428 results about "Nuclease" patented technology

Provided are compositions for genome editing and site-directed integration in plants comprising microprojectile particles coated, treated or applied with a nuclease protein, guide RNA or RNP for delivery to a mature embryo explant from dry seeds. Further provided are methods for genome editing and site-directed integration in at least one cell of a plant using the disclosed compositions, and plants, plant parts and seeds comprising an edited genome or site-directed integration, which are produced by the disclosed methods.

Embodiments disclosed herein provide methods, including computer-implemented methods, for designing guide sequence which may be incorporated into custom, large scale guide sequence libraries. The methods require only a list of target genes as input and utilize on target and off target scores to generate an optimal set of guide sequences for a set of target genes. In certain embodiments, the methods may also utilize multi-tissue RNA-sequencing data and / or protein annotation to design targets to genes that are highly expressed and / or contain a functional protein domain. The invention further comprises guide libraries, cells comprising said guide libraries. Computer-implemented embodiments further improve computer system function by reducing excessive user wait time through the use of data structures that reduce search from linear to logarithmic time.

Methods to edit genes by administering a chimeric nuclease to a cell or organism without the use of a viral vector.

The invention discloses a primer and a method for quantitatively monitoring the biomass of sargassum hemiphyllum based on an environmental DNA technology, and belongs to the technical field of molecular ecology. The primer probe group comprises an upstream primer, a downstream primer and a fluorescent probe which are specifically targeted to the sargassum hemiphyllum mitochondria COX1 gene, and the sequence is shown as SEQ ID NO.1-3. The kit comprises the primer probe group, a qPCR (quantitative polymerase chain reaction) premixed solution, nuclease-free water and a sargassum hemiphyllum plasmid positive control. The method comprises the following steps: collecting a water sample, enriching eDNA, performing qPCR detection by using the primer probe group after extraction and purification, and realizing qualitative detection and quantitative evaluation of sargassum hemiphyllum through a Cq value or a standard curve. The method disclosed by the invention has the advantages of high sensitivity, strong specificity, no damage to the environment and target organisms, capability of realizing large-scale rapid general survey and the like, and is suitable for early warning of gulfweed blooms, investigation of population distribution and evaluation of ecological influence.

Systems, methods and compositions for targeting polynucleotides are detailed herein. In particular, engineered DNA-targeting systems comprising IscB polypeptides, novel IscB nucleases and reprogrammable targeting nucleic acid components and methods and application of use are rovided.

The invention discloses a novel nuclease editing system, and belongs to the field of gene engineering. The invention provides sequence-specific nuclease which has targeted cleavage activity and can be combined with target DNA in a targeted manner under the guidance of reRNA or sgRNA. In addition, the invention also provides a gene editing system containing the sequence-specific nuclease and a modified nuclease system, and the gene editing system and the modified nuclease system can effectively target a target spot and cut or modify a target site.

The present invention relates to specific natural or artificial RNA or DNA / RNA substrates for cleaving by a Cas nuclease. The invention furthermore relates to a complex comprising the specific artificial RNA or DNA / RNA substrate, at least one of a Cas nuclease enzyme and at least one preselected guide RNA binding to at least one target RNA. The present invention also relates to methods for cleaving the natural or artificial RNA or DNA / RNA substrate and methods for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample using the substrate or for eliminating a cell expressing the at least one target RNA.

The present invention relates to compounds of formula (I), and stereoisomers, tautomers, N- oxides, and pharmaceutically acceptable salts thereof that are useful for modulating, preferably inhibiting three-prime repair exonuclease (TREX1). The present invention further relates to compounds of formula (I) for use as a medicament and to pharmaceutical compositions comprising said compounds. Further, the present invention relates to compounds of formula (I) and pharmaceutical compositions comprising said compounds for use in the treatment of cancer, such as breast, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1-mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutières syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

The invention belongs to the field of gene engineering, and relates to nuclease generated based on AI and having a gene editing function and application of the nuclease. The technical problem to be solved by the invention is to develop more nuclease suitable for eukaryote gene editing. According to the technical scheme, nuclease AIGCprotein which is generated based on AI and has a gene editing function is obtained through the following steps that a plurality of protein amino acid sequences are generated through a known nuclease three-dimensional structure in a PDB database, the sequences are classified and compared, and a protein skeleton of the nuclease AIGCprotein is obtained through extraction; the known nuclease is Cas12. The invention provides nuclease which is generated on the basis of Protein MPNN AI and has a gene editing function, and the protein does not exist in the nature; the method can be used for constructing a plant genome editing system.

The invention discloses a recombinant salmonella choleraesuis nuclease regulation vector as well as a construction method and application thereof. After oral administration, the recombinant salmonella choleraesuis nuclease regulatory vector rSC0140 enters host immune cells, c-di-AMP is released, a host STING pathway is activated, and a broad-spectrum antiviral effect can be achieved; the recombinant strain rSC0140 is proved to be capable of activating STING pathways in macrophages and mice, causing antiviral states of the macrophages and the mice and resisting challenge of various influenza viruses; the recombinant strain has broad-spectrum antiviral efficacy and is suitable for preventing and treating various virus diseases clinically.

The application provides a construction of a fluorescent protein labeled microtubulin and a microtubule binding protein universal bivalent carrier, and the process is as follows: a first stage is to construct a GFP-alpha tubulin carrier, and a second stage is to construct a GFP-alpha tubulin-mCherry universal bivalent co-expression carrier; in the second stage, 35S, mCherry and NOS sequences are inserted into a KpnI enzyme cutting site of a multiple cloning site of the GFP-alpha tubulin carrier constructed in the first stage, and a single nucleic acid enzyme cutting site is inserted into the 5' end and the 3' end of the mCherry sequence, respectively, and the single nucleic acid enzyme cutting site is XbaI, KpnI / Acc65I and AscI sequences, respectively, so as to obtain the universal bivalent carrier. The universal bivalent carrier provided by the application can express two target genes simultaneously, has the fluorescent signals of GFP and mCherry, can quickly and accurately identify a transgenic plant, is convenient for positive seedling screening, can be used for a tobacco transient expression experiment, can shorten an experimental period, and saves time and effort.

The present invention provides nuclease-resistant nucleic acid nanostructures, pharmaceutical compositions thereof, pharmaceutical and diagnostic uses thereof as well as a method of producing nucleic acid nanostructures.

The present disclosure encompasses a lipid nanoparticle (LNP) comprising a polypeptide comprising a nucleic acid sequence encoding an engineered meganuclease that binds and cleaves a recognition sequence within a Hepatitis B virus (HBV) genome. Further, the disclosure encompasses pharmaceutical compositions comprising the LNPs, and the use of such compositions for inactivating a pol gene of an HBV genome or an HBV genome fragment in a cell and treating HBV infections or diseases associated with HBV infections.

The present invention provides a method of stabilizing a phi29 DNA polymerase by contacting the phi29 DNA polymerase with a stabilized oligonucleotide that is free from degradation by a 3'exonuclease. The phi29 polymerase exhibits improved temperature stability in the presence thereof compared to the absence of the stabilized oligonucleotide. The method involves preparing a composition comprising a phi29 DNA polymerase and a stabilized oligonucleotide comprising one or more modified nucleotides. The compositions can be used in methods for performing polymerase reactions, nucleic acid replication, and detection of a target nucleic acid or target analyte in a sample. The compositions are particularly useful in rolling circle amplification reactions in which the targets are produced by proximity ligation assay, in particular cyclized lock probes.

The present disclosure relates to recombinant nucleases, recombinant nucleases operatively linked to nucleic acid binding domains, and methods of making and using them.

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

This invention relates to a method for quantifying mRNA capping efficiency, the method comprising mixing a sample, an enzyme mixture, and an isotope standard solution in a buffer solution to produce an incubation mixture, the enzyme mixture comprising a nonspecific single-stranded nuclease and an acid phosphatase, and the isotope standard comprising isotopically labeled m7G and isotopically labeled 2'-O-methylated nucleoside; incubating the mixture; and analyzing the mixture using liquid chromatography-mass spectrometry to determine at least one of capping efficiency and 2-O-methyltransferase efficiency.

The invention belongs to the field of tendon tissue scaffold preparation, and provides a tendon tissue scaffold preparation method based on a decellularization technology. Although the existing decellularization technology can realize removal of cell components and retention of a matrix structure, contradiction still exists in the aspects of considering decellularization efficiency and matrix integrity. The method comprises three steps of freeze thawing treatment, trypsin digestion ultrasonic treatment and nuclease treatment, and perfect balance between decellularization efficiency and matrix retention is realized by optimizing freeze thawing parameters, regulating ultrasonic conditions and reasonably matching enzyme types and concentrations. According to the method, the cell structure can be accurately destroyed, the release of cell contents is promoted, and meanwhile, the extracellular matrix structure and bioactive molecules are protected. Experiments show that the tendon tissue scaffold prepared by the invention is thorough in cell removal, retains an extracellular matrix structure of natural tendons to the greatest extent, is closer to natural tissues in mechanical properties and biological functions, and provides a new thought for tendon repair research and application.

The application discloses a liver-targeted gene editing system based on endogenous promoter hijacking and application, and belongs to the field of biological medicine. The system is composed of an LNP-wrapped modified Cas nuclease mRNA (first component) and a promoter-free viral vector carrying a therapeutic transgene donor (second component). The system uses LNP to realize the transient burst expression of Cas nuclease in the liver, mediates the generation of double-strand breaks at the site of endogenous high-expression genes, induces the site-specific integration of therapeutic transgenes without exogenous promoters, and hijacks the expression driven by endogenous promoters by using the splice acceptor (SA) mechanism. The application solves the risk of carcinogenesis caused by random integration of exogenous strong promoters and the immunotoxicity of long-term expression of nucleases through a "double safety lock" design. Experimental results prove that the system has high editing efficiency, long-term stability and no off-target, and can be used for various liver-derived metabolic diseases such as hemophilia, hypercholesterolemia and the like.

The present application relates to signal peptides for producing Serratia marcescens-derived nuclease and uses thereof. In particular, the present application relates to a polypeptide comprising a signal peptide and a Serratia marcescens-derived nuclease amino acid sequence, a microorganism comprising said polypeptide, and a method of producing Serratia marcescens-derived nuclease, said method comprising the step of culturing said microorganism. The present application can be used for large-scale production of Serratia marcescens-derived nuclease.

The invention discloses a kit and a method for preparing cDNA (complementary deoxyribonucleic acid) by reverse recording of a single B cell of a mouse. The kit comprises a B cell lysis solution and a reverse transcription buffer solution system, wherein the B cell lysis solution is prepared from a nonionic detergent, dNTP (deoxyribonucleoside triphosphate), dCTP (deoxycytidine triphosphate), a secondary structure stabilizer, a reducing agent, BioIS-mCH2-RT (reverse transcriptase), BioIS-CK-RT, a mouse RNA (Ribonucleic Acid) enzyme inhibitor and nuclease-free water; the reverse transcription buffer solution system comprises 5X RT Buffer, a secondary structure stabilizer, Mg < 2 + >, a reducing agent, a mouse RNA enzyme inhibitor, a Bio-Adaptor primer, reverse transcriptase and nuclease-free water. The kit can significantly improve the success rate, accuracy and sensitivity of reverse transcription of a single B cell, and simplify the operation process.

In one embodiment, an engineered CRISPR nuclease polypeptide is provided that is derived from a reference CRISPR nuclease shown as SEQ ID NO: 1, the engineered CRISPR nuclease polypeptide comprises (i) one or more mutations in a HNH nuclease domain or a RuvC nuclease domain that reduce or eliminate nuclease activity of the HNH nuclease domain or the RuvC nuclease domain; (ii) one or more arginine substitutions and / or lysine substitutions; and / or (iii) one or more mutations for reducing the stringent PAM recognition.

The present disclosure relates to oligonucleotides, compositions, and methods useful for reducing GYS2 expression, particularly in hepatocytes. The disclosed oligonucleotides for reducing GYS2 expression can be double-stranded or single-stranded, and can be modified to improve properties such as stronger resistance to nucleases and lower immunogenicity. The disclosed oligonucleotides for reducing GYS2 expression can also include targeting ligands to target specific cells or organs, such as hepatocytes of the liver, and can be useful for treating glycogen storage diseases (e.g., GSDIa, GSDIII, GSDIV, GSDVI, and GSDIX) and related conditions.

The present invention relates to a novel polynucleotide applicable to genome editing techniques with improved editing efficiency of a target nucleotide sequence. The method using the double-stranded nucleotide complex of the present invention enables modification of a target nucleotide sequence solely by introducing the double-stranded nucleotide complex, without introducing an exogenous nuclease or a gene encoding an exogenous nuclease into a cell, and is thus applicable to genome editing techniques with extremely high safety.

Embodiments disclosed herein include novel nucleic acid-guided nucleases, novel guide nucleic acids, and novel targetable nuclease systems, and methods of use. In some embodiments, engineered non-naturally occurring nucleic acid-guided nucleases, can be used with known guide nucleic acids in a targetable nuclease system. In certain embodiments, targetable nuclease systems can be used to edit targeted genomes of humans and other species. In some embodiments, methods include, but are not limited to, recursive genetic engineering and trackable genetic engineering methods.

The present disclosure relates, according to some embodiments, to systems, apparatus, compositions, methods, and workflows that include salt active nucleases (e.g., salt active nuclease variants) with desirable properties including, for example, salt tolerance.

The invention relates to the technical field of biomedical materials and tissue engineering, and discloses a preparation method and application of adjustable porous fat foam. Comprising the following steps: fat tissue pretreatment and freeze-thaw circulation, multi-step combined decellularization and impurity removal, graded washing and purification, freeze grinding and freeze drying, preparation of a decellularized fat matrix suspension, porous foam scaffold forming and foam scaffold gradient rehydration. By adopting a multi-step combined decellularization and impurity removal process, residual lipid droplets in adipose tissues can be actively extruded out by mechanical squeezing assisted by isopropanol degreasing, a lipid wrapping phenomenon is broken, meanwhile, residual nucleic acid and adipose components can be thoroughly removed by virtue of a synergistic degradation effect of nuclease and lipase, the immunogenicity risk is reduced, and the immunogenicity of the adipose tissues is improved. All the steps have a synergistic effect under strict control of temperature, concentration and time parameters, so that the structural integrity of the extracellular matrix is ensured, the decellularization efficiency and thoroughness are improved, and the biological safety and biocompatibility of a final product are ensured.

The present invention relates to variants of Cas12a nucleases having altered protospacer adjacent motif recognition specificity. The present invention also relates to methods of making CRISPR-CAS nuclease variants and methods of using the variants to modify nucleic acids.

The present disclosure provides nucleases and compositions, methods, and systems thereof for nucleic acid modification. More particularly, the present disclosure provides compositions and system comprising a nuclease comprising an amino acid sequence having at least 70% identity to any of SEQ ID NOs: 1-1096 and at least one gRNA.

The invention discloses a universal sample type nucleic acid releasing agent and application thereof. The nucleic acid releasing agent is prepared from the following components in molar concentration: 20 to 100 mM of Tris-HCl, 30 to 500 mM of sodium chloride, 30 to 200 mM of ammonium sulfate, 1 to 6 mM of EDTA (Ethylene Diamine Tetraacetic Acid), 1 to 8 mM of a reducing agent, 0.1 to 0.2 percent of sodium dodecyl sarcosinate, 0.1 to 3 mM of Surfactin, 5 to 30 percent of Chelex-100 and 5 to 15 percent of trehalose. According to the method, various samples can be mildly split, impurities such as impure proteins and lipids can be effectively removed, the complexity of nucleic acid samples is reduced, and the method is seamlessly jointed with subsequent PCR (Polymerase Chain Reaction); the kit has double effects of sample preservation and splitting decomposition, can strongly inhibit various nuclease, and can ensure the long-term storage stability of samples.