184 results about "Microsatellite" patented technology

The invention relates to a pigeon individual typing detection system, a kit and application thereof. The kit comprises a pigeon individual typing detection system, the pigeon individual typing detection system comprises a primer combination and a composite amplification premix, and the primer combination comprises primers for amplifying 23 STR (short tandem repeat) microsatellite markers, bird sex detection CHD gene loci and 5 SNP (single nucleotide polymorphism) genetic markers. The pigeon individual typing detection system and the kit provided by the invention can realize single-tube detection of 29 pigeon DNA genetic markers, comprise STR genetic markers for realizing pigeon individual identification and parent-child relationship identification and single nucleotide polymorphism genetic markers for evaluating the flying ability of pigeons, and are a detection system which can be detected at present and contains the maximum number of pigeon DNA gene loci; the method has a good application prospect in the fields of pigeon identity identification, parent-child relationship identification and flight ability evaluation.

The invention discloses a multi-satellite cooperative distributed game control method and device, a computer program and a storage medium, belongs to the technical field of spaceflight, and particularly relates to a satellite attitude control and game control method. The problem that in the prior art, resolving of the overall control quantity depends on a center unit, and constraint processing on the size of the microsatellite control torque is not accurate enough is solved. The method comprises the following steps: S1, according to attitude dynamics modeling and pseudo-linearization processing of the combined spacecraft, obtaining a state dependence coefficient model; s2, obtaining a local optimal control strategy of each satellite in the combined spacecraft through a model prediction control method according to the state dependence coefficient model in combination with a dynamic model in a prediction time domain and flywheel constraint conditions; and S3, obtaining a distributed Nash equilibrium solution through a distributed iteration and global coordination method according to the local optimal control strategy of each satellite in combination with communication topology information. The method is suitable for efficient cooperation tasks of large-scale satellite groups and microsatellite systems.

The invention discloses SSR (simple sequence repeat) multiple PCR (polymerase chain reaction) primers for paternity test of grass carp and application of the SSR multiple PCR primers. The primers comprise 16 pairs of specific primers, and base sequences of the 16 pairs of specific primers are respectively shown as SEQ ID NO.1-32 in sequence. The invention further discloses a fish paternity test kit comprising the SSR multiple PCR primer, an SSR multiple fluorescent PCR method for grass carp paternity test and application of the SSR multiple PCR primer, the kit or the method in grass carp paternity test. According to the kit, 16 pairs of specific SSR primers, multiple fluorescent PCR and a universal amplification primer technology are combined, 16 sites can be detected at a time, universal primers can be repeatedly used, and compared with simple single-site detection, the efficiency is improved, and the cost is reduced; the microsatellite loci contained in the invention are 3-6 basic groups, the allele size interpretation is more accurate, and the accuracy of genotype data is improved.

The invention belongs to the technical field of animal genetic breeding, and particularly discloses an SNP (Single Nucleotide Polymorphism) chip for distinguishing five kinds of Hubei native cattle (yi-ling cattle, Dabie mountain cattle, troilin cattle, Enshi cattle and delta mountain cattle). Candidate SNP loci are obtained by combining whole genome sequencing and three selection signals (Tajima's D, FST and pi ratio), then the candidate loci are subjected to random forest scoring, the number of the needed SNP loci is further reduced, finally, an SNP locus combination with variety specificity is obtained, probes are designed according to the SNP loci and 60 bp sequences before and after the SNP loci, and the variety specificity is obtained. The SNP chip for distinguishing five kinds of Hubei native cattle can be developed, technical support is provided for variety breeding of Hubei native cattle, and meanwhile, compared with a traditional pedigree and microsatellite variety identification method, the SNP chip has the advantages of being high in accuracy and easy to operate.

The invention provides an altered mineral recognition model construction method and system and a storage medium, and relates to the technical field of geological exploration, and the method comprises the steps: obtaining remote sensing data of a geological resource environment hyperspectral microsatellite for a target region; performing feature enhancement on the remote sensing data through a band ratio method to obtain band ratio features of the remote sensing data; performing principal component analysis on the remote sensing data to obtain principal component characteristics of the remote sensing data; splicing the waveband ratio feature, the principal component feature and the remote sensing data to obtain a high-dimensional feature matrix, and allocating an actual target mineral proportion to each pixel in the high-dimensional feature matrix according to preset mineral sample data; and training the initial recognition model according to the high-dimensional feature matrix and the actual target mineral proportion, and taking the trained initial recognition model as an altered mineral recognition model. According to the method, through multi-dimensional feature extraction and an advanced machine learning algorithm, the recognition effect on altered minerals is remarkably improved.

The invention discloses a satellite ground staring attitude control multi-software joint simulation system and a construction method thereof, and belongs to the technical field of computer simulation, and the construction method comprises the steps: 1, constructing an ADAMS-based microsatellite ontology model; 2, constructing a satellite orbit model and an attitude sensor model based on STK; step 3, constructing a torque execution mechanism model based on MATLAB (matrix laboratory) and Simulink; 4, designing an attitude determination algorithm and a control algorithm of a ground staring task simulation model capable of combining a microsatellite body model, a satellite orbit model, an attitude sensor model and a torque execution mechanism model; according to the method, ADAMS, STK and MATLAB are combined to simulate a satellite body, an attitude sensor, a torque execution mechanism and a running orbit, the attitude control task of the satellite is simulated, and the method has the advantages of being good in simulation effect and visual and intuitive in simulation process.

The invention discloses a grass carp marker release effect evaluation method, which specifically comprises the following steps: dividing released grass carps into large grass carps and small grass carps, implanting microsatellite markers into abdominal cavities of the large grass carps, and fixing external markers on dorsal fins of the small grass carps; the released grass carp is subjected to fin ray cutting sampling, and the age, the weight and the shape of the grass carp are recorded; constructing a sample genetic archive; recapturing the released groups; and identifying the recaptured individuals, and counting released individuals in the recaptured grass carp. The larger the recapture rate is, the better the enhancement and release effect is, so that the contribution of the enhancement and release of the grass carps to the ecological quantity of all the grass carps in the river is estimated, and the enhancement and release effect of the grass carps is determined. The method is beneficial to recovery of the number of the grass carps in the river, the releasing effect of the grass carps can be known, the releasing method is improved in time, and the method has great popularization value.

The invention discloses a communication and remote control integrated intelligent satellite sensing processing system, and aims to solve the problems of poor timeliness, low efficiency, insufficient on-satellite computing power and the like due to mutual independence of remote sensing and communication functions and data relying on back-to-ground processing in a traditional satellite system. Through a remote communication integrated hardware system architecture, a storage and calculation integrated AI computing platform, a multi-modal intelligent processing algorithm and a satellite in-orbit remote communication collaborative algorithm, and through the synergistic effect of all the parts, the efficient remote sensing and communication functions of the micro-nano satellite under the condition of resource limitation are realized. According to the method, communication and remote sensing loads are set on a commercial satellite, deep collaboration of multi-spectrum remote sensing imaging, high-sensitivity satellite Internet of Things communication and satellite-borne AI edge calculation is achieved through a satellite-end high-computing-power AI computer, an on-satellite intelligent processing closed loop is constructed, and the satellite comprehensive sensing efficiency is remarkably improved.

The invention discloses a microsatellite primer for identifying germplasm of siniperca chuatsi and siniperca chuatsi and an identification method, and aims to effectively distinguish the siniperca chuatsi from the siniperca chuatsi The microsatellite primer comprises nucleotide sequences as shown in SEQ ID NO. 1-20, a nucleotide sequence as shown in SEQ ID NO. The identification method comprises the following steps: carrying out PCR amplification on extracted DNA of a sample to be identified, a siniperca chuatsi reference sample and a siniperca chuatsi reference sample by using the microsatellite primer, carrying out electrophoretic separation on the obtained amplification product, carrying out clustering analysis on the electrophoretic separation result, and judging that the sample to be identified is siniperca chuatsi if the sample to be identified is clustered to the siniperca chuatsi reference sample. The sample to be identified is clustered to the siniperca chuatsi reference sample, and the siniperca chuatsi reference sample is judged to be The method can accurately, quickly and effectively identify the germplasm of the siniperca chuatsi and the siniperca chuatsi, and provides technical support for field germplasm resource investigation of the siniperca chuatsi and the siniperca

The invention relates to a primer group of a microsatellite marker HA223 related to growth of belly-expanding hippocampus and application of the primer group, and belongs to the field of molecular biology, and the sequence of the primer group is shown as SEQ ID NO.1-2. The invention also provides an application of the primer group in breeding of growth traits of hippocampus erectus, the primer group is utilized to perform PCR amplification on DNA of a hippocampus erectus individual, an individual which can amplify a specific fragment with the size of 260bp is screened as a basic parent, and a heterozygous individual or a homozygous individual with the fragment is produced and used for breeding of a rapid growth variety, so that the breeding of the growth traits of the hippocampus erectus is facilitated, and the breeding efficiency of the hippocampus erectus is improved. Compared with a conventional breeding method, the method can shorten the breeding period, accelerate the breeding process and improve the breeding efficiency.

The invention relates to a magnetic control method for a single-axis sun-oriented stable attitude of an optical microsatellite, and relates to the technical field of aerospace. The magnetic control method comprises the following steps: step 1, modeling optical microsatellite attitude dynamics adopting magnetic control; 2, calculating the posture of the single axis to the sun; 3, calculating an attitude control expected moment; and 4, calculating the expected magnetic moment of the magnetic torquer. According to the magnetic control method for the single-axis sun-oriented stable attitude of the optical microsatellite, the single-axis sun-oriented stable attitude control of the satellite can be realized under the condition of extremely low power consumption, and the energy stability of a non-task long-term mode and the reliable operation of the satellite can be ensured.

The invention discloses SSR (Simple Sequence Repeat) multiple PCR (Polymerase Chain Reaction) primers for megalobrama amblycephala paternity test and application, the primers comprise seven pairs of specific primers, namely a primer pair MamGLB2501, a primer pair MamGLB2502, a primer pair MamGLB2503, a primer pair MamGLG2504, a primer pair MamGLG2505, a primer pair MamGLR2506 and a primer pair MamGLR2507, and the base sequences of the seven pairs of specific primers are sequentially shown as SEQ ID NO.1-14; the invention also discloses an SSR multiplex fluorescent PCR method for megalobrama amblycephala paternity test by using the primer and application of the primer or the method in megalobrama amblycephala paternity test. The microsatellite site amplified by the primer is 3-6 base repetition, the typing is accurate, and the polymorphism of the amplified site is high; the method is accurate in identification and low in price.

The embodiment of the invention discloses a preparation method of a kit applied to endometrial cancer microsatellite state detection. The preparation method comprises the following steps: taking a first preset volume of polymerase chain reaction amplification liquid; taking a polymerase chain reaction primer mixed solution with a second preset volume; and combining the weighed polymerase chain reaction amplification liquid and polymerase chain reaction primer mixed liquid into the kit applied to endometrial cancer microsatellite state detection. According to the embodiment, the accuracy and the stability of microsatellite state detection of the endometrial cancer can be improved, so that the kit consumed by repeatedly detecting the microsatellite state in the endometrial cancer is reduced.

The invention relates to a primer group of a microsatellite marker HA88 related to growth of belly-expanding hippocampus and application of the primer group, and belongs to the field of molecular biology, and the sequence of the primer group is shown as SEQ ID NO.1-2. The invention also provides an application of the primer group in breeding of growth traits of hippocampus swelling, DNA of a hippocampus swelling individual is subjected to PCR amplification by using the primer group, an individual capable of amplifying a specific fragment with the size of 245bp is screened as a basic parent, and a heterozygous individual or a homozygous individual with the fragment is produced for breeding of a rapid growth variety, so that the breeding of the growth traits of the hippocampus swelling individual is realized, and the breeding of the growth traits of the hippocampus swelling individual is realized. Compared with a conventional breeding method, the method can shorten the breeding period, accelerate the breeding process and improve the breeding efficiency.

The invention provides a microsatellite genotyping method, and belongs to the technical field of genotyping. According to the microsatellite genotyping method, a bar code primer is introduced into a microsatellite primer, and the bar code primer comprises a bar code and a universal primer. The universal primer can be used for increasing PCR products obtained by the microsatellite primer so as to supplement a target product obtained by the microsatellite primer, the problem of amplification of a low-quality DNA template is solved, the library building success rate is remarkably increased to 90-100% from 60-70%, the library building and sequencing times are remarkably reduced, the sample number of each time of library building and sequencing is increased, and the library building and sequencing efficiency is improved. The method has the remarkable advantages of low cost and high accuracy.

The present invention belongs to the field of molecular biology technology, and specifically relates to a microsatellite primer set for identifying yellow sand softshell turtle varieties, comprising a first primer set and a second primer set, wherein the sequence of the first primer set comprises: an upper primer: CTGAAGTCTGGCACTAAGCTTTCC, a lower primer: GTCTAAATTCCGAAGCGGGTAAAA; the sequence of the second primer set comprises: an upper primer: TAGCCCCGAGATTATCAGAGACAG, a lower primer: TGTGGCTGGTTGGTGTAGTAAGAA, and application of the microsatellite primer set in identifying yellow sand softshell turtle varieties. The microsatellite primer set proposed by the present invention has high conservatism and high versatility, and can accurately and quickly identify yellow sand softshell turtle varieties, thereby effectively improving the accuracy of identifying yellow sand softshell turtle varieties.

The present disclosure provides single- or double-stranded interfering RNA molecules (e.g., siRNA) that target a MutS Homolog 3 (MSH3) gene. The interfering RNA molecules may contain specific patterns of nucleoside modifications and internucleoside linkage modifications, as pharmaceutical compositions including the same. The siRNA molecules may be branched siRNA molecules, such as di-branched, tri-branched, or tetra-branched siRNA molecules. The disclosed siRNA molecules may further feature a 5′ phosphorus stabilizing moiety and / or a hydrophobic moiety. Additionally, the disclosure provides methods for delivering the siRNA molecule of the disclosure to the central nervous system of a subject, such as a subject identified as having Huntington's Disease.

The invention discloses a method for detecting the state of a microsatellite site BAT-26, and belongs to the field of biological medicine, the sequences of a primer and a probe are shown in SEQ ID No: 1 to SEQ ID No: 11, the primer and the probe are adopted for detecting the state of the microsatellite site BAT-26 through a quantitative PCR end point fluorescence signal ratio method, the method has the advantages of being easy and rapid to operate and objective in result interpretation, uncovering electrophoresis detection is not needed, the detection time is shortened, and the detection efficiency is improved. Meanwhile, an expensive sequencer does not need to be purchased, and analysis can be carried out only by one fluorescent quantitative PCR instrument, so that the method is convenient to popularize.

The invention discloses an SSR (Simple Sequence Repeat) primer composition for evaluating genetic diversity of channel catfish breeding population and an application method of the SSR primer composition, and belongs to the technical field of fish genetic breeding. The method comprises the following steps: modifying 5'ends of forward primers of the primers by using FAM fluorophores respectively, amplifying genome DNA of each breeding group by using the 10 pairs of microsatellite site primers respectively, analyzing amplification products, reading genotypes, analyzing parameters, and determining the genotype of the breeding group. The analysis result is used for evaluating the population polymorphism, the variation condition of the population genetic structure and the genetic differentiation degree among the populations. By applying the evaluation method disclosed by the invention, the population genetic diversity and genetic structure of continuous breeding generations of channel catfish can be systematically evaluated. The SSR primer and the genetic diversity evaluation method can be used for genetic improvement and new variety breeding of channel catfish.

This invention discloses a composite attitude control method for the maneuvering phase of a microsatellite. The method includes: constructing a novel composite actuator based on a zero-momentum gear train and a two-dimensional translational mechanism; establishing and optimizing attitude rotational dynamics and slider translational dynamics models considering inertial principal axis offset and additional disturbance torque; designing an exponentially convergent disturbance observer to monitor thrust eccentricity torque in real time; and designing an attitude control loop MPC (Model Predictive Control) controller and a thrust eccentricity torque compensation loop discrete PID (Proportional-Integral-Derivative) controller to form a dual-closed-loop composite attitude control system. This control method can effectively observe slowly time-varying thrust eccentricity torque, and features high control accuracy and no saturation in the momentum gear train, making it suitable for long-term thrust eccentricity disturbances in microsatellite maneuvering missions.

The invention discloses a method for counting the number of wild rock sheep based on a microsatellite molecular marker. The method comprises the following steps: preprocessing a rock sheep manure sample and extracting DNA (Deoxyribonucleic Acid); performing double PCR amplification on the microsatellite marker, wherein each group of microsatellite primers comprises two pairs of specific primers; carrying out electrophoresis separation on a PCR product by using 12% polyacrylamide gel, and reading the size of an allele fragment of each microsatellite site through GeneMapper software after silver staining and developing; analyzing the acquired allele data by using software, and counting the number of different wild rock sheep individuals in the region according to an individual identification standard; the individual identification standard is as follows: if the genotypes of all 10 microsatellite loci are completely the same, or only one allele of one locus is different, the same individual is determined. The method is particularly suitable for non-invasive individual identification, genetic relationship identification and population quantity statistics of plateau wild rock sheep populations, and provides technical support for rock sheep resource protection and dynamic monitoring.

The invention relates to the technical field of computer images, and provides a spatial weak moving target detection method and system driven by time sequence image registration, and the method comprises the steps: obtaining a time sequence image short sequence of spatial weak moving target detection; inter-frame registration is carried out on the time sequence image short sequence to obtain a registration transformation matrix, and geometric correction is carried out on subsequent frames to complete space registration; double labeling is carried out based on the time sequence data after space registration is completed; and inputting the time sequence image short sequence subjected to spatial registration into a trained target detection model to obtain a detection result, and performing inter-frame registration on the time sequence image short sequence and constructing double annotations based on a motion sequence frame and coordinate points. The weak moving target can still keep feature alignment and track consistency under the conditions of cross-frame background disturbance and low signal-to-noise ratio; in combination with a cooperative structure of the encoder and the two-stage detection head, detection and high-precision positioning of weak targets such as space debris and microsatellites are realized, and the detection stability and accuracy of the weak and small moving targets in the space are improved.

The utility model discloses an intelligent monitoring device for precise orbit flight of a microsatellite, which is characterized in that the upper end of a bottom column is provided with a lifting assembly, the upper end of the lifting assembly is fixedly connected with a supporting column, the upper end of the supporting column is fixedly connected with a bearing plate, the upper surface of the bearing plate is fixedly connected with a monitoring device body, and the bearing plate is provided with a through hole; a first sliding rod is slidably connected to the inner surface of the through hole, a connecting plate is fixedly connected to the other end of the first sliding rod, a mounting hole is formed in the bearing plate, an electric push rod is fixedly connected to the inner surface of the mounting hole, and the other end of the electric push rod is fixedly connected to the rear surface of the connecting plate. When the device is in a standby state, the protective shell can be moved to provide physical protection, the collision resistance is remarkably improved, meanwhile, a brush and a spray head in the protective shell can effectively clean dust on the surface of the device, the monitoring accuracy is ensured, and therefore the reliability of monitoring data is improved.

The invention provides a cold air thruster of a microsatellite. The cold air thruster is integrated with a valve assembly, a piezoelectric actuator, an elastic mechanism, a capacitance displacement sensor, a flow sensor and a control unit. The valve assembly is driven by the executing mechanism, the gap between the disc-shaped diaphragm and the valve port is accurately regulated and controlled, and fine adjustment of gas flow and thrust is achieved. And the piezoelectric ceramic and elastic design of the actuating mechanism ensures that the valve is normally opened and quickly responded. The sensor system optimizes the control accuracy through feedback of a capacitance sensor and a flow sensor. The double-closed-loop control strategy adjusts driving voltage based on displacement and flow information, improves dynamic response and reduces control noise. The shell assembly provides comprehensive protection. The problems that in the prior art, thrust control precision is low, dynamic response performance is poor, and control noise is large can be effectively solved.

The invention discloses a spiro derivative serving as a WRN helicase inhibitor and application of the spiro derivative. The spiro derivative has better WRN helicase inhibitory activity, can be used for inhibiting growth of microsatellite unstable (MSI) tumor cells by inhibiting high-level DNA double-strand breakage (DSB) in microsatellite unstable (MSI) cells caused by WRN, is used for preventing and / or treating related cancers, especially colorectal cancer, gastric cancer, ovarian cancer, endometrial tumor and the like, and has a good application prospect. The vacancy of specific MSI type cancer targeting drugs can be filled, and the application prospect and value in the field of medicines are very good.

The present invention relates to the microsatellite marker technology of forest musk deer, and specifically relates to a microsatellite locus combination, primer combination, kit and individual tracing application of forest musk deer. The purpose is to solve the technical problem of inaccurate identification results in the existing forest musk deer gene identification using microsatellite marker locus technology, and provide a microsatellite locus combination, primer combination, kit and individual tracing application of forest musk deer. By adopting a suitable locus combination with four-base repeats, accurate individual tracing of forest musk deer based on gene identification is achieved. The present invention uses 8 microsatellite loci that can best reflect the gene characteristics of forest musk deer, and provides the corresponding primer combination and kit. By using the primer combination and kit, high-precision individual tracing of forest musk deer is achieved, with an accuracy of 99.999%, and it has the advantages of being fast, accurate, simple and having a relatively low implementation cost.

The utility model discloses a bi-directional micro-pushing multi-unit iodine working medium storage and supply system, which comprises a bottom plate, a control power supply, two mounting plates, a plasma micro-pushing device, an iodine working medium storage and supply unit and a multi-stage conveying pipeline, the control power supply is arranged at the position close to the edge of the bottom plate, the two mounting plates are oppositely fixed at the two ends of the bottom plate, and the plasma micro-pushing device is arranged on the plasma micro-pushing device. The plasma micro-pushers are respectively fixed on the two mounting plates, the plurality of groups of iodine working medium storage and supply units are arranged, the multi-stage conveying pipeline comprises a working medium conveying main pipe, two groups of working medium conveying branch pipes and a plurality of working medium access pipelines, the two groups of working medium conveying branch pipes are symmetrically arranged at the two ends of the working medium conveying main pipe, and the working medium access pipelines are connected with the working medium conveying main pipe. The working medium access pipelines are respectively connected with the plasma micro-thruster, and each working medium access pipeline is connected with one iodine working medium storage and supply unit. By means of the mode, the motion adjusting efficiency of the microsatellite can be improved, the operation reliability of the whole system in the outer space is enhanced, and the overall service life of the microsatellite is prolonged.

The invention relates to the technical field of satellites, in particular to a multi-layer solar wing adjusting device suitable for microsatellites, which is characterized in that support plates perpendicular to a mounting surface are symmetrically arranged at two ends of a base, a fixing plate which is orthogonally distributed with the support plates is arranged at the other end of the base, and a coaxial limiting hole is formed in the center of the end surface of each support plate; a shaft hole penetrating through the supporting plate is formed in the center of the bottom face of the limiting hole, the two sets of solar wings are symmetrically arranged on the two sides of the base, each set of solar wings rotatably penetrates through the shaft hole through a rotating shaft, and one end of each rotating shaft extends out of the outer side face of the supporting plate to form a cylindrical transmission shaft. Dynamic tracking of the incident angle of sunlight is realized, and the intelligent control mechanism can ensure that the solar panel always receives sunlight irradiation at the optimal angle.

The present invention relates to a method for detecting mutations at microsatellite sequence loci in a target fragment from a DNA sample, the method comprising subjecting the DNA sample to digital polymerase chain reaction (PCR) in the presence of a PCR solution comprising: a pair of primers suitable for amplifying a target fragment from the DNA sample, the target fragment containing a microsatellite sequence; a first MS oligonucleotide (MS) hydrolysis probe labeled with a first fluorophore, the first MS oligonucleotide probe being complementary to a wild-type sequence containing the microsatellite sequence; and a second oligonucleotide reference (REF) hydrolysis probe labeled with a second fluorophore, the second oligonucleotide REF probe being complementary to a wild-type sequence of the target DNA fragment that does not contain the microsatellite sequence. The present invention also encompasses methods for diagnosing and prognosing cancer and methods for determining the efficacy of cancer treatments. The present invention also includes kits for detecting mutations in microsatellite sequences. [Selection diagram] Figure 4

This invention discloses a method for evaluating the effectiveness of stock enhancement and release based on microsatellite markers. The method involves collecting a dataset of recaptured samples of released species; obtaining microsatellite genetic data of released broodstock, released fry, and recaptured samples; performing consistency processing on the microsatellite genetic data of released broodstock to supplement the virtual parent microsatellite genotype database; generating an allele contribution probability weight matrix to obtain an allele contribution probability dataset of recaptured samples; generating a basic matching list to construct a contribution weight dataset; and outputting the stock enhancement and release contribution rate evaluation results and storing them in a stock enhancement and release evaluation database. This invention makes the stock enhancement contribution rate no longer simply dependent on the number of matches, but comprehensively reflects the true contribution of recaptured individuals in the overall genetic background, thus improving the accuracy and robustness of stock enhancement and release effectiveness evaluation from an algorithmic perspective.