Porphyra yezoensis microsatellite marker screening method and use thereof
A technology of microsatellite marker and laver streak, which is applied to the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. The effect of increasing yield and simple method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0025] 1 Construction of microsatellite enrichment library by magnetic bead adsorption method
[0026] Genomic DNA of Porphyra zebra filaments was extracted by conventional methods, 10 μg was taken, and the genomic DNA was digested with restriction endonucleases Hae III and Afa I, digested at 37°C for 12 hours, and 500- Fragments of 1500bp size. Add adapters for ligation, the conditions are 50ng 5'-end phosphorylated adapters (the adapter sequence is the first strand 5'TAGTCCGAATTCAAGCAAGAGCACA3'; the second strand 5'CTCTTGCTTGAATTCGGACTA3'), 1 μg enzyme-cut fragment, 20 U T 4 Ligase (New England BioLab, Inc.), 2 μl ligase buffer (New England BioLab, Inc.), ligated at 16°C for 14 hours. Using the above ligation product as a template and the short chain in the linker (sequence 5'CTCTTGCTTGAATTCGGACTA3') as a primer, enrich by PCR. The PCR reaction system is 20μl, 10mM Tris-HCl, 50mM KCl, 2.0mM Mg 2+ , 0.15mM dNTPs, 15ng primers, 1U Taq DNA polymerase. The reaction program wa...
PUM
| Property | Measurement | Unit |
|---|---|---|
| melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
