88 results about "Taq DNA Polymerase" patented technology

The invention discloses a hemoglobin-resistant Taq DNA polymerase mutant and a construction method thereof, and relates to the field of biology, and the hemoglobin-resistant Taq DNA polymerase mutant is characterized in that a nucleotide sequence for coding the Taq DNA polymerase is shown as SEQ ID NO.1, and the mutant comprises at least one mutation or all mutations selected from S623D and E721A sites. On the basis of natural Taq DNA polymerase, the molecular structure of the Taq DNA polymerase is modified through rational design and combination with a site-specific mutagenesis biotechnology, so that the Taq DNA polymerase mutant is more suitable for PCR amplification of samples containing hemoglobin and the like than a wild type, and the result judgment accuracy of a sample containing a hemoglobin inhibitor is more facilitated.

The invention discloses a Taq DNA polymerase mutant as well as a preparation method and application thereof, and relates to the technical field of biology. The Taq DNA polymerase mutant is mutation on the basis of a wild type Taq DNA polymerase amino acid sequence as shown in SEQ ID NO.1, and comprises at least one of amino acid mutation L345E, L352D and S438M. The Taq DNA polymerase mutant has excellent tolerance to urea, and solves the dual technical problems that complex biological samples containing endogenous inhibitors such as urea can be efficiently amplified, and the Taq DNA polymerase mutant is compatible with difficult PCR reactions which take urea as an additive to optimize a high GC template and the like. Therefore, the mutant is a molecular biology tool enzyme which is wider in applicability and more stable and reliable in performance.

Disclosed is a Taq DNA polymerase mutant. Compared to a wild-type Taq DNA polymerase, the Taq DNA polymerase mutant has a mutation at one or more of amino acid positions 116, 439, and 468, wherein the amino acid sequence of the wild-type Taq DNA polymerase is set forth in SEQ ID NO: 1. Compared to the wild-type Taq DNA polymerase, the Taq DNA polymerase mutant of the present invention has higher enzyme activity than the wild-type enzyme; both single-site mutants and multi-site mutants show improved tolerance to corn leaf supernatant, mouse serum, and / or heparin sodium, and thus can be used for direct rapid amplification of samples.

The present disclosure relates to Taq DNA Polymerase mutants comprising at least three mutations which are capable of high levels of DNA amplification in the presence of several PCR inhibitors and compositions comprising the same. Also disclosed are methods of performing mutagenesis on wild-type Taq DNA polymerase to obtain the disclosed Taq DNA polymerase mutants, DNA amplification using the same, and cDNA amplification using the same.

The invention discloses a Taq DNA polymerase mutant with improved excision activity and application thereof, and belongs to the technical field of enzyme engineering. The invention aims to solve the technical problems of low probe cutting efficiency, weak fluorescence signal, limited detection sensitivity (especially for low-abundance targets), low reaction speed (high Ct value) and reduced specificity caused by insufficient 5 '-> 3' excision enzyme activity of wild Taq DNA polymerase in TaqMan probe method qPCR (quantitative polymerase chain reaction). According to the technical scheme, the Taq DNA polymerase mutant with the high 5 '-3' exonuclease activity is provided, the amino acid sequence of the Taq DNA polymerase mutant is shown as SEQ ID NO.2, the exonuclease activity of the mutant is improved by 77%, the cutting speed of a TaqMan probe is greatly increased, accumulation of fluorescence signals is accelerated, the Ct value is reduced, and the detection time is remarkably shortened.

The present invention relates to a novel anti-Taq DNA polymerase monoclonal antibody, or an antigen-binding fragment thereof, which exhibit high sensitivity and high specificity in specifically binding Taq DNA polymerase, and can therefore bind Taq DNA polymerase to form a stable and efficiently-blocked hot-start Taq DNA polymerase, thus avoiding non-specific amplification during polymerase chain reactions at low temperatures and improving the specificity and sensitivity of PCR reactions.

The invention discloses an anti-Taq DNA polymerase antibody or an antigen binding fragment thereof and application thereof, and relates to the technical field of biology. The antibody or the antigen binding fragment of the antibody can be specifically bound with Taq DNA polymerase, the polymerization activity and / or excision activity of the Taq DNA polymerase are / is blocked, and the stability of the Taq DNA polymerase is improved.

The invention discloses an anti-inhibition Taq DNA polymerase and application thereof, and relates to the technical field of biology. According to the anti-inhibition Taq DNA polymerase, amino acid mutations of K206R, F667Y and the like are carried out on an amino acid sequence of a wild type Taq DNA polymerase with an amino acid sequence as shown in SEQ ID No.1, so that a certain degree of anti-inhibition property is obtained. In addition, the invention also discloses application of the anti-inhibition Taq DNA polymerase in preparation of reagents or kits, and the like. Compared with a wild type Taq DNA polymerase, the anti-inhibition Taq DNA polymerase can maintain the PCR amplification capability in the presence of an inhibitor such as polysaccharide.

The invention discloses a Taq DNA polymerase mutant with improved thermal stability and inhibition resistance as well as a preparation method and application of the Taq DNA polymerase mutant, and relates to the technical field of biology. According to the Taq DNA polymerase mutant, amino acid mutation is carried out on an amino acid sequence of wild type Taq DNA polymerase, and amino acid mutation sites comprise F73S and P93A; the amino acid sequence of the wild type Taq DNA polymerase is as shown in SEQ ID NO: 1. Compared with wild type Taq DNA polymerase, the Taq DNA polymerase has the advantages that the resistance to inhibitors such as heme, ethanol and EDTA (Ethylene Diamine Tetraacetic Acid) is improved, and meanwhile, the Taq DNA polymerase has higher specific enzyme activity and heat stability.

The invention provides a reagent for detecting the proportion of vibrio in prawn seeds or prawn culture water in total bacteria. The reagent comprises a vibrio detection primer and probe, a bacteria detection primer and probe, Taq DNA polymerase, a dNTP mixture, UNG enzyme, a freeze-drying protective additive and a PCR buffer solution. According to the method, the specific DNA of the vibrio and the bacteria in the sample is quantitatively detected by utilizing the fluorescent PCR technology, the proportion of the vibrio in the total bacteria is obtained through the obtained quantitative detection data, the proportion of the vibrio in the total bacteria in shrimp seeds and shrimp culture water can be obtained in a short time, and guidance is provided for shrimp breeding and culture.

The invention discloses a Taq DNA polymerase mutant, compared with a wild type Taq DNA polymerase, the Taq DNA polymerase mutant has mutation at one or more of amino acid at the 116th site, amino acid at the 439th site and amino acid at the 468th site, and the amino acid sequence of the wild type Taq DNA polymerase is shown as SEQ ID NO: 1. Compared with a wild type Taq DNA polymerase, the Taq DNA polymerase mutant disclosed by the invention has the advantages that the enzyme activity is higher than that of the wild type Taq DNA polymerase, the tolerance of a single site mutant and a multi-site mutant to corn leaf supernatant, mouse serum and / or heparin sodium is improved, and the Taq DNA polymerase mutant can be used for direct and rapid amplification of samples.

The invention discloses a mutant Taq DNA polymerase for rapid PCR and application thereof, and belongs to the technical field of enzyme engineering, the amino acid sequence of the mutant Taq DNA polymerase corresponds to the sequence as shown in SEQ ID NO: 4, and the mutant Taq DNA polymerase has a plurality of mutation sites as follows: D58E, K292N, G304A, E507K and E742K; compared with a wild Taq DNA polymerase, the mutant Taq DNA polymerase provided by the invention has the advantages that the amplification rate is increased by more than 4 times, the rapid amplification performance is excellent, the PCR inhibitor resistance and the thermal stability are excellent, and meanwhile, the mutant Taq DNA polymerase is matched with a rapid PCR buffer solution provided by the invention, so that the amplification extension of 40 PCR cycles can be completed within the net duration of 350sec, the amplification of 40 cycles can be completed within 19min, and the application prospect is wide. The PCR detection time is remarkably shortened, and the requirement of rapid PCR detection is met.

The present invention provides a recombinant antibody for Taq DNA polymerase, mainly involving recombinant antibodies whose heavy chain sequences and light chain sequences are derived from different species. The recombinant antibody provided by the present invention reduces nonspecific amplification products in PCR and qPCR reactions, improves the reaction accuracy and the stability of premixed reagents.

The invention provides a Taq DNA (Deoxyribose Nucleic Acid) polymerase mutant. The Taq DNA polymerase mutant provided by the invention solves the problems of slow amplification speed and short extended DNA length of polymerase in the prior art. The Taq DNA polymerase mutant disclosed by the invention has the advantages that the amplification speed and the amplification length are obviously superior to those of a wild type product and a product in the prior art, and a large DNA fragment can be quickly expanded.

The invention relates to the technical field of molecular biology, in particular to mutant Taq DNA polymerase and application thereof. On the basis of the wild Taq DNA polymerase, the mutant Taq DNA polymerase has the following site mutations: the 31st amino acid residue is mutated from lysine to proline, the 186th amino acid residue is mutated from threonine to arginine, and the 795th amino acid residue is mutated from arginine to glutamic acid. Compared with a wild Taq DNA polymerase, the mutant Taq DNA polymerase has the advantages that the assembly error rate is reduced by 51.16%, the enzyme activity is improved to 1.64 times of that of the wild Taq DNA polymerase, and the mutant Taq DNA polymerase has important application value on a genome assembly technology and has important application potential in the fields of molecular biology and synthetic biology.

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.

The present disclosure provides a mutant Taq DNA polymerase and the use thereof. In one embodiment, the mutant Taq DNA polymerase exhibits a DNA polymerase activity in a PCR reaction containing whole blood, high concentration salt or humic acid.

The invention relates to the field of bioengineering, in particular to a Taq enzyme mutant, a nucleic acid molecule and application of the Taq enzyme mutant and the nucleic acid molecule. The invention provides a mutant of Taq DNA (deoxyribonucleic acid) polymerase, which has one or more amino acid site mutations on the basis of wild Taq DNA polymerase: the 507th site, the 543th site, the 551th site, the 742th site and the 664th site, and the amino acid sequence of the wild Taq DNA polymerase is as shown in SEQ ID NO: 75. The invention provides a novel mutant DNA (deoxyribonucleic acid) polymerase. Compared with a wild type DNA polymerase, the novel mutant DNA polymerase has higher inhibition resistance or higher dUTP (deoxyuridine triphosphate) doping capacity.

The application belongs to the technical field of molecular biology, and particularly relates to a Taq DNA polymerase mutant for probe qPCR. In the application, the Taq DNA polymerase mutant is designed, characterized and screened based on probe qPCR, a cycle process with fast amplification time (1 second of extension period) is adopted, and part of the Taq DNA polymerase mutant is obtained. Compared with the wild-type Taq DNA polymerase, the mutant provided in the application has the characteristics of fast detection and amplification results, which significantly reduces the total time required in the qPCR process and improves the detection efficiency of qPCR or real-time qPCR. Therefore, the mutant provided in the application has great economic advantages. The Taq DNA polymerase mutant provided in the application can be used for conventional qPCR detection, including gene expression analysis and other DNA quantitative detection.

The application belongs to the technical field of molecular biology, and particularly relates to a Taq DNA polymerase mutant for probe qPCR. In the application, the Taq DNA polymerase mutant is designed, characterized and screened based on probe qPCR, a cycle process with fast amplification time (1 second of extension period) is adopted, and part of the Taq DNA polymerase mutant is obtained. Compared with the wild-type Taq DNA polymerase, the mutant provided in the application has the characteristics of fast detection and amplification result, which significantly reduces the total time required in the qPCR process and improves the detection efficiency of the qPCR or real-time qPCR. Therefore, the mutant provided in the application has great economic advantages. The Taq DNA polymerase mutant provided in the application can be used for conventional qPCR detection, including gene expression analysis and other DNA quantitative detection.

The application belongs to the technical field of molecular biology, and particularly relates to a Taq DNA polymerase mutant for probe qPCR. In the application, the Taq DNA polymerase mutant is designed, characterized and screened based on probe qPCR, a cycle process with fast amplification time (1 second of extension period) is adopted, and part of the Taq DNA polymerase mutant is obtained. Compared with the wild-type Taq DNA polymerase, the mutant provided in the application has the characteristics of fast detection and amplification results, which significantly reduces the total time required in the qPCR process and improves the detection efficiency of qPCR or real-time qPCR. Therefore, the mutant provided in the application has great economic advantages. The Taq DNA polymerase mutant provided in the application can be used for conventional qPCR detection, including gene expression analysis and other DNA quantitative detection.

The present disclosure relates to the technical field of biology. Disclosed are an anti-Taq DNA polymerase antibody or an antigen binding fragment thereof, and a use thereof. The antibody or the antigen binding fragment thereof can specifically bind to a Taq DNA polymerase and block the polymerization activity and / or exonucleolytic activity of the Taq DNA polymerase, thereby improving the stability of the Taq DNA polymerase.

The present disclosure relates to Taq DNA Polymerase mutants comprising at least three mutations which are capable of high levels of DNA amplification in the presence of several PCR inhibitors and compositions comprising the same. Also disclosed are methods of performing mutagenesis on wild-type Taq DNA polymerase to obtain the disclosed Taq DNA polymerase mutants, DNA amplification using the same, and cDNA amplification using the same.

The invention belongs to the technical field of antibodies, and discloses a nano antibody for hot start of Taq DNA polymerase and a construction method of the nano antibody. The nano-antibody is a monovalent nano-antibody for sealing a 3 '-5' excision enzyme structural domain of Taq DNA polymerase, a monovalent nano-antibody for sealing a 5 '-3' polymerization active structural domain of Taq DNA polymerase or a bivalent nano-antibody obtained by connecting the monovalent nano-antibody and the monovalent nano-antibody through flexible peptide; the amino acid sequence of the monovalent nano antibody for sealing the 3 '-5' excision enzyme structural domain of the Taq DNA polymerase is shown as SEQ ID NO: 1, the amino acid sequence of the monovalent nano antibody for sealing the 5 '-3' polymerization active structural domain of the Taq DNA polymerase is shown as SEQ ID NO: 2, and the amino acid sequence of the flexible peptide is shown as SEQ ID NO: 3.

The invention provides Taq DNA polymerase as well as a preparation method and application thereof. The Taq DNA polymerase has an amino acid sequence as shown in SEQ ID NO. 1. According to the invention, the amino acid sequence of the Taq DNA polymerase is improved, and the obtained polymerase has better thermal stability; according to the present invention, the polymerase purification process is improved, such that the obtained polymerase has characteristics of low nucleic acid residue and high purity, the PCR amplification efficiency can be improved, and the method can be widely used for the nucleic acid detection platform.

The invention provides a method for efficiently expressing and purifying Taq DNA polymerase by using HEK293T, and belongs to the technical field of molecular biology. According to an amino acid sequence of Taq DNA polymerase, thrombin recognition and cleavage sites, six connected His amino acid tags and IFNalpha-2 signal peptides are sequentially designed at the N end of the Taq DNA polymerase, reverse translation is performed to obtain a nucleotide sequence, codons are optimized according to the environment of HEK293T cells, and then an eukaryotic expression vector is constructed. And transfecting the eukaryotic expression vector to an HEK293T cell to obtain the target protein. The purity of the obtained Taq DNA polymerase can reach 100%, the protein yield is high, about 2 mg of Taq DNA polymerase can be obtained by 20 mL of a culture medium, and the method is economical and efficient.

The invention discloses a preparation method and application of a Taq DNA polymerase monoclonal antibody based on structural domain analysis, which are specifically different from a traditional method using full-length Taq polymerase as an immunogen (the method generally cannot generate a functional blocking antibody due to a hidden epitope which is difficult to approach). According to the invention, by adopting a structure-oriented and domain-specific strategy, the exposure of epitopes related to active sites is remarkably enhanced, and a novel antigen Taq-P protein is developed. Based on the antigen, a high-specificity inhibitory monoclonal antibody is prepared, and the antibody is expected to become a core component of a high-performance hot start PCR reagent. According to the invention, a novel and generalizable mode is established for the development of a core diagnostic reagent, a key raw material is provided for gene detection and molecular diagnosis, and a valuable methodological framework is contributed to the development of propulsor engineering and biotechnology reagents.

The application discloses a digital PCR kit for thyroid cancer detection, and is characterized in that the digital PCR kit is used for detecting TERT-C250T, TERT-C228T and / or BRAF V600E mutations, a buffer system in the kit comprises Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme and betaine, the final concentration of the betaine is 0.25-0.7 M, and the final concentration of the Taq DNA polymerase is more than 3 U. The application provides a high-sensitivity, simple-to-operate auxiliary molecular diagnostic kit for thyroid cancer based on a digital PCR platform, combined with fluorescence quantification and multiplex PCR technology. The kit has high sensitivity and high specificity through optimization of the final concentration of the betaine, the final concentration of the Taq DNA polymerase and primers and probes for detecting three mutation sites, and the sensitivity of the kit for detecting target sequences in a complex background can reach 0.2 %.

The present invention relates to the technical field of molecular biology, and particularly to a mutant Taq DNA polymerase and its application. Based on the wild-type Taq DNA polymerase, the mutant Taq DNA polymerase has the following site mutations: the 31st amino acid residue is mutated from lysine to proline, the 186th amino acid residue is mutated from threonine to arginine, and the 795th amino acid residue is mutated from arginine to glutamate. Compared with the wild-type Taq DNA polymerase, the mutant Taq DNA polymerase of the present invention has a 51.16% reduction in the assembly error rate and its enzyme activity is increased to 1.64 times that of the wild-type, which has important application value for gene assembly technology and great application potential in the fields of molecular biology and synthetic biology.

The invention belongs to the technical field of molecular biology, and particularly discloses Taq DNA polymerase with enhanced base mismatch recognition capacity and application of the Taq DNA polymerase in gene mutation detection. The Taq DNA polymerase provided by the invention has enhanced base mismatch recognition capability, also retains the activity of the polymerase, and is especially suitable for gene mutation detection of which the 3'end of a primer contains a mismatch base. Experimental results show that Ct values of mutants M9, M10, M11, M12, M13 and M14 amplified by the 3'end base mismatched primer are obviously greater than Ct values of mutants amplified by a normal primer, and the mutants can all adapt to a rapid amplification procedure of 5s at 60 DEG C. Especially, the Ct value of the mutant M14 amplified by using a 3'end 1-bit base mismatched primer or a 2, 3-bit base mismatched primer is obviously greater than that of a normal primer, which indicates that the error distinguishing capability of the mutant M14 is the strongest, and the mutant M12 is suitable for preparing a gene mutation detection reagent.