303 results about "Genetic diversity" patented technology

The invention discloses a sugarcane germplasm resource evaluation and breeding method for smart agriculture. The sugarcane germplasm resource evaluation and breeding method comprises the following steps: step 1, collecting materials with wide genetic diversity; establishing an intelligent incubator and a greenhouse, and monitoring environmental parameters by using an Internet of Things sensor; 2, performing data acquisition on the related germplasm resources by using an unmanned aerial vehicle, a robot and a near infrared spectrum technology, and constructing a phenotype database for data management; meanwhile, genotype identification is carried out by combining molecular marker-assisted selection and genome selection technologies, molecular markers of key genes are mined, and the genetic value of related germplasm is evaluated; step 3, constructing a hybrid combination prediction model by using an AI algorithm, optimizing parent matching of the related germplasm and the cultivated sugarcane, monitoring and collecting the filial generation at the same time, and analyzing and screening in combination with smart agriculture; 4, demonstration planting is conducted on the bred excellent sugarcane strain, and application of the excellent strain is improved through government-enterprise-scientific research institution collaborative popularization and in combination with farmer technical training.

The invention discloses a cowpea 5K SNP (Single Nucleotide Polymorphism) liquid chip and application thereof in variety identification, and belongs to the technical field of biology. The liquid chip provided by the invention comprises a set of nucleotide probes for detecting 5847 SNP sites of cowpea, and can be widely applied to different scenes of germplasm resource identification, genetic diversity evaluation, variety identification, genetic relationship identification, purification and rejuvenation of local varieties and the like of different cowpea varieties; an effective scientific basis is provided for cowpea variety identification, the variety identification and evaluation efficiency is improved, and the method has a remarkable application value.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination for constructing an oat DNA (Deoxyribose Nucleic Acid) fingerprint spectrum and application, the SNP molecular marker combination is developed and obtained based on an SLAFseq technology, and has the characteristics of uniformly covering an oat genome, being high in polymorphic information content and being suitable for typing. Compared with other traditional molecular marker technologies, the SNP marker provided by the invention has higher stability, is not easily influenced by experimental conditions and environmental factors, and can be widely applied to oat germplasm resource identification, genetic diversity analysis, DNA fingerprint construction and molecular marker-assisted breeding. The DNA fingerprint spectrum constructed on the basis of the SNP molecular marker can more comprehensively reflect genetic information of a biological individual or population, and is of great significance to research of genetic diversity, evolutionary relationship and the like of species. Therefore, the method can provide technical reference for popularization of oat varieties, property right confirmation and protection, purity identification of oat seed production and the like.

The invention discloses a tea tree liquid phase chip and application thereof, and relates to the technical field of molecular detection. The invention discloses a tea tree liquid phase chip and application thereof, according to site screening requirements and probe design principles, the tea tree liquid phase chip comprises 5781 SNP sites, and tea tree resource genetic typing can be realized based on a target interval genome sequence liquid phase capture accurate positioning sequencing typing technology. The tea tree liquid chip can realize low-cost genetic typing, is mainly specific to tea trees, can realize variety identification and genetic relationship analysis of the tea trees, scientifically guides hybridization improvement work of the tea trees and assists protection and development of germplasm resources of the tea trees, and has relatively high application values in multiple fields of tea tree breeding. The tea tree liquid phase chip can be used for tea tree genetic diversity evaluation, germplasm resource and genetic relationship identification, genetic map construction and gene localization, whole genome association analysis and tea tree molecular marker assisted breeding.

The invention discloses a silver carp 20K liquid phase chip and application thereof, the liquid phase chip comprises a probe combination of 20,909 SNP molecular markers covering a whole genome, the physical positions of the 20,909 SNP molecular markers are determined based on sequence alignment of the silver carp genome (GCA041475455.1), and the site information of the 20,909 SNP molecular markers is shown in the specification table 1. The invention provides a silver carp first type whole genome SNP liquid phase breeding chip, which effectively reduces the application cost of silver carp in genetic diversity analysis, QTL positioning, GWAS analysis and the like in scientific research, solves the problem that no applicable product exists in silver carp molecular auxiliary breeding and whole genome selective breeding, accelerates the progress of silver carp basic research and breeding, and has a wide application prospect. The method is of great significance in improving the utilization efficiency of silver carp germplasm resources, accelerating the breeding process of excellent characters and improving the economic value and environmental adaptability of bred varieties.

The invention provides an SNP (Single Nucleotide Polymorphism) site combination for genetic typing of micropterus salmoides and application of the SNP site combination. The SNP locus combination comprises 50000 SNP loci, and the positions and base information of the 50000 SNP loci on chromosomes are as shown in a table 3. By applying the micropterus salmoides whole genome liquid chip of the SNP site combination for genotyping of micropterus salmoides, provided by the invention, the genotype of a sample to be detected can be rapidly and accurately detected, and the average detection rate of the SNP sites and the average consistency rate of the genotype of the sample are as high as 99.95%; the micropterus salmoides whole genome liquid phase chip has the characteristics of high capture specificity, low cost, flexible sites and the like, is suitable for character breeding and improvement, gene mining, genetic relationship identification, genetic diversity analysis and the like of micropterus salmoides, and can effectively improve the breeding efficiency and accuracy of improved varieties of micropterus salmoides; and a new variety of largemouth micropterus salmoides which is more suitable for market requirements and is more competitive can be cultivated.

The invention provides an Indel molecular marker primer combination for identifying different populations of sargassum and a detection method and application of the Indel molecular marker primer combination, and belongs to the technical field of germplasm identification and genetic diversity analysis of macroalgae. The Indel molecular marker primer combination disclosed by the invention comprises an Indel-F1 / R1 and an Indel-F2 / R2, wherein the Indel molecular marker primer combination comprises an Indel molecular marker primer and an Indel molecular marker primer; the sequence of the Indel-F1 is as shown in SEQ ID NO. 1, and the sequence of the Indel-R1 is as shown in SEQ ID NO. 2; the sequence of the Indel-F2 is as shown in SEQ ID NO.3, and the sequence of the Indel-R2 is as shown in SEQ ID NO.4. The Indel molecular marker primer combination disclosed by the invention can be used for accurately identifying a creeping branch population and a guede population of a guede line and quickly distinguishing from other common sargassum, and has important significance in the aspects of resource protection, research and utilization of the sargassum.

The invention relates to a mytilus coruscus byssus adhesion protein gene Mfp5 coding region SNP marker and application thereof, the mytilus coruscus byssus adhesion protein gene Mfp5 coding region SNP marker comprises a gene sequence numbered as an McMfp5 coding region, the nucleotide sequence of the gene sequence is shown as SEQ ID No.1, an SNP marker primer pair is designed based on the sequence, three SNP markers numbered as McMfp51, McMfp52 and McMfp53 are obtained through sequencing, and the primer sequences of the three SNP markers are shown as SEQ ID No.2 and SEQ ID No.3 in sequence. The primer designed aiming at the gene sequence of the McMfp5 coding region is used for SNP (Single Nucleotide Polymorphism) marker typing, is high in specificity, stable in amplification and high in polymorphism, can be used for genetic diversity analysis, germplasm identification and marker-assisted selection breeding of mytilus coruscus populations, and provides a powerful tool for genetic breeding of mytilus coruscus.

The invention relates to a gene related to the body color character of paramisgurnus dabryanus, a primer group of an SNP marker and application of the primer group, and belongs to the technical field of molecular markers, and the nucleotide sequence of the gene is as shown in SEQ ID NO.1. The invention also provides a primer pair for detecting the body color related SNP marker herc2-105, and the nucleotide sequence of the primer pair is as shown in SEQ ID NO: 2-3; the SNP marker herc2-105 is located at the 105bp position of the nucleotide sequence of the gene, and the polymorphic form of the SNP marker herc2-105 is A / T. Wherein the AA genotype individual has a golden red body color, and the AT and TT genotype individuals have a wild body color. The molecular marker provided by the invention can be used for body color character breeding of the golden red paramisgurnus dabryanus, the genetic diversity of population offspring is effectively increased, and the breeding process of new body color variety breeding of the red paramisgurnus dabryanus is remarkably promoted.

The invention discloses a dynamic evaluation system for a biodiversity resource response mechanism, and relates to the technical field of biological resources. A target enterprise resource monitoring region is divided into sub-regions through a biological resource evaluation value analysis module; and obtaining a species diversity adaptation value, a genetic diversity adaptation value, an ecosystem diversity adaptation value and an inter-organism mutual adaptation value of each sub-region adjacent to the historical cycle. The multi-dimensional analysis mode can comprehensively and deeply reflect various aspects of biodiversity, limitation of single index evaluation is avoided, the set mode determination module determines the biodiversity level of the sub-region according to the resource evaluation value of each sub-region adjacent to the historical period, and then the collection mode corresponding to each sub-region in the current period is formulated. According to the personalized acquisition strategy, the acquisition intensity and method can be reasonably adjusted according to the biodiversity conditions of different sub-regions.

The invention discloses a pig breeding screening method and system based on a body type database, and particularly relates to the technical field of pig breeding screening. The system comprises a multi-modal sign data acquisition and integration module for collecting and standardizing heterogeneous data sources such as phenotypic signs, genomics and environmental parameters of breeding pigs in real time, and a multi-dimensional biological characteristic modeling and analysis module for analyzing a nonlinear action mechanism among genetic markers, phenotypic characteristics and environmental factors, the genetic potential intelligent judgment module is used for quantitatively evaluating spatial expression potential and intergenerational transmission probability of genetic advantages of the breeding pigs through a deep learning algorithm; and the intelligent screening and dynamic monitoring module is used for establishing a multi-dimensional threshold dynamic regulation and control mechanism to realize accurate elimination decision and continuous optimization of a germplasm resource library. According to the method, the screening accuracy is remarkably improved by designing multi-source data fusion and online optimization capability, meanwhile, mistaken elimination is reduced through a redundant superior species temporary storage management module, and collaborative improvement of population genetic diversity and environmental adaptability is ensured.

The invention belongs to the technical field of molecular biology and plant molecular breeding, and particularly relates to a mustard core SNP molecular marker set and a screening method and application thereof. The invention provides a core SNP marker set (33) which is subjected to whole genome re-sequencing screening and experimental verification and is suitable for mustard germplasm resource identification and genetic analysis for the first time. The marker set is high in polymorphism and good in stability, covers the whole genome and can effectively distinguish different leaf mustard germplasms. By utilizing the core marker set and the matched KASP primer, the genetic typing of the leaf mustard germplasm resources can be quickly and accurately performed with high throughput, and the defects that the traditional morphological identification is time-consuming, labor-consuming and poor in accuracy are overcome. The marker set can be used for analyzing the genetic diversity, the population structure and the phylogenetic relationship of the leaf mustard germplasm resources, and a molecular basis is provided for collection, preservation and evaluation of the germplasm resources and breeding parent matching.

Provided are a Medicago sativa SNP molecular marker combination and a use thereof. The SNP molecular marker combination consists of 61351 SNP molecular markers. The physical positions of the 61351 SNP molecular markers are determined by sequence alignment on the basis of the Medicago sativa reference genome ZM-4 alfalfa genome. The SNP molecular markers have good site specificity, strong versatility, and high polymorphism and can effectively discriminate Medicago sativa germplasms from different sources. A Medicago sativa genome-wide liquid-phase gene chip is prepared from the SNP molecular markers, and can be used for genetic diversity assessment of Medicago sativa germplasm resources, genetic map construction and functional gene mapping, genome-wide association study, etc., providing an important tool and technical support for Medicago sativa molecular design breeding and variety authenticity identification, and achieving important significance for high-quality development of the alfalfa seed industry in China.

The invention belongs to the technical field of molecular biology, and particularly discloses a cotton 10K functional site breeding chip and application thereof. The breeding chip is named as' Cotton Core No.1 ', and comprises a 10K functional site targeting capture probe group designed based on a reference genome of disease-resistant, high-quality and high-yield modern upland cotton No.8, the probe group comprises 11159 SNP (Single Nucleotide Polymorphism) loci, 3981 of the SNP loci are functional loci associated with 13 important agronomic characters, and 7178 of the SNP loci are background loci reflecting genetic diversity; the SNP site information is shown in the specification table 1. The invention discloses a cotton 10K functional site breeding chip and application thereof, the breeding chip contains functional sites with more index function genetic variation, has higher detection accuracy among different cotton varieties, is applied to cotton molecular marker-assisted selection breeding, whole genome selection breeding and whole genome correlation analysis, and has higher detection accuracy. The breeding efficiency can be obviously improved, and the practical application is wider.

The invention discloses a lateolabrax japonicus liquid-phase chip based on a targeted genotype detection technology and application of the lateolabrax japonicus liquid-phase chip, the lateolabrax japonicus liquid-phase chip can detect genotypes of 45 and 459 target sites, and the lateolabrax japonicus liquid-phase chip comprises 44 and 927 background SNPs sites uniformly distributed in a whole genome, 454 INDELs sites located in a coding region and capable of causing frame shift mutation and 78 functional sites related to lateolabrax japonicus growth. The chip is based on a targeted sequencing genotype detection technology (GBTS) of liquid-phase probe hybridization, and compared with an existing lateolabrax japonicus genotyping method, the liquid-phase chip provided by the scheme has great advantages in the aspects of repeatability and accuracy of target site detection, experiment standardization degree, data analysis simplicity degree, required computing resources and the like. The invention fills up the blank that the lateolabrax japonicus lacks genetic typing chips, and is suitable for genome selective breeding, whole genome association analysis, germplasm identification and genetic diversity analysis of lateolabrax japonicus.

The invention belongs to the technical field of molecular biology, and particularly discloses a primer capable of identifying five acer species at the same time and application of the primer, the primer comprises AcerTS-F: CGGAACTAGTCGGATGGAGT; the invention relates to a method for preparing an Ac < S-R >: GAAGCAGTTCGAGACAACCG; respectively extracting total DNA (deoxyribonucleic acid) of acer palmatum, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum plants; carrying out PCR (Polymerase Chain Reaction) amplification on the total DNA (Deoxyribose Nucleic Acid) of each species by using the AcerTS-F and the AcerTS-R; after PCR products are sequenced, sequence comparison is carried out, five acer species including acer northeast, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum can be identified at the same time, and precious genetic resources are provided for genetic diversity, phylogenetic evolution and taxonomy research of the acer species.

The invention relates to the technical field of species distribution analysis, and discloses a dove tree population natural update limitation-based species distribution analysis system, which comprises a habitat factor acquisition module, an update limitation evaluation module, a distribution prediction module, a spatial constraint correction module and an adaptability atlas optimization module. The habitat factor acquisition module acquires data in real time and constructs a multi-layer environment factor topology; the update limit evaluation module evaluates update limit in combination with genetic diversity and seed diffusion constraint; the distribution prediction module generates a distribution strategy through spatial modeling and ecological niche optimization; the spatial constraint correction module corrects a diffusion range and genetic parameters based on terrain and climate factors; and the adaptability graph optimization module feeds back an analysis result to carry out closed-loop optimization on the strategy. The system is provided with a multi-stage obstacle avoidance mechanism and a redundant link, so that the habitat change response capability is improved. According to the method, accurate analysis and dynamic optimization of davidia involucrata distribution are realized, and technical support is provided for species protection.

The invention discloses a beef cattle multi-variety genome data analysis and management method and system, and the method comprises the following steps: data collection and integration: obtaining beef cattle original genome sequence data, building a genome data storage library, and adding a unique identification label for the data of each variety; performing data preprocessing and standardization: detecting variation points, performing standardization processing on the detected variation points, and meanwhile, performing encoding processing on genotype data of the variation points; multi-variety genome feature analysis: identifying beef cattle varieties with rich genetic diversity and relatively deficient beef cattle varieties, obtaining potential variety subgroups or variety combinations with similar genetic backgrounds, and mining character associated sites ubiquitous in different varieties or specific to specific varieties; and performing data visualization and report generation: performing visual display on a result obtained by analysis. According to the method, comprehensive, systematic and efficient analysis and management of beef cattle multi-variety genome data can be realized, and powerful support is provided for beef cattle genetic breeding.

The invention belongs to the technical field of whole genome gene chips, and particularly relates to a cattle whole genome liquid phase chip and application thereof. Based on an SNP molecular marker combination (position information is shown in a specification table 1) provided by the invention, cattle genotyping can be realized through a targeted capture sequencing technology, and cattle genotypes can be detected in a short time and at high throughput, so that cattle breeding work is promoted. Furthermore, based on the cattle SNP molecular marker combination provided by the invention, a probe is designed, and a whole genome breeding chip is constructed, so that large-scale typing site detection rate of cattle is high, stability is good, and platform wide adaptability is achieved. The method can be applied to germplasm resource identification and mining, genetic diversity analysis, population structure analysis, genetic relationship identification and whole genome selective breeding of cattle varieties, especially Anhui province local cattle varieties, and has important significance in improving the cattle core provenance autonomous breeding efficiency.

The invention discloses a compression and decompression method based on generic genome expression, and relates to the technical field of compression and decompression of DNA next-generation sequencing data, in particular to the compression and decompression method based on generic genome expression. The method aims at solving the problems that in the prior art, the capacity of processing population genetic diversity is insufficient, original sequencing quality information cannot be effectively restored during decompression, and memory occupation is too high during large-scale data processing. Obtaining a to-be-compressed sequencing sequence data file, a reference genome sequence and a thousand-person genome variation sample; obtaining a haplotype list, a variation list and a haplotype offset list corresponding to each window block; storing the window number, the haplotype number, the haplotype offset, the head and tail unmatched sequences, the current sequence name and the quality score character string into a single compression block; carrying out binding storage; completing the compression processing of the mass fraction; and obtaining each to-be-compressed sequencing sequence based on the result of the compressed part.

The invention belongs to the field of plant molecular genetics, and relates to a spirodela polymorphic microsatellite molecular marker primer and application thereof. The kit comprises 10 pairs of microsatellite primers which form 5 groups of duplex PCR systems, and the kit can be applied to population genetic diversity analysis of spirodela polyrhiza. The population genetic diversity analysis comprises the following steps: collecting a sample of spirodela polyrhiza to be identified; extracting spirodela polyrhiza genome DNA from the spirodela polyrhiza sample; taking the extracted DNA as a template, and carrying out PCR (Polymerase Chain Reaction) amplification on the DNA template by using the screened 10 pairs of microsatellite primers; carrying out electrophoresis detection on a PCR product, and then carrying out silver staining; the silver staining result is digitally analyzed, the UPGMA clustering analysis chart is drawn by genetic analysis software, the clustering analysis chart of the spirodela polyrhiza is identified according to the clustering analysis result, and the method has huge popularization and utilization value.

The invention provides a primer probe composition, a kit and application of the primer probe composition to identification of rhinogobio ventralis species or detection of rhinogobio ventralis population abundance. The primer probe composition disclosed by the invention is simple to use, accurate in result and high in repeatability; the method has high accuracy and can avoid errors caused by gene diversity in a population; the kit has high sensitivity, and the detected minimum DNA concentration can reach 1 * 10 < 3 > copies / mu L; the method also has good interspecific specificity, can effectively distinguish rhinogobio ventralis and other fishes, and even can distinguish rhinogobio ventralis and related species, such as rhinogobio ventralis and rhinogobio cylindrica. Under the background of continuous decline of rhinogobio ventralis population resources, accurate monitoring of rare species can be realized, and data support is provided for resource management protection of rhinogobio ventralis.

The invention provides a cynaroides cynaroides chloroplast genome and application thereof, and belongs to the technical field of genes. The nucleotide sequence of the cynaros cynaroides chloroplast genome is shown as SEQ.ID.NO.1. The invention provides application of the cynaros cynaroides chloroplast genome in identification of cynaros cynaroides varieties and reconstruction of cynaros phylogenetic trees, and provides technical support for protection of cynaros cynaroides germplasm resources and species identification. According to the invention, the chloroplast genome of the cynaroides is used as a super DNA bar code for identifying the variety of the cynaroides, so that technical support is provided for protection of germplasm resources and species identification, and the application of the chloroplast genome of the cynaroides in variety identification and reconstruction of phylogenetic trees of the cynaroides is realized. The method is of great significance to plant breeding and genetic diversity evaluation, protection and utilization.

The invention discloses a sesbania SSR primer combination developed based on a shallow genome sequence and application thereof, and belongs to the technical field of molecular markers. The invention develops an SSR primer combination based on a shallow genome sequence of sesbania, and the SSR primer combination comprises 23 pairs of SSR primer pairs. The SSR primer pair developed by the invention has the advantages of high polymorphism, rich polymorphic information content, stable amplification result, high resolution, accuracy and the like, can quickly and accurately judge the source and variety of sesbania, is beneficial to the research of germplasm resource identification, germplasm resource genetic diversity analysis, genetic structure analysis and the like of sesbania, and has wide application prospects. The method has important significance in promoting conservation and utilization of sesbania germplasm resources and promoting industrial development.

The invention relates to the technical field of molecular genetic breeding, and particularly discloses an eggplant core SNP molecular marker set and application, and the molecular marker set comprises 23 SNP markers; screening representative eggplant germplasm for re-sequencing; the method comprises the following steps: by taking an eggplant HQ-1315V1.0 genome as a reference genome, carrying out comparison to obtain 4869502 SNP (Single Nucleotide Polymorphism) markers; the method comprises the following steps: screening to obtain a first SNP molecular marker set based on a material discrimination degree, a distribution uniformity degree on a genome, specificity intensity, a heterozygosity degree, a gene diversity index, a polymorphic information amount PIC and a minimum allele frequency MAF principle of SNP markers; 96 SNP molecular markers are randomly selected, and genetic typing verification is carried out on the SNP molecular markers by using eggplant resource materials to obtain 32 candidate SNP molecular markers; and further performing genetic diversity evaluation, clustering analysis and population structure analysis on the 32 candidate SNP molecular markers, and screening to obtain 23 core SNP molecular marker sets. The method has the characteristics that germplasm resources can be effectively distinguished, and variety identification and authenticity detection are convenient.

The invention belongs to the technical field of molecular biology, bioinformatics, sorghum genetics and whole-genome gene chips, and particularly relates to a sorghum whole-genome SNP molecular marker combination developed based on a targeted sequencing technology, a 10K liquid chip and application of the sorghum whole-genome SNP molecular marker combination and the 10K liquid chip. The SNP molecular marker combination comprises 10,000 SNP loci, and the specific information of the 10,000 SNP loci is as shown in a table 1; the physical positions of the 10000 SNP loci are determined by performing sequence alignment based on a reference genome of the wine red tassel sorghum variety HYZ-T2T with the version number of v1.0. A liquid chip developed based on the SNP molecular marker combination provided by the invention can be effectively applied to genetic diversity analysis, whole genome association analysis, genetic typing, molecular marker-assisted selective breeding, whole genome selective breeding and other applications of sorghum germplasm resources.

The invention belongs to the field of microbial breeding and fermentation engineering, and particularly relates to a saccharomyces cerevisiae mutagenesis strain with high yield of S-adenosyl-L-methionine as well as a mutagenesis method and application of the saccharomyces cerevisiae mutagenesis strain. Saccharomyces cerevisiae is induced to generate genetic diversity through multiple rounds of ultraviolet mutagenesis, and high-throughput screening is performed in combination with strain color phenotypic difference; and the mutant strain HY2402-Z18 with high yield of S-adenosine-L-methionine and genetic stability is obtained. The SAM yield of the mutagenic strain is increased by 40.1% compared with that of an original strain, the SAM yield reaches 13.44 g / L when the mutagenic strain is fermented for 60 h in a 5 L fermentation tank system, the unit yield reaches 0.156 g / L / OD, and the methionine conversion rate is 75%. After thalli are collected through centrifugation of fermentation liquor, an S-adenosine-L-methionine product with the purity of 98%-100% can be obtained through purification of ion exchange resin, no by-products are accumulated, the yield, the substrate conversion rate and the production efficiency of the S-adenosine-L-methionine can be remarkably improved when the mutagenesis strain is used for fermentation production, and the production cost is reduced. The production cost is effectively reduced, the product purity and quality are improved, and the method is suitable for industrial large-scale production of SAM.

This invention relates to the fields of genomics, molecular biology, bioinformatics, and genome-wide selection breeding, specifically a 20k liquid-phase breeding chip for the whole genome of *S. esculenta* and its applications. The liquid-phase chip contains background SNPs and functional SNPs located on the *S. esculenta* reference genome; wherein the background SNPs are uniformly distributed within the genome; and the functional SNPs are associated with important economic traits of *S. esculenta*; these important economic traits include one or more of the following: saponin content, polysaccharide content, and heat tolerance. The chip can be applied to the assessment of genetic diversity in *S. esculenta*, identification of germplasm resources and phylogenetic relationships, genome-wide association analysis of important economic traits, and genome-wide selection breeding. This chip has advantages such as high throughput, high region coverage, high locus detection rate, and high flexibility, providing powerful tool support for molecular breeding of *S. esculenta*.

The present invention relates to the field of biotechnology, and relates to a multiplex amplification system, a kit and an application for 28 short tandem repeats. The multiplex amplification system includes 28 pairs of primers, which can simultaneously amplify 28 loci, and the primer sequences for the 28 loci are disclosed. Through the study of the genetic diversity of STR loci, the 28 loci selected by the present invention are located in the imprinted gene segments of the corresponding chromosomes. These loci have characteristics such as high individual discrimination power and high polymorphic information content, and can effectively and accurately detect the STR polymorphisms of the genome in a specific region. By comparing with the detection results of the parents, uniparental disomy in the corresponding segment can be indicated.

The invention discloses a corn genome breeding 45K chip and application thereof, the chip covers 44, 637 SNP loci and 27 InDel loci, and the SNP loci are uniformly distributed on 10 chromosomes and part of scaffold of a corn genome and have rich polymorphism. Compared with an existing corn chip, the SNP marker of the 45K chip is derived from re-sequencing results of 507 corn varieties, has better variety representativeness, and contains 925 key functional gene loci for close planting and high yield and 96 corn variety authenticity identification loci; the method can be more effectively used for functional gene identification, genetic diversity analysis, heterosis group division, whole genome selection analysis and variety authenticity identification.