107 results about "Pseudorabies" patented technology

The present application relates to the field of veterinary diagnostic technology, and specifically to a probe composition, a primer composition, and a triple fluorescence PCR kit and related methods for differential diagnosis of three genes of different strains of African swine fever composed of the above-mentioned probe composition and primer composition. The kit includes primer probes specific to the B646L gene, the CD2v gene, and the I177L gene. The present application designs fluorescent PCR primers and probes for the B646L gene, the CD2v gene, and the I177L gene, respectively, and establishes a triple fluorescence PCR detection method, which can quickly identify African swine fever virus strains and gene-deficient strains. At the same time, it has no cross-reaction with swine fever virus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, porcine epidemic diarrhea virus, porcine circovirus, porcine parvovirus, healthy whole blood, oropharyngeal swabs, nasal swabs, anal swabs, environmental swabs, pig tissues, etc., and has good specificity.

The invention discloses a dual fluorescent quantitative PCR (polymerase chain reaction) primer probe combination for identifying a PRV (pseudorabies virus) vaccine strain and a wild strain. The dual fluorescent quantitative PCR primer probe combination comprises two pairs of primers gB-F and gB-R, gE-F and gE-R, and probes gB-probe and gE-probe, wherein the two pairs of primers are used for specifically amplifying a PRV gB gene and a PRV gE gene; through existence of real-time fluorescence PCR amplification curves of the PRV gB gene and the gE gene, a PRV vaccine strain (gE gene deletion) and a wild strain can be rapidly, specifically, sensitively and stably identified, technical support can be provided for porcine pseudorabies epidemic disease monitoring, and thorough purification of the PRV in a live pig breeding link is facilitated.

Comprising a multivalent fusion protein and an exosome delivery carrier, and the content of the multivalent fusion protein is 70-90 [mu] g; wherein the multivalent fusion protein is a fusion protein formed by connecting a gB glycoprotein, a gC glycoprotein, a gD glycoprotein and a high-immunogenicity part of an important antigen segment selected from gE and gI; the exosome delivery carrier is a small vesicle extracted and purified from mesenchymal stem cells or HEK 293-F cells, the surface of the exosome delivery carrier is modified with a CD40L single-chain antibody, and the exosome delivery carrier is used for loading multivalent fusion protein; the porcine pseudorabies virus vaccine further comprises adjuvants, and the adjuvants comprise a TLR agonist, CpG oligonucleotide, synthetic liposome and a traditional aluminum salt adjuvant. The porcine pseudorabies virus vaccine also comprises a mucous membrane adsorbent, a penetration enhancer, a stabilizer and a preservative. The invention aims to construct a multivalent fusion protein complex containing a plurality of important antigen segments by using an advanced bioengineering technology, and provides a wider protection effect by combining an efficient exosome delivery platform and a method for enhancing immune response.

The invention relates to a porcine bacterial polysaccharide-viral protein conjugate vaccine as well as a preparation method and application thereof, and belongs to the technical field of animal vaccines. The vaccine takes porcine bacterial polysaccharide and virus protein as raw materials, and a polysaccharide-virus protein conjugate is formed through coupling of a biotin-avidin system; wherein the virus protein is selected from one of classical swine fever virus E2 protein, porcine circovirus type 2 Cap protein, porcine pseudorabies virus gD protein and the like, and the porcine bacterial polysaccharide is selected from one of streptococcus suis capsular polysaccharide, porcine pasteurella multocida capsular polysaccharide and the like. The vaccine can simultaneously induce an organism to generate a high-level IgG antibody aiming at porcine bacterium capsular polysaccharide and virus protein, so that synergistic immune protection on porcine bacterium and virus infection is realized, and a broad-spectrum cross immune effect is achieved.

The invention relates to the technical field of antibodies, and discloses an antibody for specifically recognizing porcine pseudorabies virus gB (507-734 aa) or an antigen binding fragment thereof and application. The antibody or the antigen binding fragment thereof comprises a heavy chain and a light chain; the antibody or the antigen binding fragment thereof can be used for detecting the existence or the level of the porcine pseudorabies virus gB protein in a sample, and has key significance on optimization of a porcine pseudorabies virus detection method, improvement of diagnosis accuracy and realization of effective prevention and control of epidemic situations.

The invention belongs to the technical field of biology, and particularly relates to a porcine pseudorabies virus gB-gD recombinant fusion protein subunit vaccine as well as a preparation method and application thereof. According to the invention, the PRV gB and gD genes are selected to serially express the gBgD protein to prepare the vaccine, the gB and gD proteins which are respectively expressed are replaced, and the vaccine is high in safety and good in immunogenicity, can effectively prevent the occurrence of a pseudorabies virus virulence enhancement event when being clinically used, provides a powerful space for purification of pseudorabies, and has a wide application prospect.

This invention relates to an anti-swine pseudorabies virus (PRV) preparation and the application of Rehmannia glutinosa polysaccharide in its preparation, belonging to the field of biopharmaceutical technology. This invention provides an anti-swine pseudorabies virus (PRV) preparation comprising Rehmannia glutinosa polysaccharide. It also provides the application of Rehmannia glutinosa polysaccharide in the preparation of an anti-PRV preparation for the prevention and / or treatment of swine pseudorabies. This invention utilizes Rehmannia glutinosa polysaccharide to prevent infection by the PRV variant XJ5 by reducing intracellular oxidative stress levels; it also resists viral infection by affecting viral adsorption. Furthermore, when the concentration of Rehmannia glutinosa polysaccharide is between 50 and 400 μg / mL, it can also affect viral entry and replication, and has no cytotoxicity to PK-15 cells.

The invention relates to the technical field of biological medicines, and particularly discloses a diluent for a porcine pseudorabies live vaccine. The diluent for the porcine pseudorabies live vaccine is prepared by stirring and dissolving sodium dihydrogen phosphate, dipotassium phosphate, calcium chloride, sodium chloride, a traditional Chinese medicine extract, a stabilizer and water, and performing high-pressure steam sterilization, the traditional Chinese medicine extract is prepared by taking poria cocos and honeysuckle as traditional Chinese medicine raw materials and further reacting with chitosan and tannic acid, and the stabilizer is prepared by mixing gelatin, cyclodextrin and bovine serum albumin according to a mass ratio. When the diluent prepared by the method is used for diluting the porcine pseudorabies live vaccine, the stability and the activity of vaccine antigens can be effectively improved, the activity and the function of immune cells are enhanced, so that the immune effect of the vaccine is enhanced, and the prepared diluent for the porcine pseudorabies live vaccine solves the problem that a traditional live vaccine diluent does not have an immune enhancement effect.

The invention discloses application of PD-L1 as a drug target for resisting pseudorabies virus infection, the invention discloses PD-L1 as a key host limiting factor for pseudorabies virus infection for the first time, and knockout of PD-L1 can significantly promote replication of pseudorabies virus and induce apoptosis and inflammatory response of host cells. And PD-L1 overexpression can effectively inhibit proliferation of the pseudorabies virus and induce apoptosis and inflammatory response of host cells. Mechanism research results show that PD-L1 can be combined with envelope proteins gB and gD of the pseudorabies virus, and the effect of resisting pseudorabies virus infection is achieved through a cGAS-STNG-IFN pathway. The further research finds that the 125th arginine (ARG125) and the 271th lysine (LYS271) of the PD-L1 protein play a key role in the anti-pseudorabies virus infection effect of the PD-L1. The invention provides a new target spot for drugs for preventing or treating pseudorabies virus infection, and has a good application prospect in the aspect of resisting pseudorabies virus.

The invention relates to the technical field of biological medicines, and particularly discloses application of a swine STING molecular agonist SR-717 in preparation of a pseudorabies virus infection resisting medicine. The swine STING molecular agonist SR-717 can be stably combined with swine STING protein, the promoter activity of a downstream signal molecule interferon regulatory factor 3 (IRF3) and I-type interferon (IFN beta) is enhanced, PRV replication can be remarkably inhibited, the virus load is reduced, and pathological changes of infected mouse lung, brain and other tissues are reduced. The SR-717 provided by the invention has good targeting property and immune activation ability, and is suitable for intervention treatment of porcine pseudorabies virus infection.

The utility model relates to the technical field of farm disinfection, and disclose a pig pseudorabies prevention disinfection structure, including passageway frame, the upper surface fixed connection of passageway frame has the disinfection and killing main part mechanism, the output end fixed communication of disinfection and killing main part mechanism has the spray head, the outside of passageway frame is provided with non -contact disinfection mechanism, and non -contact disinfection mechanism includes two fixed frame, and the inside of every fixed frame all is provided with the shelter door pole. The pig pseudorabies prevention disinfection structure, through passageway frame, disinfection and killing main part mechanism, spray head, fixed frame, shelter door, button controller, warning light, warning device, first infrared distance sensor, second infrared distance sensor, servo motor and rotary lever, passageway frame can be installed at the pig house entrance and exit, and then when the breeding worker enters and exits passageway frame, first infrared distance sensor can monitor that personnel has stood in passageway frame, and second infrared distance sensor can monitor that there is no shelter at two shelter doors.

The present invention discloses a dual nano-PCR detection kit for porcine reproductive and respiratory syndrome virus and pseudorabies virus and its application, belonging to the technical field of molecular biology. The dual nano-PCR detection kit for porcine reproductive and respiratory syndrome virus and pseudorabies virus includes a primer set for detecting porcine reproductive and respiratory syndrome virus (PRRSV) and a primer set for detecting pseudorabies virus (PRV). The primers of the kit of the present invention have strong specificity, good repeatability and high sensitivity. Using nano-dual PCR for detection, it can detect as low as 5.17×10<supgt;2< / supgt> copies / μL and 4.46×10<supgt;2< / supgt> copies / μL, which is 100 times more sensitive than ordinary PCR; a single detection operation can simultaneously identify single infection or co-infection of the two viruses, greatly saving the detection time and reducing the detection cost, and providing technical support for disease prevention and control in pig farms.

This study describes the construction, identification, and application of a pseudorabies virus (PRV) triple-gene deletion vaccine strain (gI / gE / TK). Based on the JS-2012-ΔgI / gE double-gene deletion strain, the TK virulence gene was further deleted using CRISPR technology. Its pathogenicity was evaluated in KM mice and piglets, and its immunoprotective efficacy was verified in piglets. This provides theoretical support for the clinical prevention and control of pseudorabies; establishes experimental models in mice and pigs to study the immunoprotective efficacy of the triple-gene deletion strain; and prepares for the subsequent development and evaluation of vaccines using PRV strains as vectors.

This application relates to a neutralizing monoclonal antibody, hybridoma cell, and application thereof against pseudorabies virus gD protein. This application constructs a PRV gD eukaryotic expression vector, transduces it into CHO cells for expression, and then immunizes animals with PRV gD recombinant protein and a live attenuated vaccine as immunogens to produce a neutralizing monoclonal antibody against PRV gD. The neutralizing monoclonal antibody or hybridoma cell provided herein lays the foundation for the development of rapid detection technologies for pseudorabies virus and its gD protein. These antibodies have broad research and application value and commercial utility in pseudorabies virus-related immunoassays, and provide important guidance for the development of pseudorabies virus-based vaccines.

The invention belongs to the technical field of veterinary biological products, and particularly relates to a swine fever-porcine pseudorabies bivalent subunit vaccine containing a traditional Chinese medicine immunopotentiator as well as a preparation method and application of the swine fever-porcine pseudorabies bivalent subunit vaccine. The enhancer is prepared by compounding a hypericum perforatum extract and a horse chestnut seed extract, the hypericum perforatum extract and the horse chestnut seed extract are mixed with a classical swine fever virus (CSFV) E2 protein, a pseudorabies virus (PRV) gB protein, a PRV gD protein and an adjuvant to prepare a subunit vaccine, the vaccine can remarkably improve the humoral immunity level and the cellular immunity level excited by the vaccine at the same time, and the vaccine can be used for preparing the vaccine. Specifically, cell factors such as neutralizing antibodies GMT and IFN-gamma are remarkably increased, and the uniformity and stability of immune response are promoted, so that the immunogenicity of the existing swine fever-porcine pseudorabies bigeminy subunit vaccine is effectively improved, and the protection effect of the vaccine is enhanced.

The application discloses a recombinant pseudorabies virus strain expressing classical swine fever virus E2 protein and application, and relates to the technical field of biology.The recombinant E2 protein provided by the application successfully realizes high-level expression of the E2 protein by removing the transmembrane region of the E2 protein and using the 18aa signal peptide of the E2 protein itself and a pig albumin signal peptide.The recombinant PRV expressing the classical swine fever virus (CSFV) E2 protein can induce E2 antibodies and cellular immunity after immunization of mice.The recombinant pseudorabies virus strain provided by the application can be used as a bivalent vaccine for preventing CSFV and PRV infection.

The invention relates to the technical field of biological medicines, and aims to provide application of glutamic acid in preparation of a medicine for treating pseudorabies virus infection. Particularly, glutamic acid is applied to preparation of drugs for treating pseudorabies virus infection. The medicine takes glutamic acid as an active component, and comprises an effective amount of glutamic acid and pharmaceutically acceptable auxiliary materials. It is proved for the first time that glutamic acid can remarkably inhibit PRV replication in PK-15 cells, the effectiveness of glutamic acid in the aspects of inhibiting virus replication and improving infection symptoms and the remarkable effect of glutamic acid in the aspects of improving the survival rate and weight change of infected mice are verified, and a new scientific basis and practical support are provided for prevention and control of PRV infection. The traditional Chinese medicine composition has the characteristics of high safety and small toxic and side effects, and is low in price, easy to obtain and suitable for being popularized and used in farms. A novel treatment method is provided for coping with prevalence of porcine pseudorabies, virus transmission in pig farms is expected to be prevented, and economic losses are reduced.

This invention relates to the field of biomedical technology, specifically disclosing a STING agonist ST-71, its synthesis method, and its applications. ST-71 is obtained by modifying SR-717. The STING agonist ST-71 synthesized in this invention has the characteristics of good antiviral effect, low toxicity and side effects, and cost-effectiveness, and can also inhibit the proliferation of porcine pseudorabies virus.

The application discloses a reagent containing pig pseudorabies virus gB protein magnetic microparticle coating, a preparation method and a kit, and relates to the technical field of antibody detection. The preparation method of the reagent containing pig pseudorabies virus gB protein magnetic microparticle coating comprises the following steps: incubating magnetic microparticles and gB protein antibodies in a coating buffer solution; removing the reaction solution, and performing first sealing on the gB protein magnetic microparticle coating with a first sealing solution; after the first sealing is completed, the first sealing solution is washed away, and then the gB protein magnetic microparticle coating is sealed for the second time with a second sealing solution; after the second sealing is completed, the second sealing solution is washed away, and then resuspension is performed to obtain the reagent containing the gB protein magnetic microparticle coating. The two-step sealing method is adopted to prepare the reagent containing the pig pseudorabies virus gB protein magnetic microparticle coating, the sealing effect is good, and non-specific adsorption in the system is reduced. The kit provided by the application contains the reagent, and has the advantages of high analysis sensitivity, a wide linear range and high accuracy.

This invention relates to the field of biomedical technology, specifically to a stably expressed porcine pseudorabies virus gD recombinant protein, a vaccine composition, its preparation method, and its applications. The invention provides a stably expressed porcine pseudorabies virus gD recombinant protein, the amino acid sequence of which is shown in SEQ ID NO:7. The porcine pseudorabies virus gD recombinant protein is stably expressed in monoclonal cells, exhibiting stable expression levels after 48 consecutive passages. This lays a solid foundation for its subsequent applications in the preparation of stable porcine pseudorabies subunit vaccine compositions or in porcine pseudorabies virus vaccine efficacy testing formulations.

The application provides a construction and application of a recombinant pseudorabies virus strain stably and efficiently expressing green fluorescent protein, in the research, a green fluorescent protein gene (EGFP) is inserted into different positions of a double gene deletion vaccine strain (JS-2012-△gE / gI) of a pseudorabies virus mutant strain by using a homologous recombination method. Finally, it is proved that the recombinant virus JS-2012-△gE / gI-VP1 / 2-EGFP has good genetic stability, and the EGFP gene can also be stably and efficiently expressed, and the growth rate on cells is also comparable to that of the parent virus, so that the VP1 / 2 gene is the best exogenous gene insertion site. Subsequently, the classical swine fever virus E2 gene, the parvovirus VP2 gene, the cap gene of the circovirus type 2 and the VP1 gene of the foot-and-mouth disease virus can be replaced or inserted into the EGFP expression frame in a single or combined manner to construct different types of multi-vaccines, and the multi-vaccines have extremely high research value and platform significance.

The present invention discloses the application of JH-RE-06 in the preparation of a drug for inhibiting the DNA synthesis of pseudorabies virus. The translesion DNA synthesis pathway inhibitor JH-RE-06 has the characteristics of a REV1 inhibitor and can induce the dimerization of REV1. The REV1-mediated TLS pathway is essential for the DNA synthesis of porcine pseudorabies virus. Therefore, JH-RE-06 can inhibit the proliferation of porcine pseudorabies virus. The present invention discovers for the first time the mechanism of action of JH-RE-06 in inhibiting the proliferation of pseudorabies virus and uses this drug for antiviral purposes for the first time.

This invention discloses monoclonal antibodies that recognize linear B-cell epitopes in the conserved extracellular domain of pseudorabies virus (PRV) gE protein and their applications. Using recombinant PRV gE protein extracellular domain protein as an immunogen, hybridoma cell lines were prepared. Combining dot blot and peptide scanning techniques, two monoclonal antibodies, 4E5D7 and 8F6B2, were screened to recognize the 69-93aa region of the conserved extracellular domain of the PRV gE protein. Both antibodies achieved a titer of 1:2048000 and specifically recognized the native PRV wild-type gE protein, showing no cross-reactivity with gE gene-deleted vaccines. The monoclonal antibodies of this invention fill the gap in detection reagents targeting the precise epitopes of the 69-81aa and 79-93aa extracellular domains of the PRV gE protein, thus improving the linear B-cell epitope map of the PRV gE protein. These monoclonal antibodies can be used for research on the pathogenesis of PRV and the development of specific detection reagents for PRV wild-type strains, possessing significant application value and translational prospects in basic scientific research, veterinary clinical testing, and animal disease prevention and control.

The present invention provides an aerosol protective agent for a porcine pseudorabies live vaccine, and relates to the field of animal vaccines. The aerosol protective agent is an aqueous solution containing the following ingredients: 3-24 g / L trehalose, 3-24 g / L L-arginine, 3-24 g / L proline and 1-10% glycerol, with a pH value of 7.0-7.8. The present invention also provides a method for preparing a porcine pseudorabies live vaccine aerosol, comprising: preparing a solution of a commercially available porcine pseudorabies live vaccine freeze-dried product with an aerosol protective agent, and preparing the aerosol live vaccine by ultrasonic atomization; the aerodynamic mass median particle size of the aerosol live vaccine is 1-10 μm, and after being retained in the air for 30 minutes, it still has a high titer, a high immune protection rate, simple preparation, and low cost.

The invention belongs to the technical field of biological immunity, and particularly relates to a monoclonal antibody for resisting pseudorabies virus gC protein and application of the monoclonal antibody. The affinity of the anti-PRV monoclonal antibody is greater than or equal to 5 * 10 < 9 > L / mol, the ELISA titer is greater than or equal to 1: 5.12 * 10 < 5 >, the IPMA titer is 1: 6.4 * 10 < 3 >, and the anti-PRV monoclonal antibody has the characteristic of high sensitivity. And the kit is suitable for various detection platforms such as ELISA, IPMA, Western Blot and the like, and a reliable tool is provided for rapid detection of the PRV antigen.

The invention discloses a gene modification system capable of being used for knocking out a pig TRIM29 gene, a TRIM29 gene modified cell strain prepared by adopting the system, and application of the system in preparation of a TRIM29 gene modified pig or preparation of a PRV (pseudorabies virus) resistant pig or cultivation of a new anti-PRV pig variety. By means of the system, the TRIM29 gene modified cell strain capable of being stably inherited can be efficiently screened out, the TRIM29 gene in the cell strain has a biisometric displacement mutation genotype behind a GACCTCAGCTACTCTAAGCA sequence site, and the genotype can be stably inherited. A TRIM29 gene modified pig can be prepared by utilizing the gene modification system or the TRIM29 gene modified cell strain, the gene modified pig has improved I-type interferon level, has relatively strong disease resistance to PRV (porcine reproductive and respiratory syndrome), also has disease resistance to various I-type IFN sensitive viruses, is a broad-spectrum disease-resistant pig, and has good application prospects. Good market competitiveness and application prospects are realized.

The invention discloses an application of cepharanthine in preparation of an anti-pseudorabies virus drug, cepharanthine has no significant toxicity to cells in a concentration range of 0-8 [mu] M, and the cepharanthine can significantly reduce pseudorabies virus infection in a concentration range of 2-4 [mu] M by inhibiting viral genome replication, protein synthesis and progeny virus titer, so that the application of cepharanthine in preparation of the anti-pseudorabies virus drug is realized. The cepharanthine can be used as a safe and effective anti-pseudorabies virus drug, and has the advantages of safety, few toxic and side effects, low drug residue, no pollution and the like.

The invention discloses a porcine pseudorabies GE purification scheme, and the purification method comprises the following steps: S1, pig farm environment background evaluation and odor purification device installation; s2, evaluating the health status of the swinery and optimizing an immune program; s3, epidemic disease purification and odor cooperative control; s4, environment-epidemic disease linkage monitoring and early warning are carried out; and S5, maintaining the purification effect. The environment stress is reduced through the odor purification device, the immunity of pigs is enhanced, and the propagation opportunity of PRV is reduced; biodegradation and photocatalysis technologies are combined, so that a remarkable inactivation effect on PRV aerosol is achieved; establishing a first machine learning-based environment parameter and PRV propagation risk prediction model to realize early warning; the use amount of disinfectants is reduced by 40%, the use amount of antibiotics is reduced, and green breeding is achieved; the PRV purification period can be shortened, the maintenance cost is reduced, and meanwhile, the working environment of a pig farm is remarkably improved.

This application relates to the technical field of pseudorabies virus detection, specifically to a primer combination for pseudorabies virus detection, its application, and a reagent kit. Specifically, the amplification primers in this application exhibit good specificity and amplification efficiency when used for pseudorabies virus detection, and demonstrate good linear regression performance, enabling more accurate and precise quantitative detection of pseudorabies virus.

The invention provides a method for producing porcine pseudorabies virus recombinant protein by using bioreactor fed-batch culture, and relates to the technical field of biology. The culture method comprises the following steps: inoculating a recombinant CHO cell containing a gD protein coding gene into a basic culture medium, and controlling the temperature to be 35-37 DEG C; feeding a first fed-batch culture medium and a second fed-batch culture medium every 1-2 days from 2-4 days after inoculation, reducing the culture temperature after the exponential growth period of the cells is ended, and continuously culturing for a certain time to obtain gD protein; the basic culture medium is a Shanghai brachycarpus leaf base Eden B100S culture medium, the first feed culture medium is a Shanghai brachycarpus leaf base Eden F100a culture medium, and the second feed culture medium is a Shanghai brachycarpus leaf base Eden F100b culture medium. According to the culture method, domestic raw materials are adopted, so that the stability of a culture process is improved on the basis of reducing the cost, and meanwhile, the problem of low expression quantity of gD protein is solved.