13 results about "Pseudorabies" patented technology

The utility model relates to the technical field of farm disinfection, and disclose a pig pseudorabies prevention disinfection structure, including passageway frame, the upper surface fixed connection of passageway frame has the disinfection and killing main part mechanism, the output end fixed communication of disinfection and killing main part mechanism has the spray head, the outside of passageway frame is provided with non -contact disinfection mechanism, and non -contact disinfection mechanism includes two fixed frame, and the inside of every fixed frame all is provided with the shelter door pole. The pig pseudorabies prevention disinfection structure, through passageway frame, disinfection and killing main part mechanism, spray head, fixed frame, shelter door, button controller, warning light, warning device, first infrared distance sensor, second infrared distance sensor, servo motor and rotary lever, passageway frame can be installed at the pig house entrance and exit, and then when the breeding worker enters and exits passageway frame, first infrared distance sensor can monitor that personnel has stood in passageway frame, and second infrared distance sensor can monitor that there is no shelter at two shelter doors.

This study describes the construction, identification, and application of a pseudorabies virus (PRV) triple-gene deletion vaccine strain (gI / gE / TK). Based on the JS-2012-ΔgI / gE double-gene deletion strain, the TK virulence gene was further deleted using CRISPR technology. Its pathogenicity was evaluated in KM mice and piglets, and its immunoprotective efficacy was verified in piglets. This provides theoretical support for the clinical prevention and control of pseudorabies; establishes experimental models in mice and pigs to study the immunoprotective efficacy of the triple-gene deletion strain; and prepares for the subsequent development and evaluation of vaccines using PRV strains as vectors.

This invention relates to the field of biomedical technology, specifically disclosing a STING agonist ST-71, its synthesis method, and its applications. ST-71 is obtained by modifying SR-717. The STING agonist ST-71 synthesized in this invention has the characteristics of good antiviral effect, low toxicity and side effects, and cost-effectiveness, and can also inhibit the proliferation of porcine pseudorabies virus.

This application relates to the technical field of pseudorabies virus detection, specifically to a primer combination for pseudorabies virus detection, its application, and a reagent kit. Specifically, the amplification primers in this application exhibit good specificity and amplification efficiency when used for pseudorabies virus detection, and demonstrate good linear regression performance, enabling more accurate and precise quantitative detection of pseudorabies virus.

The application belongs to the field of biological medicine and virus infection, and particularly relates to an inhibitor for limiting virus-mediated cell-cell fusion. The application specifically discloses an inhibitor for limiting cell-cell fusion mediated by pseudorabies virus (PRV), wherein the inhibitor contains MARCH1 protein, and the MARCH1 protein includes a derivative thereof, an isolated nucleic acid molecule, a vector or a host cell containing the MARCH1 protein, and / or a fusion. It is found in the research that MARCH1 significantly inhibits the replication of PRV in the stage of cell-cell fusion, that is, it is found in the application that MARCH1 captures a virus protein complex inducing cell-cell fusion in a trans-Golgi network (TGN), and it is proved that MARCH1 has anti-PRV infection activity.

The application belongs to the technical field of animal disease prevention and control, and discloses application of a traditional Chinese medicine monomer, i.e., a perillyl alcohol, in preparation of a medicine for preventing or treating a pseudorabies of pigs. The application verifies the role of the perillyl alcohol in inhibiting a pig pseudorabies virus infection process and explores the application value of the perillyl alcohol in resisting the pig pseudorabies virus, and provides a theoretical basis and practical guidance for prevention and control of the PRV. In addition, the perillyl alcohol is a natural source medicine, has the advantages of safety, few side effects, low metabolic residues and no pollution, and has good popularization and application value.

The application provides a pig getah virus positive serum and a preparation method and application, and belongs to the technical field of animal virology. The application provides a preparation method of a pig getah virus positive serum, wherein a CDCD pig is used as a host, neutralizing antibody titer obtained through multiple immunization of high-concentration antigen is greater than or equal to 1:512; the serum does not have cytotoxicity affecting cell culture; the CDCD pig is a pig free from maternal antibody interference, which is obtained through caesarean section, isolated feeding and artificial feeding; the positive serum does not detect pig pseudorabies virus, swine fever virus, porcine circovirus type 2, pig foot-and-mouth disease virus, bovine viral diarrhea virus, porcine infectious gastroenteritis virus, porcine epidemic diarrhea virus, porcine rotavirus, porcine parvovirus, porcine Japanese encephalitis virus antibody, and has the characteristics of high titer and no cytotoxicity.

The application provides use of indole-3-propionic acid (IPA) in anti-herpes virus and a medicine and a feed additive containing the indole-3-propionic acid, and belongs to the technical field of biological medicine. The application provides application of the IPA in preparation of an antiviral agent for herpes virus, and after intervention of the IPA, the survival rate of infected mice can be obviously improved. Furthermore, after intervention of the IPA, the index of the parenchyma organs of the mice is obviously lower than that of a positive infection group; the level of inflammatory factors in each organ in the later infection stage is obviously improved, and the intestinal barrier is obviously improved; the intervention of the IPA can also obviously reduce the transcription level of PRV related genes. The IPA has the function of inhibiting pseudorabies virus replication, and can be used for preparation of a medicine for preventing and / or treating diseases caused by herpes virus infection or a corresponding feed additive.

The application relates to the technical field of animal infectious disease prevention and control, and particularly discloses application of tetrandrine in preparation of a medicine for preventing and treating pseudorabies of pigs. The application can significantly inhibit the replication efficiency of PRV on Vero cells and IPAM cells. When the concentration of the inhibitor is higher than 4 muM, the progeny virus titer and the virus gene transcription level of PRV are significantly reduced compared with those of a control group, and the pathological changes caused by cell infection are effectively relieved, which indicates that the tetrandrine can effectively inhibit the proliferation of PRV and has a potential application prospect.

The application discloses an mRNA vaccine mechanism preparation method of pseudorabies virus and belongs to the technical field of biological immunity. The technical scheme is as follows: an mRNA vaccine of pseudorabies virus, wherein the antigen coding sequence of the vaccine is obtained according to the gE protein sequence of the pseudorabies virus. The mRNA vaccine is obtained by taking the gE protein of the pseudorabies virus, which is usually neglected in the preparation of vaccines in the prior art, as the design basis of the antigen. The mRNA vaccine obtained by referring to the design is tested, and the test result shows that the mRNA vaccine is relatively other pseudorabies.

This invention discloses a gene modification system for knocking out the TRIM29 gene in pigs, a TRIM29 gene-modified cell line prepared using this system, and the application of this system in preparing TRIM29 gene-modified pigs, pseudorabies virus (PRV) resistant pigs, or breeding new PRV-resistant pig breeds. This system can efficiently screen for stably heritable TRIM29 gene-modified cell lines with a double isotransfer mutation genotype after the GACCTCCAGCTACTTCAAGCA sequence site in the TRIM29 gene, which is stably heritable. Using this gene modification system or the TRIM29 gene-modified cell line, TRIM29 gene-modified pigs can be prepared. These gene-modified pigs have elevated type I interferon levels, exhibit strong resistance to PRV, and may also be resistant to multiple type I IFN-sensitive viruses, making them a broad-spectrum resistant pig with good market competitiveness and application prospects.

This invention discloses a neutralizing monoclonal antibody against pseudorabies virus (PRV) gD protein, its preparation method, and its application. It belongs to the field of immunoglobulin technology. The neutralizing monoclonal antibody against PRV gD protein includes a heavy chain variable region and a light chain variable region. The complementarity-determining regions (CDR1, CDR2, and CDR3) in the heavy chain variable region include amino acid sequences as shown in positions 31-35, 50-66, and 99-110 of SEQ ID NO:1, respectively. The complementarity-determining regions (CDR1, CDR2, and CDR3) in the light chain variable region include amino acid sequences as shown in positions 24-34, 50-56, and 89-97 of SEQ ID NO:3, respectively. This neutralizing monoclonal antibody can specifically react with the gD protein, effectively recognize PRV, and efficiently neutralize PRV infection.