiteT5 with evolutionary, geometric and statistical features extracted from a sequence, sending the combined features into a three-track coding network, and integrating a cyclic gating module, a multi-resolution aggregation module and a long sequence deformation module to obtain a protein interface prediction model SiteT5; the method comprises the following steps: respectively capturing a time sequence relation, a local mode and long-range dependence among residues, respectively mapping the three codes into different weights, carrying out point multiplication on the three codes, and carrying out aggregation through a multi-view cross attention module; then the protein residues are sent to a three-layer hierarchical interactive learning module, local structure and global dependency are cooperatively mined through an eight-head gating self-attention module and a position-by-position feedforward module, and finally the probability that each protein residue is an interface is obtained through a classifier. According to the invention, a protein-DNA interface, a protein-RNA interface, a protein-protein interface and an antibody-antigen interface can be effectively captured. And the robustness is ensured, and meanwhile, relatively high prediction precision is also shown.

The disclosure relates to compositions and methods for treating a disease or condition associated with a TDP-pathology or a decline in TDP-43 functionality in neuronal cells in a subject, and for identifying candidate agents to restore expression of a normal full-length or protein coding STMN2 RNA.

Embodiments disclosed herein provide methods, including computer-implemented methods, for designing guide sequence which may be incorporated into custom, large scale guide sequence libraries. The methods require only a list of target genes as input and utilize on target and off target scores to generate an optimal set of guide sequences for a set of target genes. In certain embodiments, the methods may also utilize multi-tissue RNA-sequencing data and / or protein annotation to design targets to genes that are highly expressed and / or contain a functional protein domain. The invention further comprises guide libraries, cells comprising said guide libraries. Computer-implemented embodiments further improve computer system function by reducing excessive user wait time through the use of data structures that reduce search from linear to logarithmic time.

Compositions and methods comprising a deaminase for targeted editing of nucleic acids are provided. Also provided are compositions and methods for localizing a heterologous polypeptide to a target DNA molecule, and compositions and methods for targeted editing of nucleic acids. Fusion proteins comprising an RNA-guided nuclease (RGN) and at least one heterologous polypeptide inserted therein are provided, as well as fusion proteins comprising a DNA binding polypeptide and a deaminase. The heterologous polypeptide may be a pilot editing polypeptide or a base editing polypeptide. Compositions also include nucleic acid molecules encoding a deaminase or fusion protein. Vectors and host cells comprising the nucleic acid molecules encoding the deaminase or fusion protein are also provided.

The invention discloses a composition for preventing and treating eggplant root rot, and relates to the technical field of biological prevention and treatment. The composition consists of three parts, namely a double-stranded RNA (Ribonucleic Acid) delivery body controlled by a kaolinite nanotube-metal polyphenol network-boric acid ester, a nitric oxide / hydrogen sulfide double-pulse microcapsule and volatile organic compound particles of beta-cyclodextrin cross-linked aerogel, wherein the three parts are matched according to the total mass ratio of 1: (0.8-1.5): (0.8-1.2). Through structural design, time sequence release of non-overlapping peak values is realized, and a prevention and control mode for inhibiting environment enhancement host precise silencing is formed. The deliverer can be selectively disintegrated under the condition of pathogen-induced organic acid, iron chelating agent and hydrogen peroxide, so that the targeted release of the double-stranded RNA is realized; the double-pulse microcapsule respectively releases nitric oxide and hydrogen sulfide in a transplanting stress stage and an early disease stage, and induces host defensive gene expression; the aerogel particles continuously release 2, 3-butanediol and aromatic aldehyde to inhibit germination of pathogenic bacteria and serve as rhizosphere signals to enhance host resistance.

The present disclosure features useful compositions and methods to treat disorders for which deamination of an adenosine in an mRNA produces a therapeutic result.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The disclosure describes changes in cfRNA gene expression that are associated with risk for preeclampsia. Accordingly, the disclosure provides methods and kits for preeclampsia risk assessment.

The invention relates to RNA constructs encoding (i) at least one therapeutic biomolecule; and (ii) at least one innate inhibitor protein (IIP). The constructs are RNA replicons and saRNA molecules, and the invention includes genetic constructs or vectors encoding such RNA replicons. The invention extends to the use of such RNA constructs and replicons in therapy, for example in treating diseases and / or in vaccine delivery. The invention extends to pharmaceutical compositions comprising such RNA constructs, and methods and uses thereof.

The present application belongs to the technical field of genetic engineering, and particularly relates to a methyltransferase gene CmCMT2 and CmDRM2 application in regulating chrysanthemum flowering. The present application constructs an RNAi silencing expression vector by isolating CmCMT2 and CmDRM2 genes in a chrysanthemum variety "Jinma", and obtains CmCMT2 -RNAi and CmDRM2 -RNAi transgenic "Jinma" plants by using a genetic transformation method, then performs phenotype observation and statistics on the transgenic plants, and explores CmCMT2 and CmDRM2 the mechanism of the genes affecting early flowering of chrysanthemum by using an RNA-seq method. The CmCMT2 and CmDRM2 genes are cloned from the chrysanthemum variety "Jinma", and spatiotemporal expression analysis shows that CmCMT2 and CmDRM2 the genes are highly expressed during the process of "Jinma" from bud development to color change; and CmCMT2 and CmDRM2 the expression level in leaves gradually decreases during the growth and development of "Jinma". The research results show that CmCMT2 and CmDRM2 the content of GA1 is changed by negatively regulating the expression of CmG20ox2a and CmG20ox2b , so that the flowering period of chrysanthemum is advanced by 15 and 8 days, respectively.

The invention discloses a self-adaptive multi-channel fusion lncRNA subcellular localization prediction method based on a reinforcement learning agent, and relates to a long-chain non-coding RNA subcellular localization prediction method. The method aims at solving the problems that sample heterogeneity is ignored and RNA-protein interaction characteristics are ignored due to the fact that a fixed feature fusion strategy is adopted in an existing method. According to the method, firstly, multi-modal feature extraction is carried out, original feature vectors are obtained through splicing, the original feature vectors are projected to a reinforcement learning state, actions are obtained through an intelligent agent obtained through PPO training based on near-end strategy optimization, and the actions comprise feature selection mask codes, fusion weight guidance and dynamic hyper-parameter configuration. A personalized fusion strategy is obtained through action vectors generated by the reinforcement learning agent, the fusion prediction network fuses the features in the multi-modal feature set based on the personalized fusion strategy, and finally the positioning probability of the lncRNA at each subcell position is obtained.

The present invention discloses a system for targeted gene editing and related uses. Also disclosed are related cells.

The invention belongs to the technical field of biological detection, and discloses a primer probe composition for detecting CMV virus, a product and application thereof, the primer probe composition for detecting CMV virus comprises a primer probe combination for detecting CMV virus and a primer probe combination for detecting reference gene; the detection technology can be used for detecting the CMV on the DNA level and also can be used for detecting on the RNA level, the detection operation is more flexible, and the detection technology is particularly suitable for rapid safety recheck of cell therapy products and process detection in the production process. The primer probe composition provided by the invention has good detection sensitivity and specificity, is simple to operate, and can be widely applied to CMV detection of cell therapy products.

Provided herein are methods of identifying methylation status of a nucleic acid, e.g., RNA in a biological sample. Also provided herein are methods for identifying the methylation status of RNA in a biological sample with spatial technology to identify the location of a methylated RNA in the biological sample.

One aspect of the present invention relates to double-stranded RNA (dsRNA) agent capable of inhibiting the expression of a target gene. Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA molecules suitable for therapeutic use, and methods of inhibiting the expression of a target gene by administering these dsRNA molecules, e.g., for the treatment of various disease conditions.

The present invention relates to lipid nanoparticle (LNP) compositions, as well as diagnostic or therapeutic polynucleotides, such as TERT mRNA, that can be delivered in a formulation together with the LNP compositions to various tissue and cell types in the whole body of a mammal, such as, for example, TNP mRNA. Comprising stem cells, progenitor cells, germ cells, differentiated cells or terminally differentiated cells, cancer cells, endothelial cells, epithelial cells, splenic cells, hepatocells, kidney cells and / or osteoblasts, for example, for use in the diagnosis, prevention and / or treatment of a condition or disease.

The invention relates to gene therapy of ocular conditions. Described herein are compositions and methods for delivering therapeutic products, such as therapeutic proteins (e.g., antibodies), therapeutic RNAs (e.g., shRNAs, siRNAs, and miRNAs), and therapeutic aptamers, to the retinal / vitreous humor of the eye of a human subject to treat ocular conditions, involving, for example, recombinant viral vectors, such as recombinant adeno-associated virus (rAAV) vectors.

The present disclosure relates in some aspects to methods and compositions for generating a library of nucleic acids for analysis. In some aspects, a plurality of RNAs are processed and analyzed in situ in a sample or used to generate a plurality of barcoded nucleic acid molecules for analysis. Also provided are oligonucleotides, a plurality of free nucleotides, detection reagents, compositions, and systems for use in accordance with the methods.

A sampling device including an intake pump coupled with a volume controller to provide a known volume of samples such as liquid collected through a specialized hollow membrane filter. Once the known volume of sample is filtered the intake pump is turned off, an air pump turns on and removes residual or excess sample. The membrane filter is then preserved for extraction of DNA / RNA.

This invention discloses an amplification-free electrochemical biosensor and method based on CRISPR-Cas13a. The sensor includes an electrochemical biosensor substrate, a dual-channel RNA reporter molecule, a CRISPR-Cas13a reaction system, and a dual-channel differential signal processing module. The working electrode surface is immobilized with a stem-loop structured first reporter molecule and a linear second reporter molecule loaded with gold nanoparticles, labeled with methylene blue and ferrocene signal molecules respectively, and immobilized with a ferrocene-specific capture probe. When target RNA is present, Cas13a is activated and non-specifically cleaves the reporter molecule, reducing the methylene blue signal and enriching and enhancing the ferrocene signal. Background self-calibration is achieved through dual-channel differential ratio calculation. This invention integrates signal attenuation and signal enhancement modes, offering advantages such as nucleic acid amplification-free operation, fast detection speed, high sensitivity, and strong anti-interference capability.

A skin care composition includes a plurality of agents that include at least one retinol derivative that may comprise, for example, hydroxypinacolone retinoate, and at least one bark extract that may comprise, for example, Eperua falcata bark extract, the plurality of agents providing reduced retinol associated inflammation as compared with a composition that includes the at least one retinol and lacks the at least one bark extract. The plurality of agents may also include hydroxy acid, for example, comprising lactic acid. The composition may confer one or a combination of increased skin cell proliferation, improved cellular migration, improved cellular differentiation, an anti-inflammatory retinol genetic signature as demonstrated by via bulk-RNA sequencing of human keratinocytes and restores epidermal disruption and reduce IL-1A and IL-23 inflammatory cytokines in human ex-vivo skin models of chronic inflammation.

The present invention provides a long non-coding RNA (lncRNA) biomarker composition in serum exosomes, comprising LOC105377989, LOC105375434, LOC107986997, and LOC101927073, for diagnosing atrial fibrillation on the basis of the results of profile analysis of lncRNA in serum exosomes of patients with atrial fibrillation. When used, the lncRNA biomarker composition enables non-invasive in-vitro diagnosis, and exhibits an excellent effect in atrial fibrillation diagnosis, and thus is highly applicable as a useful diagnostic biomarker for atrial fibrillation.

The application discloses a drug-loaded micelle capable of effectively crossing the blood-brain barrier, which is an amphiphilic conjugate composed of a reduction-sensitive paclitaxel prodrug and a nucleic acid complex, wherein the reduction-sensitive paclitaxel prodrug is used as a hydrophobic part, and the nucleic acid complex is used as a hydrophilic part, and the drug-loaded micelle is self-assembled in an aqueous environment; the reduction-sensitive paclitaxel prodrug is formed by the reaction of paclitaxel and a disulfide bond-containing linker; and the nucleic acid complex is formed by connecting an antisense oligonucleotide and an interfering RNA through a DNA bridge. The drug-loaded micelle exhibits superior blood-brain barrier penetration, effectively realizes enrichment in brain tumors, solves the problem of low blood-brain barrier penetration efficiency of existing nano-carriers, and provides an effective basis for brain drug delivery and brain diseases such as brain tumor imaging and treatment.