Supercharge Your Innovation With Domain-Expert AI Agents!

Porphyra yezoensis microsatellite marker screening method and use thereof

A technology of microsatellite marker and laver streak, which is applied to the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. The effect of increasing yield and simple method

Inactive Publication Date: 2009-10-07
OCEAN UNIV OF CHINA
View PDF0 Cites 26 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the rapid development of mariculture in recent years, molecular marker-assisted breeding technology has also been used in marine economic species, but it is rarely used in laver cultivation and breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porphyra yezoensis microsatellite marker screening method and use thereof
  • Porphyra yezoensis microsatellite marker screening method and use thereof
  • Porphyra yezoensis microsatellite marker screening method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0025] 1 Construction of microsatellite enrichment library by magnetic bead adsorption method

[0026] Genomic DNA of Porphyra zebra filaments was extracted by conventional methods, 10 μg was taken, and the genomic DNA was digested with restriction endonucleases Hae III and Afa I, digested at 37°C for 12 hours, and 500- Fragments of 1500bp size. Add adapters for ligation, the conditions are 50ng 5'-end phosphorylated adapters (the adapter sequence is the first strand 5'TAGTCCGAATTCAAGCAAGAGCACA3'; the second strand 5'CTCTTGCTTGAATTCGGACTA3'), 1 μg enzyme-cut fragment, 20 U T 4 Ligase (New England BioLab, Inc.), 2 μl ligase buffer (New England BioLab, Inc.), ligated at 16°C for 14 hours. Using the above ligation product as a template and the short chain in the linker (sequence 5'CTCTTGCTTGAATTCGGACTA3') as a primer, enrich by PCR. The PCR reaction system is 20μl, 10mM Tris-HCl, 50mM KCl, 2.0mM Mg 2+ , 0.15mM dNTPs, 15ng primers, 1U Taq DNA polymerase. The reaction program wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention belongs to molecular biology DNA labeling technique and application field, concretely relates to a porphyra yezoensis microsatellite marker screening method, and a method for analyzing germplasm genetic diversity by the makers, thereby lay foundations for genetic structure analysis of porphyra yezoensis, germplasm resource protection and molecular marker auxiliary breeding.

Description

technical field [0001] The invention belongs to the field of DNA marker technology and application of molecular biology, in particular to a screening method and application of microsatellite markers of marine economical alga Porphyra yezoensis. Background technique [0002] Porphyra zebra belongs to Rphdophyta, Protoflorideophyceae, Bangiales, Bangiaceae, Porphyra, and is one of the main cultured species of laver in my country, mainly distributed in the northern coastal , has extremely high nutritional value and economic value. At present, the laver breeding technology still adopts traditional selective breeding, mutation breeding and other methods, which makes the genetic basis of laver cultured species increasingly narrow. Disease properties are all reduced, which limits the development of my country's laver aquaculture industry. Therefore, strengthening the research on the genetic structure of Porphyra wild populations and cultivated populations is of great significance f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/34C12Q1/68C12N15/11
Inventor 孔凡娜茅云翔杨惠王莉
Owner OCEAN UNIV OF CHINA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More