361results about How to "High polymorphism" patented technology

The invention discloses a core SNP sites combination maizeSNP384 for building of a maize DNA fingerprint database and molecular identification of varieties, and an application of the core SNP sites combination. The invention provides applications of 384 SNP sites in any one of the following conditions: (1) building of the maize DNA fingerprint database; (2) detecting of the authenticity of maize varieties; (3) genetic analysis of corn germplasm resources; and (4) molecular breeding of maize, wherein the physical positions of the 384 SNP sites are determined by comparison on the basis of a whole genome sequence of the maize variety B73; the version number of the whole genome sequence of the maize variety B73 is B73 RefGen V1; and the 384 SNP sites are MG001-MG384. An experiment proves that the 384 SNP sites can be applied to building of the maize variety DNA fingerprint database, identification of the variety authenticity, dividing of germplasm resource groups, and other related researches.

The invention aims at providing microsatellite loci of portunus trituberculatus and a polymorphic primer, namely providing five microsatellite loci of portunus trituberculatus. A nucleotide sequence of the microsatellite loci is any one of SEQ ID NO:1 to 5. The invention also provides a primer designed from the microsatellite loci. The primer is used for genetic diversity detection of portunus trituberculatus population. By adopting the microsatellite loci of portunus trituberculatus, five microsatellite loci are screened from a public database of the portunus trituberculatus; a specific primer is designed according to flanking sequences at two ends of the microsatellite; the amplification result has high polymorphism and stability. The primer can be applied to the fields such as genetic diversity detection and relationship identification of the portunus trituberculatus population, building of a genetic linkage map, and assistant breeding of a molecular marker.

The invention relates to a method for constructing and identifying molecular marker fingerprint chromatogram of Dendrobium huoshanense and similar species thereof, which solves the problems that a method of identifying medicinal plants in the prior art has high cost, complicated procedures and long time consumption. The method comprises the steps of: 1, the collection of Dendrobium huoshanense samples; 2 the extraction and purification of DNA of genomes of the samples; 3. ISSR-PCR amplification; 4, agarose gel electrophoresis; 4, the construction of ISSR molecular marker fingerprint chromatogram of the samples to be tested; and 5, the identification of Dendrobium huoshanense germplasm by utilizing the constructed ISSR molecular marker fingerprint chromatogram. The method has the advantages that the method saves the time and the cost, and can obtain an accurate and reliable identification chromatogram through the extraction to DNA of Dendrobium plants, the ISSR-PCR amplification, and the agarose gel electrophoresis; the method has the advantages of simplicity, convenience, quickness, good repetitiveness, and high resolution on the identification of raw materials which are easy to confuse in appearance; and the method can identify in a seedling stage, which has important effect on ensuring the accuracy and stability of base resources of medicinal materials.

The invention provides a fluorescence-labeled composite amplification kit for Y chromosome STR (short tandem repeat) gene loci capable of improving distinguishing capability. When the kit is used for detecting DNA (deoxyribonucleic acid) gene, not only can 17 STR gene loci of DYS391, DYS389I/II, DYS439, DYS438, DYS456, DYS458, DYS437, DYS635, DYS448, Y-GATA-H4, DYS19, DYS392, DYS393, DYS390 and DYS385a/b, which can be analyzed by the commercial kit, be amplified and analyzed, but also at least one of STR gene loci of DYS449, DYS527a/b, DYS522, DYS388, DYS447 and DYS444 can be simultaneously amplified and analyzed, so that the accumulative individual distinguishing capability and cumulative probability of exclusion of the system are improved, and the individual distinguishing capability is improved overall.

The invention discloses a method for screening microorganism high-polymorphism molecular marker sites. The method comprises the following steps of uniformly mixing microspecies of different organismsat equal amount, and extracting total nucleic acid; building a high-flux sequencing library; finding variation sites on a genome; screening the high-polymorphism sites in a gliding translation way; designing multiple amplification primers at both sides of a candidate site; screening the multiple primers, so as to obtain the novel high-polymorphism molecular marker sites. The method has the advantages that in theory, all available high-polymorphism molecular marker sites on the genome can be screened at one time, and be directly used for high-flux detection of variety, and the repeated demonstration process in the traditional screening method is not needed; the screened molecular marker sites can be detected in batch, and the respective molecule amplification and detection on each molecularmarker site are not needed, so that the detection speed is accelerated, and the accuracy is improved; the screened molecular marker has high polymorphism and good resolution, the screening process issimple and quick, and the process is standard.

The invention belongs to the technical field of biological detection, and in particular relates to a fluorescently-labeled insertion/deletion (InDel) genetic polymorphism locus composite amplification system and application thereof. The application comprises the following steps of: selecting 35 InDel loci, designing polymerase chain reaction (PCR) amplification primers of the 35 InDel loci, matching fluorescein labels of the PCR primers, compositely amplifying and detecting the 35 InDel loci, and the like. The system can analyze 35 InDel genetic polymorphism loci by the composite amplification. The 35 InDel loci are labeled by FAM, HEX, TAMRA and ROX fluorescein with four different colors respectively. The composite amplification system based on the invention can be made into a kit, serves as an InDel locus fluorescence composite amplification kit with Chinese characteristics, and is applied to the fields, such as triplet paternity test, doublet paternity test, grandparent and grandchild test, sibling test, individual recognition, disease diagnosis, anthropology and the like.

The invention discloses an SNP mark combination for traceability and identification of beef cattle individuals and meat products and application of the SNP mark combination. The SNP mark combination disclosed by the invention comprises 32 highly polymorphic loci distributed on 29 autosomes. The minimum allele frequencies of the combination loci are all greater than 0.35. The experiments show that the combination can be successfully applied to the identification of the beef cattle individuals except for yak breeds in the market and the traceability of the meat products and is conducive to the realization of the whole chain traceability of breeding-slaughtering-selling to really ensure food safety.

The invention discloses an ISSR molecular marking based method for constructing a Chinese asparagus bean generic resource database and application thereof. The invention also utilizes the data base to identify the trueness of a variety; according to field forms, the consistency and typicality among individual plants of the variety are identified, separated and atypical materials are given up, and DNA of the individual plant of the consistent and typical variety is picked up; by utilizing three ISSR markings with high polymorphism, the consistency of DNA level among the individual plants is primarily selected, and the variety and individual plant constructing a fingerprint are finally determined; and by utilizing the finally selected variety and individual plant, the ISSR analysis of the Chinese asparagus bean is made to construct a fingerprint database. The invention overcomes the defects existing in the construction of the prior generic resource database, such as separation among different individual plants of the variety and impurity on the DNA level, the reliability and accuracy of the Chinese asparagus bean ISSR fingerprint data base constructed by the method are greatly improved, and the planting varieties of the Chinese asparagus bean can be effectively and conveniently identified and distinguished.

The invention discloses a SSR core primer group developed based on sesame complete genomic sequence and application. The primer group comprises 32 pairs of primers, and the nucleotide sequences are shown as the sequence SEQ ID NO. 1-64. The obtained SSR core primer group has the advantages of being capable of furthest reflecting the heredity diversity of sesame germplasm resource materials, high in polymorphism, good in repeatability, stable in mark, easy for discrimination statistics and the like, is applicable to the fields of sesame variety identification, sesame variety heredity pedigree analysis and sesame variety germplasm resource heredity diversity evaluation and the like; and the primer group can be utilized to perform sesame heredity diversity analysis, and the heredity genetic relationship of a to-be-tested material can be furthest accurately reflected.

The invention discloses a method for developing a functional marker related to MicroRNA (miRNA for short). The method comprises the following steps of: performing BlastN comparison on a known miRNA sequence in an miRNA database with a disclosed DNA sequence of a researched species; determining a DNA (miDNA for short) sequence corresponding to the miRNA based on the number and a similarity degree of base mismatch; extending to the left and right for a certain distance until the total length is about 150bp; determining a precursor miDNA site through prediction of a stem loop secondary structure and calculation of the minimum free folding energy coefficient; classifying and comparing all screened precursor miRNA sequences; designing primers according to conserved sequences; electronically comparing the designed primers in the database, and determining as miRNA special sequences; and finally combining according to an annealing temperature of each primer, and developing the functional marker with high efficiency and good polymorphism. The marker system integrates the advantages of the conventional markers such as simple sequence repeat (SSR), amplified fragment length polymorphism (AFLP) and the like, and has good characteristics of higher portability, low cost, polymorphism and stability and the like.

The invention relates to a five-color fluorescence-labeling composite amplification system simultaneously analyzing 18 loci of human genomic DNA. The system divides the 18 loci into four groups, and relates to fluorescence labels in five colors in all. The fluorescence-labeling composite amplification system has the advantages of high sensitivity and capability of detecting the whole 18 loci under the condition that DNA template quantity is 0.2 ng. In Chinese Han population, the overall random matching probability is 8.8*10<-21>, and the cumulative non-parentage exclusion rate is 0.999999999993.

The invention discloses a molecular marker of sesame dominant genic male sterility gene and a preparation method and application thereof. A forward primer sequence of the marker GB50 is ATGGGTTTATGGCAGGCT, and a reverse primer sequence is GGACTACTCCTCCTCCCCA; a forward primer sequence of SBM298 is CCCCTTTTCACTTACGTACAGCAG, and a reverse primer sequence is CTCTTCCTCCACCATCTCCTCTTC. The preparation method comprises the steps of: A, respectively numbering dominant genic male sterility brother-sister inbreeding segregation population in the seedling stage, collecting tender leaves from each individual plant, treating by liquid nitrogen and storing in a refrigerator for standby; B, conducting biosynthesis by using EST-SSR primers of SBM series; C, amplifying by a PCR procedure; D, conducting PCR amplification and product detection; E, acquiring a polymorphism marker; and F, acquiring a molecular marker associated with male sterility. The method can obtain 100% male sterility population, significantly improve the efficiency of sesame recurrent selection, and avoid the trouble of eradication of 50% fertile plants until the flowering phase by using morphological characteristics. The invention has obvious effect, low cost, no pollution and very broad application prospects.

The invention relates to the method for identifying the varieties of lilium brownii by adopting an SSR (simple sequence repeat) molecular marking technology. A result shows that: two pairs of high-polymorphism and high-repeatability primers are screened from 13 pairs of primers for detecting 171 fragments comprising 131 polymorphic fragments, 4 to 22 fragments can be detected by each pair of primers with the sizes of 100 to 250bp, 1.69 bands are amplified by each pair of primers, and the polymorphism rate is 76.70 percent; NTSYS-pc2.11 is used for similarity coefficient and cluster analysis, the genetic similarity coefficient is 0.5882 to 09412, and the average similarity coefficient is 0.7647; materials are divided into six major classes by cluster analysis, the genetic differences between 11 lilium brownii germplasms are irrelevant to varietal characteristics, flower forms, the colors of filaments and styluses, but have certain correlation with the colors of petals, flower genes can better reflect genetic relationships between the lilium brownii germplasms, different varieties have different colors, and the primers can be designed by controlling related genes of flowers to provide an important means for further distinguishing the genetic relationships.

The invention belongs to the technical field of bioinstrumentation, in particular to a fluorescent-marked 16 X-STR loci multiplex amplification system and application thereof. The system performs multiplex amplification analysis on 16 X-STR loci, namely GATA165B12, DXS101, GATA172D05, HPRTB, DXS981, DXS8378, DXS6795, GATA31E08, DXS6809, DXS6803, DXS9902, DXS6807, DXS7423, DXS7133, DXS6810 and DXS7132; the 16 loci are independent relatively and not linked mutually; and corresponding primers are respectively marked by four fluorescent markers, namely FAM, HEX, TAMRA and ROX. Based on the multiplex amplification system, an X-STR loci multiplex amplification kit suitable for Chinese people can be prepared for parentage analysis, individual recognition, sex tests, and gene location of X-linked inheritance disease, particularly for paternity identification of sisters, blooded half-sisters and skipped generations.

The invention discloses microsatellite marker primers used for penaeus monodon microsatellite family identification. The microsatellite marker primers include six primer pairs in total, and the six primer pairs are PM-38, PM-69, PM-92, PM-84, PM-102 and PM-114 respectively. The invention further discloses an identification method for the penaeus monodon microsatellite family and application of the microsatellite marker primers to penaeus monodon microsatellite family identification. By the adoption of the microsatellite marker primers, a paternity test platform is set up on penaeus monodon with polymorphic microsatellite markers marked by fluorescence for the first time, and the identification accuracy reaches 99%; different families and sources of the penaeus monodon can be effectively and fast identified, and a basis is provided for breeding, reproduction matching and enhancement and releasing assessment of the penaeus monodon.

The invention discloses a fluorescent labeled X-STR locus multiplex PCR method and an application thereof; the system performs multiplex amplification analysis of 12 loci: GATA172D05, DXS6789, DXS10074, DXS10078, GATA165B12, DXS6797, DXS6803, DXS6804, GATA31E08, DXS7130, DXS9895, and DXS6810, wherein primers of the 12 loci are labeled respectively by four fluorescences of FAM, HEX, TAMRA, ROX. The method of the invention can be used to prepare a set of kit as an X-STR locus multiplex amplification kit with Chinese characteristics, and the kit is applicable to gene localization of paternity identification, individual identification, sex identification, and X-linked genetic diseases, and is especially applicable to paternity identification for sister recognition, half-blood half-sister recognition, generation-skipping recognition, etc.

The invention provides a group of microsatellite markers for identifying parent-child relationships of Chinese Simmental cattle. The group of microsatellite markers includes ten microsatellite markers. The microsatellite markers have the advantages that the markers are high in polymorphism and are not linked with one another, fragments are appropriate in size and interval, and simultaneous detection can be facilitated; combined exclusion probabilities CPE (1), CPE (2) and CPE (3) can respectively reach 0.9960969, 0.999854 and 0.9999997 when the parent-child relationships of the Chinese Simmental cattle are identified by the aid of marker combinations under three different conditions, and accordingly the microsatellite markers are extremely high in detection efficiency; the microsatellite marker combinations can be used for completely and accurately identifying family trees of the Chinese Simmental cattle, accordingly, the Chinese Simmental cattle breeding accuracy can be improved, breeding procedures can be accelerated, and the microsatellite markers have excellent application prospects and economic benefits.

The invention discloses screening and application of solanum melongene SSR (Simple Sequence Repeats) molecular marker core primers. A solanum melongene SSR molecular marker core primer group comprises17 SSR molecular marker core primer pairs. The stable and reliable solanum melongene SSR primers with high polymorphism are screened by extracting DNA and SSR-PCR of solanum melongene core germplasmswith great property differences. The screened 17 SSR primer pairs are used for analyzing 106 parts of solanum melongene culture variety resources; through similarity calculation and clustering analysis, the result shows that the screened 17 pairs of primers can be used for accurately and efficiently identifying the solanum melongene variety; and the foundation is laid for the application of an SSR molecular marker technology to solanum melongene germplasm genetic relationship analysis and variety identification.

The invention discloses a radish EST-SSR core primer combination which comprises primers of which nucleotide sequences are as shown in SEQ ID NO. 1-42. The SSR core primer combination disclosed by the invention has the advantages of showing genetic diversity of a radish germplasm material, stable and reliable labeling, good repeatability, high polymorphism, convenience in statistics and the like to the greatest extent; when being used in genetic diversity analysis, the primer combination can be used for reflecting the genetic relationship of a tested material to the greatest extent with the fewest primers.

The invention belongs to the biotechnical field and provides a floral character QTL (quantitative trait locus) molecular marker screening method of amenone form chrysanthemum. The method can be used for positioning and cloning excellent genes of floral characters of amenone form chrysanthemum and cultivating novel varieties of amenone form chrysanthemum. The method comprises the following steps: I, obtaining a test material and phenome data; II, constructing a linkage map of chrysanthemum; III, combining phenome data with a molecular genetic map for QTL analysis of floral characters of amenone form chrysanthemum; and IV, determining the floral character associated molecular marker of the amenone form chrysanthemum. By using 160 F1 segregation population which is obtained by taking an amenone form chrysanthemum variety QX-053 as a female parent and a non-menone form chrysanthemum variety Nannongjingyan as a male parent, a plurality of molecular markers which are remarkably associated with floral characters of amenone form chrysanthemum. The molecular markers which are associated with floral characters of amenone form chrysanthemum are obtained for fine-mapping and cloning excellent genes of floral characters of amenone form chrysanthemum so as to greatly improve the selection efficiency, so that the amenone form chrysanthemum cultivating process is accelerated.

The invention belongs to the field of molecular biology DNA marker technique and application. The invention discloses a method for analyzing genetic diversity of Amomum tsao-ko by using inter simple sequence repeat (ISSR) reaction system. The ISSR reaction system comprises (per 25 muL) Mg<2+>-free 10*PCR buffer 3.0 muL, Taq DNA polymerase 1.5 U, Mg<2+> 1.5 mmol/L, dNTP 0.25 mmol/L, primers 0.3 mumol/, and template DNA 50 ng. The reaction mixture is amplified by the following procedures: pre-degeneration at 95 DEG C for 5 min, degeneration at 95 DEG for 1 min, annealing at 50-58 DEG C for 1 min, extension at 72 DEG C for 1 min, after 35 cycles, extension at 72 DEG C for 10 min, and storage at 4 DEG C. The method of the invention provides technical guide and theoretical support for Amomum tsao-ko resource identification, genetic diversity analysis and other scientific researches.

The invention relates to a micro-satellite DNA molecular marker for cervine animals. The molecular markers can be used for identifying allelic polymorphism, identify same or related cervine animals, distinguish the cervine animals and research the genetic diversity of the species group. The molecular marker can also be used for the genetic and phenotype research utilizing a statistics method such as linkage analysis, association mapping, linkage imbalance. The information can be used for breeding and/or selecting plants.

The invention discloses a rice blast resistance gene Pi5 function specificity molecular marker named as Pi5InDel and application of the rice blast resistance gene Pi5 function specificity molecular marker. The nucleotide sequence of the rice blast resistance gene Pi5 function specificity molecular marker is shown in the sequence SEQ ID NO.1. The rice blast resistance gene Pi5 function specificity molecular marker is high in specificity, is low in cost and high in throughput in practical application, and can be widely applied groups with different genetic backgrounds to screen rice germplasm containing the rice blast resistance gene Pi. By means of the molecular marker, the utilization efficiency of the molecular marker in molecular marker auxiliary selective breeding, gene pyramiding breeding and transgene breeding can be improved.

The invention discloses a genetic marker combination for human individual recognition and/or paternity identification and a detection method thereof. By conducting whole-genome SNPs unbiased scanningon multiple races, a SNPs site combination widely applicable to the multiple races is screened, and 116 autosome SNPs sites which come from 37 groups in different regions in the whole world, have thehypermorph allel frequency and low difference and achieve independent inheritance and 12 X chromosome SNPs sites which come from 37 groups in different regions in the whole world, have the hypermorphallel frequency and low difference and achieve independent inheritance are screened from 25,580,678 SNPs sites in a genome-wide scale. Compared with an existing commercial kit, the SNPs site combination has higher and wider multiracial adaptation, the cumulative individual recognition probability and the cumulative probability of exclusion are both significantly superior to those of the commercialkit, the detection result is more accurate, and a great application prospect is achieved.

The invention relates to a method for designing, amplifying and sequencing twelve pairs of floccularia luteovirens microsatellite primers. The method comprises the following steps: (1) extracting genome DNA of three floccularia luteovirens populations among which the geographic interval is more than 300km by using an improved CTAB method; (2) randomly selecting an individual genome DNA respectively from the three populations, mixing, detecting the quality of total DNA, preparing a gene library, and performing Illumina HiSeq<TM>2500 sequencing after the gene library is qualified in examination in depot; (3) splicing sequenced data, detecting simple sequence repeats (SSR) in the total DNA sequence by using SR search software, and performing primer design by applying primer3; (4) preparing an SSR primer having an annealing temperature of 50-60 DEG C by adopting a temperature gradient method; (5) respectively performing PCR amplification on the genome DNA of the three floccularia luteovirens populations, and sequencing and verifying to obtain 12 pairs of primers with polymorphism; and (6) calculating the number N of allelic genes, haplotype diversity H<d> genetic differentiation coefficient F<ST>, nucleotide diversity P, G<ST> and the value of pi. The method is beneficial to large-scale research.