424 results about "Genetic diversity" patented technology

The invention provides a large yellow croaker medium-low density SNP liquid phase chip and application thereof, the chip is prepared from a probe for detecting 15,292 SNP molecular marker combinations of a large yellow croaker whole genome, and the position and base information of each SNP site on the chip are shown in a table 1. The invention further provides a preparation method and application of the chip, such as application in large yellow croaker population genetic diversity analysis, breeding population genotype identification, character correlation analysis or genome selective breeding. The chip designed by the invention comprises a series of core sites obviously related to growth, flow resistance and quality characters, and also comprises a large number of background sites, so that the detection accuracy of the designed chip is guaranteed, and the chip has the obvious advantage of low detection cost, the detection cost is reduced by more than 30%, and the detection efficiency is improved. The scientific and technological innovation of the large yellow croaker dark blue breeding industry can be further accelerated.

The invention discloses a sugarcane germplasm resource evaluation and breeding method for smart agriculture. The sugarcane germplasm resource evaluation and breeding method comprises the following steps: step 1, collecting materials with wide genetic diversity; establishing an intelligent incubator and a greenhouse, and monitoring environmental parameters by using an Internet of Things sensor; 2, performing data acquisition on the related germplasm resources by using an unmanned aerial vehicle, a robot and a near infrared spectrum technology, and constructing a phenotype database for data management; meanwhile, genotype identification is carried out by combining molecular marker-assisted selection and genome selection technologies, molecular markers of key genes are mined, and the genetic value of related germplasm is evaluated; step 3, constructing a hybrid combination prediction model by using an AI algorithm, optimizing parent matching of the related germplasm and the cultivated sugarcane, monitoring and collecting the filial generation at the same time, and analyzing and screening in combination with smart agriculture; 4, demonstration planting is conducted on the bred excellent sugarcane strain, and application of the excellent strain is improved through government-enterprise-scientific research institution collaborative popularization and in combination with farmer technical training.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the testis size character of Hu sheep as well as a screening method and application of the SNP molecular marker, and belongs to the fields of genetic breeding and molecular biology. The marker is located in an intron region of a Hu sheep chromosome 3 LRRIQ1 gene and is remarkably related to the Hu sheep testis size character, and the accuracy and reliability of the SNP molecular marker are ensured through a scientific and rigorous screening method; according to the marker, Hu sheep individuals related to testis size characters can be rapidly and accurately screened out, the breeding efficiency and accuracy are improved, the breeding process is accelerated, the breeding cost is reduced, and the economic benefits are improved; the genetic diversity is protected, the accuracy of seminal fluid quality evaluation is improved, a powerful tool is provided for Hu sheep breeding work, and important basic data is also provided for researching a genetic mechanism of testis development and functions; the method can also be used as an auxiliary diagnosis tool to assist in identifying potential genetic defects or disease risks and promote progress and development of the breeding technology.

The invention discloses a cowpea 5K SNP (Single Nucleotide Polymorphism) liquid chip and application thereof in variety identification, and belongs to the technical field of biology. The liquid chip provided by the invention comprises a set of nucleotide probes for detecting 5847 SNP sites of cowpea, and can be widely applied to different scenes of germplasm resource identification, genetic diversity evaluation, variety identification, genetic relationship identification, purification and rejuvenation of local varieties and the like of different cowpea varieties; an effective scientific basis is provided for cowpea variety identification, the variety identification and evaluation efficiency is improved, and the method has a remarkable application value.

The invention discloses a rubber tree whole genome SNP molecular marker combination, a gene chip and application, and belongs to the field of molecular marker development. The rubber tree whole genome SNP molecular marker combination comprises 28923 SNP molecular markers, the 28923 SNP molecular markers comprise 28923 SNP sites, each SNP site comprises two different base variation sites and is used for detecting allelic change of the site, and the physical positions of the 28923 SNP sites are determined based on comparison of genome sequences of rubber tree wild germplasm MT / VB / 25A 57 / 8. The 28923 SNP loci adopted by the invention uniformly cover the whole genome of the rubber tree, so that the real level of genetic diversity of the rubber tree can be comprehensively revealed, and the SNP loci can be applied to genetic diversity analysis, population structure analysis, whole-genome association analysis, molecular marker-assisted breeding and whole-genome selective breeding research work of the rubber tree. The whole genome SNP site combination and the gene chip thereof are used for detection, have the advantages of simplicity, rapidness and low cost, and can realize large-scale application in hevea brasiliensis genetic breeding research.

The invention discloses an alfalfa SNP (Single Nucleotide Polymorphism) molecular marker combination and application thereof. The SNP molecular marker combination is composed of 61351 SNP molecular markers, the physical positions of the 61351 SNP molecular markers are determined based on sequence alignment of a medicago sativa reference genome ZM-4alfalfa gene, the SNP molecular markers are good in site specificity, high in universality and high in polymorphism, medicago sativa germplasms of different sources can be effectively distinguished, and the application prospect is wide. The alfalfa whole-genome liquid-phase gene chip prepared from the SNP molecular marker can be used for alfalfa germplasm resource genetic diversity evaluation, genetic map construction, functional gene positioning, whole-genome association analysis and the like, and provides important tools and technical supports for alfalfa molecular design breeding and variety authenticity identification. The method has important significance on high-quality development of alfalfa seed industry in China.

The invention relates to the technical field of molecular biology of siberian wildrye, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination for constructing a siberian wildrye DNA (Deoxyribose Nucleic Acid) fingerprint spectrum and application. The SNP molecular marker combination for constructing the siberian wildrye DNA fingerprint spectrum is composed of 52 SNP molecular markers, and the SNP molecular marker combination has high specificity and resolution, and can reveal the real level of genetic diversity of siberian wildrye; the SNP molecular marker combination is used for establishing a siberian wildrye DNA fingerprint database, DNA fingerprint information of different siberian wildrye germplasm can be correctly reflected, resource or variety identification can be carried out on siberian wildrye, the detection result is accurate and efficient, 90 siberian wildrye germplasm resources are effectively distinguished for the first time, the identification capacity is high, and technical support is provided for siberian wildrye germplasm resource protection. The SNP marker and the application method thereof provided by the invention have the advantages of high throughput, accuracy, low cost, simplicity in operation and the like, and have a very wide application prospect.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination for constructing an oat DNA (Deoxyribose Nucleic Acid) fingerprint spectrum and application, the SNP molecular marker combination is developed and obtained based on an SLAFseq technology, and has the characteristics of uniformly covering an oat genome, being high in polymorphic information content and being suitable for typing. Compared with other traditional molecular marker technologies, the SNP marker provided by the invention has higher stability, is not easily influenced by experimental conditions and environmental factors, and can be widely applied to oat germplasm resource identification, genetic diversity analysis, DNA fingerprint construction and molecular marker-assisted breeding. The DNA fingerprint spectrum constructed on the basis of the SNP molecular marker can more comprehensively reflect genetic information of a biological individual or population, and is of great significance to research of genetic diversity, evolutionary relationship and the like of species. Therefore, the method can provide technical reference for popularization of oat varieties, property right confirmation and protection, purity identification of oat seed production and the like.

The invention discloses a tea tree liquid phase chip and application thereof, and relates to the technical field of molecular detection. The invention discloses a tea tree liquid phase chip and application thereof, according to site screening requirements and probe design principles, the tea tree liquid phase chip comprises 5781 SNP sites, and tea tree resource genetic typing can be realized based on a target interval genome sequence liquid phase capture accurate positioning sequencing typing technology. The tea tree liquid chip can realize low-cost genetic typing, is mainly specific to tea trees, can realize variety identification and genetic relationship analysis of the tea trees, scientifically guides hybridization improvement work of the tea trees and assists protection and development of germplasm resources of the tea trees, and has relatively high application values in multiple fields of tea tree breeding. The tea tree liquid phase chip can be used for tea tree genetic diversity evaluation, germplasm resource and genetic relationship identification, genetic map construction and gene localization, whole genome association analysis and tea tree molecular marker assisted breeding.

The invention discloses a silver carp 20K liquid phase chip and application thereof, the liquid phase chip comprises a probe combination of 20,909 SNP molecular markers covering a whole genome, the physical positions of the 20,909 SNP molecular markers are determined based on sequence alignment of the silver carp genome (GCA041475455.1), and the site information of the 20,909 SNP molecular markers is shown in the specification table 1. The invention provides a silver carp first type whole genome SNP liquid phase breeding chip, which effectively reduces the application cost of silver carp in genetic diversity analysis, QTL positioning, GWAS analysis and the like in scientific research, solves the problem that no applicable product exists in silver carp molecular auxiliary breeding and whole genome selective breeding, accelerates the progress of silver carp basic research and breeding, and has a wide application prospect. The method is of great significance in improving the utilization efficiency of silver carp germplasm resources, accelerating the breeding process of excellent characters and improving the economic value and environmental adaptability of bred varieties.

The invention discloses a cucumber whole genome SNP (Single Nucleotide Polymorphism) site combination, a liquid chip and application of the cucumber whole genome SNP site combination. On the basis of whole genome re-sequencing data and GBS data of cucumbers, a group of SNP locus combinations and liquid phase chips which are uniformly distributed in the whole genome are developed, 17519 SNP loci are selected according to the whole genome re-sequencing data, 7340 SNP loci are selected according to the GBS data, and finally 24859 SNP loci are selected. 24859 SNP loci are uniformly distributed on the whole genome of the cucumber, so that an efficient whole genome genotyping tool is provided for genetic diversity analysis, variety identification, background screening, molecular marker-assisted breeding, gene positioning and whole genome association analysis of the cucumber, and the related research process of the cucumber is promoted. The method has an important application value.

The invention provides an SNP (Single Nucleotide Polymorphism) site combination for genetic typing of micropterus salmoides and application of the SNP site combination. The SNP locus combination comprises 50000 SNP loci, and the positions and base information of the 50000 SNP loci on chromosomes are as shown in a table 3. By applying the micropterus salmoides whole genome liquid chip of the SNP site combination for genotyping of micropterus salmoides, provided by the invention, the genotype of a sample to be detected can be rapidly and accurately detected, and the average detection rate of the SNP sites and the average consistency rate of the genotype of the sample are as high as 99.95%; the micropterus salmoides whole genome liquid phase chip has the characteristics of high capture specificity, low cost, flexible sites and the like, is suitable for character breeding and improvement, gene mining, genetic relationship identification, genetic diversity analysis and the like of micropterus salmoides, and can effectively improve the breeding efficiency and accuracy of improved varieties of micropterus salmoides; and a new variety of largemouth micropterus salmoides which is more suitable for market requirements and is more competitive can be cultivated.

The invention provides an Indel molecular marker primer combination for identifying different populations of sargassum and a detection method and application of the Indel molecular marker primer combination, and belongs to the technical field of germplasm identification and genetic diversity analysis of macroalgae. The Indel molecular marker primer combination disclosed by the invention comprises an Indel-F1 / R1 and an Indel-F2 / R2, wherein the Indel molecular marker primer combination comprises an Indel molecular marker primer and an Indel molecular marker primer; the sequence of the Indel-F1 is as shown in SEQ ID NO. 1, and the sequence of the Indel-R1 is as shown in SEQ ID NO. 2; the sequence of the Indel-F2 is as shown in SEQ ID NO.3, and the sequence of the Indel-R2 is as shown in SEQ ID NO.4. The Indel molecular marker primer combination disclosed by the invention can be used for accurately identifying a creeping branch population and a guede population of a guede line and quickly distinguishing from other common sargassum, and has important significance in the aspects of resource protection, research and utilization of the sargassum.

The invention relates to a mytilus coruscus byssus adhesion protein gene Mfp5 coding region SNP marker and application thereof, the mytilus coruscus byssus adhesion protein gene Mfp5 coding region SNP marker comprises a gene sequence numbered as an McMfp5 coding region, the nucleotide sequence of the gene sequence is shown as SEQ ID No.1, an SNP marker primer pair is designed based on the sequence, three SNP markers numbered as McMfp51, McMfp52 and McMfp53 are obtained through sequencing, and the primer sequences of the three SNP markers are shown as SEQ ID No.2 and SEQ ID No.3 in sequence. The primer designed aiming at the gene sequence of the McMfp5 coding region is used for SNP (Single Nucleotide Polymorphism) marker typing, is high in specificity, stable in amplification and high in polymorphism, can be used for genetic diversity analysis, germplasm identification and marker-assisted selection breeding of mytilus coruscus populations, and provides a powerful tool for genetic breeding of mytilus coruscus.

The invention relates to a gene related to the body color character of paramisgurnus dabryanus, a primer group of an SNP marker and application of the primer group, and belongs to the technical field of molecular markers, and the nucleotide sequence of the gene is as shown in SEQ ID NO.1. The invention also provides a primer pair for detecting the body color related SNP marker herc2-105, and the nucleotide sequence of the primer pair is as shown in SEQ ID NO: 2-3; the SNP marker herc2-105 is located at the 105bp position of the nucleotide sequence of the gene, and the polymorphic form of the SNP marker herc2-105 is A / T. Wherein the AA genotype individual has a golden red body color, and the AT and TT genotype individuals have a wild body color. The molecular marker provided by the invention can be used for body color character breeding of the golden red paramisgurnus dabryanus, the genetic diversity of population offspring is effectively increased, and the breeding process of new body color variety breeding of the red paramisgurnus dabryanus is remarkably promoted.

The invention discloses a dynamic evaluation system for a biodiversity resource response mechanism, and relates to the technical field of biological resources. A target enterprise resource monitoring region is divided into sub-regions through a biological resource evaluation value analysis module; and obtaining a species diversity adaptation value, a genetic diversity adaptation value, an ecosystem diversity adaptation value and an inter-organism mutual adaptation value of each sub-region adjacent to the historical cycle. The multi-dimensional analysis mode can comprehensively and deeply reflect various aspects of biodiversity, limitation of single index evaluation is avoided, the set mode determination module determines the biodiversity level of the sub-region according to the resource evaluation value of each sub-region adjacent to the historical period, and then the collection mode corresponding to each sub-region in the current period is formulated. According to the personalized acquisition strategy, the acquisition intensity and method can be reasonably adjusted according to the biodiversity conditions of different sub-regions.

The invention discloses a pig breeding screening method and system based on a body type database, and particularly relates to the technical field of pig breeding screening. The system comprises a multi-modal sign data acquisition and integration module for collecting and standardizing heterogeneous data sources such as phenotypic signs, genomics and environmental parameters of breeding pigs in real time, and a multi-dimensional biological characteristic modeling and analysis module for analyzing a nonlinear action mechanism among genetic markers, phenotypic characteristics and environmental factors, the genetic potential intelligent judgment module is used for quantitatively evaluating spatial expression potential and intergenerational transmission probability of genetic advantages of the breeding pigs through a deep learning algorithm; and the intelligent screening and dynamic monitoring module is used for establishing a multi-dimensional threshold dynamic regulation and control mechanism to realize accurate elimination decision and continuous optimization of a germplasm resource library. According to the method, the screening accuracy is remarkably improved by designing multi-source data fusion and online optimization capability, meanwhile, mistaken elimination is reduced through a redundant superior species temporary storage management module, and collaborative improvement of population genetic diversity and environmental adaptability is ensured.

The invention belongs to the technical field of molecular biology and plant molecular breeding, and particularly relates to a mustard core SNP molecular marker set and a screening method and application thereof. The invention provides a core SNP marker set (33) which is subjected to whole genome re-sequencing screening and experimental verification and is suitable for mustard germplasm resource identification and genetic analysis for the first time. The marker set is high in polymorphism and good in stability, covers the whole genome and can effectively distinguish different leaf mustard germplasms. By utilizing the core marker set and the matched KASP primer, the genetic typing of the leaf mustard germplasm resources can be quickly and accurately performed with high throughput, and the defects that the traditional morphological identification is time-consuming, labor-consuming and poor in accuracy are overcome. The marker set can be used for analyzing the genetic diversity, the population structure and the phylogenetic relationship of the leaf mustard germplasm resources, and a molecular basis is provided for collection, preservation and evaluation of the germplasm resources and breeding parent matching.

Provided are a Medicago sativa SNP molecular marker combination and a use thereof. The SNP molecular marker combination consists of 61351 SNP molecular markers. The physical positions of the 61351 SNP molecular markers are determined by sequence alignment on the basis of the Medicago sativa reference genome ZM-4 alfalfa genome. The SNP molecular markers have good site specificity, strong versatility, and high polymorphism and can effectively discriminate Medicago sativa germplasms from different sources. A Medicago sativa genome-wide liquid-phase gene chip is prepared from the SNP molecular markers, and can be used for genetic diversity assessment of Medicago sativa germplasm resources, genetic map construction and functional gene mapping, genome-wide association study, etc., providing an important tool and technical support for Medicago sativa molecular design breeding and variety authenticity identification, and achieving important significance for high-quality development of the alfalfa seed industry in China.

The invention discloses a gene breeding chip (Guangxin No.1) for selecting and breeding local chickens in Guangxi Zhuang autonomous regions and application of the gene breeding chip. The gene chip is designed aiming at the breeding condition of high-quality broiler chickens in Guangxi Zhuang Autonomous District, has lower typing cost, is beneficial to popularization and application of enterprises, has higher flexibility, can be used for carrying out iterative updating on chip sites according to application purposes and practical effects, and has a wide application prospect. The method can be effectively utilized in genetic diversity evaluation of local chickens in the Guangxi Zhuang Autonomous Region, group breed conservation effect identification, pedigree correction, whole genome association analysis and genome selection, the application of molecular biological breeding of high-quality broiler chickens in the Guangxi Zhuang Autonomous Region is further enhanced, and the breeding level of the high-quality broiler chickens in the Guangxi Zhuang Autonomous Region is improved.

The invention belongs to the technical field of molecular biology, and particularly discloses a cotton 10K functional site breeding chip and application thereof. The breeding chip is named as' Cotton Core No.1 ', and comprises a 10K functional site targeting capture probe group designed based on a reference genome of disease-resistant, high-quality and high-yield modern upland cotton No.8, the probe group comprises 11159 SNP (Single Nucleotide Polymorphism) loci, 3981 of the SNP loci are functional loci associated with 13 important agronomic characters, and 7178 of the SNP loci are background loci reflecting genetic diversity; the SNP site information is shown in the specification table 1. The invention discloses a cotton 10K functional site breeding chip and application thereof, the breeding chip contains functional sites with more index function genetic variation, has higher detection accuracy among different cotton varieties, is applied to cotton molecular marker-assisted selection breeding, whole genome selection breeding and whole genome correlation analysis, and has higher detection accuracy. The breeding efficiency can be obviously improved, and the practical application is wider.

The invention provides a Sichuan local chicken 11K SNP liquid phase chip and application thereof, the liquid phase chip is prepared from a Sichuan local chicken 11K SNP molecular marker combination, the Sichuan local chicken 11K SNP molecular marker combination is composed of 11747 SNP molecular markers, and chromosome positions and numbers of the 11747 SNP molecular markers on a chicken reference genome GRCg7b are shown in a specification table 1. The chip is high in detection flux, high in target site detection rate (99.91%) and accurate and reliable in typing result (the repetition consistency rate is 99.82%), and is a molecular marker chip with low density, high accuracy and low cost; the method can be used for chicken germplasm resource identification and improvement, genetic diversity evaluation, population structure analysis, genetic relationship identification, transmission map construction and QTL positioning, whole genome association analysis, molecular marker-assisted selection, whole genome selective breeding and the like.

Systems and methods for continuous monitoring of the behavior of animals, such as small rodents, are provided. Monitoring can include video, audio, and other sensor modalities. In one embodiment, the system can include cameras, arena design, environmental sensors, and ultrasonic sensors. The system uniquely provides a continuous long-term monitoring system suitable for mouse behavioral study. Further provided is a neural network based tracker configured for use with video data acquired by the monitoring system. 3 different neural network architectures have been tested to determine their performance on genetically diverse mice under varying environmental conditions. It has been observed that that an encoder-decoder segmentation neural network achieves high accuracy and speed with minimal training data. This general purpose neural network tracker can be easily extended to other experimental paradigms and even to other animals through transfer learning, thus forming a robust, generalizable solution for bio-behavioral research.

The invention discloses a lateolabrax japonicus liquid-phase chip based on a targeted genotype detection technology and application of the lateolabrax japonicus liquid-phase chip, the lateolabrax japonicus liquid-phase chip can detect genotypes of 45 and 459 target sites, and the lateolabrax japonicus liquid-phase chip comprises 44 and 927 background SNPs sites uniformly distributed in a whole genome, 454 INDELs sites located in a coding region and capable of causing frame shift mutation and 78 functional sites related to lateolabrax japonicus growth. The chip is based on a targeted sequencing genotype detection technology (GBTS) of liquid-phase probe hybridization, and compared with an existing lateolabrax japonicus genotyping method, the liquid-phase chip provided by the scheme has great advantages in the aspects of repeatability and accuracy of target site detection, experiment standardization degree, data analysis simplicity degree, required computing resources and the like. The invention fills up the blank that the lateolabrax japonicus lacks genetic typing chips, and is suitable for genome selective breeding, whole genome association analysis, germplasm identification and genetic diversity analysis of lateolabrax japonicus.

The invention discloses a camellia oleifera SNP (Single Nucleotide Polymorphism) molecular marker combination and application thereof. The camellia oleifera SNP molecular marker combination comprises at least one of 50 SNP molecular markers and 454 SNP molecular markers, and the physical positions of the 50 SNP molecular markers and the 454 SNP molecular markers are determined on the basis of sequence alignment of a camellia oleifera reference genome GCA039905865.1. The camellia oleifera SNP molecular marker combination can be effectively used for molecular marker breeding of camellia oleifera, the camellia oleifera SNP molecular marker combination is used for preparing a first type of whole genome liquid phase chip of camellia oleifera, and the application cost of genetic diversity analysis, QTL positioning, GWAS analysis and the like in scientific research of camellia oleifera is effectively reduced; the problem that no applicable product exists in camellia oleifera molecular auxiliary breeding and whole genome selective breeding is solved, and the process of camellia oleifera basic research and breeding is accelerated.

The invention belongs to the technical field of molecular biology, and particularly discloses a primer capable of identifying five acer species at the same time and application of the primer, the primer comprises AcerTS-F: CGGAACTAGTCGGATGGAGT; the invention relates to a method for preparing an Ac < S-R >: GAAGCAGTTCGAGACAACCG; respectively extracting total DNA (deoxyribonucleic acid) of acer palmatum, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum plants; carrying out PCR (Polymerase Chain Reaction) amplification on the total DNA (Deoxyribose Nucleic Acid) of each species by using the AcerTS-F and the AcerTS-R; after PCR products are sequenced, sequence comparison is carried out, five acer species including acer northeast, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum can be identified at the same time, and precious genetic resources are provided for genetic diversity, phylogenetic evolution and taxonomy research of the acer species.

The invention relates to the technical field of species distribution analysis, and discloses a dove tree population natural update limitation-based species distribution analysis system, which comprises a habitat factor acquisition module, an update limitation evaluation module, a distribution prediction module, a spatial constraint correction module and an adaptability atlas optimization module. The habitat factor acquisition module acquires data in real time and constructs a multi-layer environment factor topology; the update limit evaluation module evaluates update limit in combination with genetic diversity and seed diffusion constraint; the distribution prediction module generates a distribution strategy through spatial modeling and ecological niche optimization; the spatial constraint correction module corrects a diffusion range and genetic parameters based on terrain and climate factors; and the adaptability graph optimization module feeds back an analysis result to carry out closed-loop optimization on the strategy. The system is provided with a multi-stage obstacle avoidance mechanism and a redundant link, so that the habitat change response capability is improved. According to the method, accurate analysis and dynamic optimization of davidia involucrata distribution are realized, and technical support is provided for species protection.

The invention discloses a beef cattle multi-variety genome data analysis and management method and system, and the method comprises the following steps: data collection and integration: obtaining beef cattle original genome sequence data, building a genome data storage library, and adding a unique identification label for the data of each variety; performing data preprocessing and standardization: detecting variation points, performing standardization processing on the detected variation points, and meanwhile, performing encoding processing on genotype data of the variation points; multi-variety genome feature analysis: identifying beef cattle varieties with rich genetic diversity and relatively deficient beef cattle varieties, obtaining potential variety subgroups or variety combinations with similar genetic backgrounds, and mining character associated sites ubiquitous in different varieties or specific to specific varieties; and performing data visualization and report generation: performing visual display on a result obtained by analysis. According to the method, comprehensive, systematic and efficient analysis and management of beef cattle multi-variety genome data can be realized, and powerful support is provided for beef cattle genetic breeding.

The present invention relates to the field of increasing genetic diversity in a targeted manner. In particular, the present invention relates to providing methods and means for target sequence diversification using a base editor with an extended mutation profile, including providing Cas12a diversification base editing systems and uses thereof.

The invention belongs to the technical field of whole genome gene chips, and particularly relates to a cattle whole genome liquid phase chip and application thereof. Based on an SNP molecular marker combination (position information is shown in a specification table 1) provided by the invention, cattle genotyping can be realized through a targeted capture sequencing technology, and cattle genotypes can be detected in a short time and at high throughput, so that cattle breeding work is promoted. Furthermore, based on the cattle SNP molecular marker combination provided by the invention, a probe is designed, and a whole genome breeding chip is constructed, so that large-scale typing site detection rate of cattle is high, stability is good, and platform wide adaptability is achieved. The method can be applied to germplasm resource identification and mining, genetic diversity analysis, population structure analysis, genetic relationship identification and whole genome selective breeding of cattle varieties, especially Anhui province local cattle varieties, and has important significance in improving the cattle core provenance autonomous breeding efficiency.