453 results about "MicroRNA" patented technology

A dual screen technique using DEL and 2DCS screens with libraries of synthesized small molecules and synthesized RNA structures (4,096 targets) delivers bona fide ligand-RNA 3D fold target pairs. One of the newly discovered ligands bound a 5′GAG / 3′CCC internal loop that is present in pri-miR-27a, the oncogenic precursor of microRNA-27a. The DEL-derived pri-miR-27a ligand is cell-active, potently and selectively inhibits pri-miR-27a processing to reprogram gene expression and halt an otherwise invasive phenotype in triple-negative breast cancer cells.

The invention relates to a preparation method of a microwave-assisted synthesized near-infrared electrochemical luminescence gold nanocluster and application of the gold nanocluster in miRNA (micro Ribonucleic Acid) detection. The preparation method comprises the following steps: under a stirring condition, adding a gold source and alkali into a Met solution to obtain a mixed solution, carrying out microwave irradiation reaction, and carrying out solid-liquid separation to obtain a Met-Au NCs solution; the preparation method comprises the following steps: activating a Met-Au NCs solution by using EDC and NHS, adding a DNA solution, mixing, and dialyzing to obtain a Met-Au NCs-DNA compound, namely the near-infrared electrochemical luminescence gold nanocluster. Compared with Au NCs prepared by a common mild method, the Met-stable Au NCs prepared by a microwave-assisted method has the advantage that the fluorescence and electrochemical luminescence efficiency at 835 nm is improved. The invention also provides a'signal closing 'ECL (electron cyclotron ligand) biosensor for high-sensitivity detection of the miRNA-107 (MicroRNA-107), and a method for detecting the miRNA-107 (MicroRNA-107). The sensor is simple to operate and good in repeatability, and has important scientific significance and application value for clinical early diagnosis of cancers.

Oncolytic viral vectors that incorporate one or more of the following features: viral replication restriction by insertion of microRNA (miRNA) target sequences into the viral genome; disruption of oncogenic miRNA function; cancer microenvironment remodeling; and cancer cell targeting by incorporation of protease-activated antibodies into the viral particle. Such viral vectors can be used for the treatment and prevention of cancer.

The invention provides a nucleic acid aptamer and a screening method thereof, the aptamer is of an oligonucleotide DNA structure, the nucleotide sequence of the nucleic acid aptamer is the nucleotide sequence of any DNA fragment as shown in SEQ ID NO: 1-9, and the nucleic acid aptamer can specifically target cardiac muscle cells (CMs). According to the invention, a new strategy can be provided for clinical treatment of cardiovascular diseases, and meanwhile, bioactive molecules such as microRNA (miRNA), small interfering RNA (small interfering RNA, siRNA), lipidosome, microspheres, microcapsules and the like can be carried to be used as an intracellular drug delivery tool.

The present invention relates to miRNA biomarkers from milk, such as exosome-derived microRNAs from milk, as an indicator of welfare in bovine animals. In particular, the present invention relates to the identification of heat stress in bovine animals, allowing management measures to be proposed to improve productive animal welfare at individual or veterinary levels.

The present disclosure relates to a compound including a nucleic acid sequence conjugated to an anti-microRNA or a microRNA-mimic or a compound including a modified anti-microRNA sequence, compositions of such a compound, and method of treatment of a disease, and method of suppressing microRNA activity by the disclosed compound or composition.

The invention provides a correlation prediction model training method, a correlation prediction method and a correlation prediction system, and the method comprises the steps: obtaining a plurality of training samples which are obtained through the construction of first sample multi-source features and second sample multi-source features with correlation labels, the first sample multi-source feature is a multi-source feature corresponding to sample micro ribonucleic acid, and the second sample multi-source feature is a multi-source feature corresponding to a sample physiological state type; inputting the plurality of training samples into a preset model, and training the preset model based on vertex vector representation output by a fusion feature layer of the preset model to obtain a trained association prediction model; and the fusion feature layer is used for carrying out fusion processing on the global attention fusion feature representation and the local attention fusion feature representation to obtain vertex vector representation. According to the invention, the association prediction accuracy of miRNA and physiological status types is improved.

Embodiments of the present disclosure include compositions and methods for conducting in situ hybridization reactions. In particular, the disclosure provides RNA blocking molecules that enhance the detection of target RNA molecules (e.g., mRNA molecules, micro RNA (miRNA) molecules, small non-coding RNA (sncRNA) molecules, PIWI interacting RNA (piRNA) molecules, and / or small interfering RNA (siRNA) molecules) by reducing the binding of a target probe to non-target RNA molecules in a sample.

The invention discloses a pore density related MicroRNA probe in a drought-resistant and water-saving corn variety as well as a detection method and application of the pore density related MicroRNA probe. The problem to be solved and solved is to predict, regulate and control drought tolerance and stomatal density of corn. The invention specifically discloses any one of the following applications of miRNA or a substance for detecting the miRNA: A1) an application in increasing the number of stomata of the gramineous plant and / or preparing a product for increasing the number of stomata of the gramineous plant; a2) application in a product for improving the stomatal density of the gramineous plants and / or improving the stomatal density of the gramineous plants; a3) application in reducing the drought tolerance of the gramineous plants and / or preparing products for reducing the drought tolerance of the gramineous plants; a4) a product for improving the in-vitro water loss rate of the gramineous plant and / or preparing the in-vitro water loss rate of the gramineous plant, wherein the miRNA sequence is as shown in the sequence 1. The drought tolerance and stomatal density of the leaves of the corn variety to be detected can be identified by detecting the expression quantity of the miRNA, and the miRNA can be used for industrial production.

The present invention relates miRNA biomarkers and in particular to a combination of miRNA biomarkers, e.g. exosome-derived microRNA, as indicators of welfare in bovines. In particular, the present invention relates to the identification of heat stress in bovines allowing to propose management actions to improve productive animal welfare at the individual or the herd levels.

The invention belongs to the technical field of biological medicines, and particularly relates to application of microRNA-21-3p as a target spot in preparation of a medicine for treating cerebral cavernous malformation. According to the application disclosed by the invention, it is determined for the first time that the microRNA-21-3p plays an important role in cerebral hemorrhage with cerebral cavernous malformation, the microRNA-21-3p can be used as a potential treatment target spot of the cerebral cavernous malformation, and the functions of vascular endothelial cells and pericytes can be effectively improved by improving the expression level of the microRNA-21-3p through a microRNA-21-3p agonist; therefore, a good effect of treating the cerebral cavernous malformation is achieved, and a theoretical basis is provided for researching a new target spot and a new strategy for treating the cerebral cavernous malformation.

The invention discloses a formula of kyllinga breviscapus for preventing and treating EV71 type infection, and relates to the technical field of medicines, and the formula comprises the following steps: S1, taking kyllinga breviscapus, and adding 6 times of volume of water into the kyllinga breviscapus; s2, decocting for three times, and decocting for 1 hour each time; s3, filtering the decoction, and merging the filtrate; and S4, carrying out reduced pressure concentration at-80 DEG C (the vacuum degree is-0.090 to-0.1 MPa) to obtain freeze-dried powder. Compared with the prior art, the application has the advantages that the enterovirus 71 is a microRNA viridae enterovirus group A member EV71, the kyllinga breviscapus has good inhibitory activity on the enterovirus 71, and the kyllinga breviscapus has important clinical application value on treatment of diseases infected with the enterovirus 71.

The present invention relates to functional nucleic acids that target FAN1 mRNA, or miRNAs that bind to FAN1 mRNAs, and thereby relieve microRNA mediated repression of FAN1. The invention also encompasses methods of enhancing FAN1 protein expression, and methods of treating or ameliorating diseases or disorders associated with FAN1, such as triplet expansion disorders, including those of the polyglutamine family of disorders, using the functional nucleic acids of the invention.

The invention discloses an anti-tumor molecular preparation of targeted ceramide kinase and application of the anti-tumor molecular preparation, and relates to the technical field of biology, the molecular preparation is a microRNA micromolecule EBV-miR-BART17-5p derived from EB virus coding, and the molecular preparation is applied to targeted down-regulation of expression of ceramide kinase genes and inhibition of activation of PI3K / AKT / NF-kappa B signal channels. The nucleotide sequence of the EBV-miR-BART17-5p simulant is UAAGAGGACGCAGGCAUACAAG, the nucleotide sequence of the EBV-miR-BART17-5p simulant The nucleotide sequence of the inhibitor is CUUGUAUGCCUGCGUCCUUUA, and the nucleotide sequence of the inhibitor is CUUGUAUGCCUGCGUCCUUUA. The compound is used for inhibiting proliferation, migration and invasion of gastric cancer cells and is further applied to preparation of drugs for treating gastric cancer.

The present invention relates miRNA biomarkers from milk. e.g. exosome-derived microRNA from milk, as indicators of welfare in bovines. In particular, the present invention relates to the identification of heat stress in bovines allowing to propose management actions to improve productive animal welfare at the individual or the herd levels.

The invention relates to the technical field of immune functions, in particular to a construction method of a microRNA regulation and control network for influencing calf immunity establishment. According to the method, the expression profiles of microRNA in colostrum and finished milk are obtained, the microRNA with high expression and obvious difference in colostrum compared with the finished milk is found, target gene prediction is carried out on the differentially expressed microRNA, gene annotation and enrichment analysis are carried out on the obtained target gene, the target gene enriched by the MAPK pathway related to immunoregulation in the enrichment analysis result is screened, and the immunoregulation related MAPK pathway related to the immunoregulation is screened to obtain the immunoregulation related MAPK pathway related to the immunoregulation related to the immunoregulation related to the immunoregulation related to the immunoregulation related to the immunoregulation related to the immunoregulation related to the immunoregulation. And a network regulation relation graph of the immune-related target gene and the microRNA regulated by the immune-related target gene is obtained, so that the key node target gene regulated by the microRNA in milk in the MAPK pathway and the correlation between the key node target gene and the microRNA are screened out, and a technical support is provided for further research and development of feed additives or regulating agents for industrially improving the immunity of the calves.

The invention relates to the technical field of medicine preparation, in particular to application of a microRNA244-5P inhibitor in preparation of a product for treating sepsis cardiomyopathy. According to the application of the microRNA 244-5P inhibitor in the preparation of the product for treating the sepsis cardiomyopathy, the sequence of the microRNA 244-5P inhibitor is shown as Seq. ID No. 1, and the microRNA 244-5P inhibitor can be applied to the preparation of the product for treating the sepsis cardiomyopathy. The provided microRNA 244-5P inhibitor lays a precise foundation for targeted treatment of sepsis cardiomyopathy. The inhibitor can specifically recognize and act on related targets, accurately intervene the pathological process of sepsis cardiomyopathy, has more stable structure and activity, can ensure that the inhibition effect can be continuously and efficiently played when a treatment product is prepared, provides a clear material basis and a technical basis for research, development, production and quality control of subsequent products, and has a wide application prospect. The pertinence and the effectiveness of treatment are greatly improved.

The invention provides oligonucleotide and / or oligonucleotide analogue molecules that are antagonists of a microRNA, preferably antagonists of human microRNAs hsa-miR-23b-3p and hsa-miR-218-5p, that comprise a mixture of phosphorothioate and phosphodiester linkages, and that are conjugated to at least one oleic acid molecule. Inhibiting these microRNAs allows to increase the endogenous levels of the corresponding proteins MBNL1 and / or MBNL2. The present invention further provides compositions comprising said oligonucleotides and / or oligonucleotide analogue molecules and their uses for the treatment and prevention of DM in a subject in need thereof.

The invention discloses a microRNA electrochemical detection method based on a functionalized porous membrane and DNA-RNA hybrid double-chain binding protein, and belongs to the technical field of biomedical detection. The detection method comprises the following steps: designing and synthesizing a complementary DNA (Deoxyribose Nucleic Acid) probe aiming at a target miRNA to be detected; a DNA probe is connected to the inner wall of a pore channel of the porous membrane in a gathering mode; after the target miRNA is combined with the DNA probe, adding protein which can specifically recognize and be combined with a DNA-RNA compound, blocking a porous channel of the porous membrane, and amplifying a signal; washing to remove uncombined protein; the current impedance change on the two sides of the porous membrane is detected through an electrochemical workstation, so that the target miRNA is detected. The detection method provided by the invention has the advantages of simplicity and convenience in operation, easiness in obtaining raw materials, low cost, obvious current impedance change, high sensitivity and the like.

The invention discloses a method for screening an active matter for protecting skin cell telomeres, and relates to the technical field of biotechnology and cosmetic development, and the method is technically characterized by comprising the following steps: a) providing stem cells derived from an exosome which carries at least one microRNA for regulating and controlling a telomere protection factor CTC1; b) acting a candidate active matter on the stem cells, and separating to obtain a treated exosome; the technical effects are as follows: the combination of miR-150-5p and miR-181c is delivered through the exosome, the dual-miRNA coordinated regulation is realized, the limitation of the traditional single-target detection is broken through, the CD63 / CD81 protein on the membrane surface of the exosome can be specifically combined with the skin cell membrane, and the Franz diffusion experiment verifies that the micro-fluidic chip integrates the collagen scaffold and the dynamic shear force.

The technologies as described herein relate to compositions and methods for the treatment of hemoglobinopathies by increasing fetal hemoglobin in a subject.

The invention discloses a method for improving the application efficiency of frozen semen of sheep, and relates to the field of animal reproduction and breeding science, and the method comprises the following steps: collecting semen, freezing half of the semen, then respectively carrying out exosome extraction and identification experiments, then carrying out pandorah sequencing on small non-coding RNA (Ribonucleic Acid), and finally obtaining the application efficiency of the frozen semen of the sheep. The small non-coding RNA in fresh semen and frozen semen is qualitatively and quantitatively analyzed, differential expression microRNAs are screened out, corresponding target genes and signal channels are analyzed, and the small non-coding RNA and the signal channels related to semen cryopreservation are screened out. Finally, the differentially expressed small non-coding RNAs are added into frozen semen in a manner of in-vitro chemical synthesis and the like, or are added in an auxiliary manner during in-vitro artificial insemination, or are delivered through lipidosome, so that the phenotype of an embryo after insemination is influenced, the conception rate of in-vitro artificial insemination is increased, the problem in practical production is favorably solved, and the economic benefit is increased. And economic values are created for enterprises.

The invention discloses application of a PdePin1At protein and a coding gene thereof in regulation and control of a plant tree form. According to the invention, a transgenic poplar with reduced PdePin1At gene expression quantity is constructed by using a microRNA interference technology, and experiments prove that compared with a wild poplar, the leaf area, the leaf width, the leaf length, the branch included angle, the petiole length and the phyllotactic angle of the transgenic poplar are reduced, and the number of leaves / stem nodes is increased. The method is of great significance to molecular mechanism and theoretical research of regulating and controlling poplar tree forms, leaf shapes and quantity, branch angles and phyllotaxis, and is of great guiding significance to directional cultivation of trees with tree forms meeting actual production requirements. Under the condition that the plant height is not changed, the number of leaves of newborn organs can be increased, so that the number of photosynthetic organs is increased; and by changing the included angle of the branches, sunshine shielding can be reduced during close planting of the forest trees. Therefore, the method also has important guiding significance on agricultural production.

The purpose of the present invention is to provide a novel method for increasing the number of newly generated neurons in the adult brain, and to provide a polynucleotide, a vector, and a pharmaceutical composition for use in the method. The present invention provides: a polynucleotide characterized by including (A) the nucleic acid sequence of the Plagl2 gene, (B) an miR-shRNA (microRNA adapted short hairpin RNA) nucleic acid sequence for the Dyrk1a gene, and (C) a promoter sequence operatively connected to the nucleic acid sequences; a vector including the polynucleotide; and a pharmaceutical composition including the polynucleotide and the vector.

The invention relates to an intramolecular strand displacement reaction-based microRNA detection method and kit, and the kit is characterized in that the kit comprises four single-stranded sequences forming a DNA tetrahedron, a probe S and DNA polymerase; a probe T structure is designed at the top end of the DNA tetrahedron, and the probe T is used for capture of the probe S and intramolecular strand displacement reaction triggered by microRNA to be detected. The DNA tetrahedral structure is utilized to enhance the probe fixing efficiency and stability, and the detection sensitivity is improved; signal amplification is realized through intramolecular strand displacement reaction, and the detection limit is as low as 5 * 10 <-17 > mol / L; good selectivity is achieved, and single-base mismatch sequences can be distinguished; the kit has good performance in serum samples and has practical application potential.

The present invention relates to a formulation comprising an oligonucleotide drug which is an antagonist of microRNA-21 as an active agent for administration to a human subject in need thereof by inhalation.

The present invention relates to compositions and methods for activating expression from the paternally-inherited allele of UBE3A in human Angelman's Syndrome neurons using viral vector delivery of short hairpin RNAs, ribozymes, and / or microRNAs.

The invention relates to application of a mir-331-3p inhibitor in preparation of a medicine for inhibiting malaria mosquito transmission, and belongs to the technical field of biological medicine. Aiming at the technical problems that the existing anti-malarial drug mainly acts on the later stage of plasmodium development and is lack of an effective propagation blocker, the invention provides the miR-331-3p inhibitor which is used for blocking the formation of plasmodium oocysts by inhibiting the interaction between microRNA and a mosquito target gene spetzle. Experiments show that the inhibitor can reduce the mosquito infection rate by about 50%, and has the characteristics of high targeting property, simplicity in operation and the like. The invention provides a novel drug development target for blocking malaria transmission, can effectively supplement the prevention and control blind area of the existing anti-malarial drug, and has important application value in the field of mosquito-borne infectious disease control.

Disclosed are compositions, methods, and kits for modifying DNA within cells as well as compositions and methods for modifying gene expression in a cell. In particular, the invention generally relates to compositions, methods, and kits for DNA editing using single-stranded DNA. Compositions and methods for modifying gene expression using artificial microRNAs (amiRNA) are also contemplated.

The application belongs to the technical field of biomedical engineering, and specifically discloses a nano gene composition for treating brain glioma and a preparation method thereof, which is synthesized from bovine serum albumin loaded manganese dioxide particles, PLGA, DSPE-PEG3000 and DSPE-PEG-Angiopep2 as raw materials; the average particle size of the nano gene composition is 122.18±31.3 nm. The application also discloses a preparation method of the nano gene composition. The nano gene composition provided by the application encapsulates miRNA-138 in PLGA to avoid the degradation of miRNA-138 by RNA enzymes in the body, and simultaneously utilizes the targeting property of Angiopep2 to target the delivery of the nano gene composition to tumor tissues, to deliver microRNA into the brain while reducing tumor hypoxia and increasing the sensitivity of cells to X-ray irradiation, so as to realize multidirectional comprehensive treatment of glioblastoma.