Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine pseudorabies virus vaccine composition and preparation method and application thereof

A technique for porcine pseudorabies virus and vaccine composition, which is applied in the field of vaccine composition of porcine pseudorabies virus and preparation thereof

Active Publication Date: 2014-12-31
PU LIKE BIO ENG
View PDF5 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After the pigs are immunized with vaccines in the prior art, they cannot completely resist the wild virus attack, and symptoms such as high fever, depression, loss of appetite or extinction will still occur, the infection rate exceeds 80%, the morbidity rate exceeds 30%, and the mortality rate is between 10%. Between 20%
There is no vaccine in the prior art to solve the pseudorabies caused by the variant strain of pseudorabies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine pseudorabies virus vaccine composition and preparation method and application thereof
  • Porcine pseudorabies virus vaccine composition and preparation method and application thereof
  • Porcine pseudorabies virus vaccine composition and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1 Preparation of porcine pseudorabies virus gB and gD proteins

[0071] 1. Amplification of porcine pseudorabies virus gB and gD genes

[0072]Inoculate PRV HN1201 virus or cultures of different generations on well-growing PK15 cells. The cultures of different generations are cultures within 5-35 generations. After harvesting the virus, use MiniBEST Viral RNA / DNA Extraction Kit from TAKARA Company Ver.3.0 kit to extract PRV genomic DNA. Take 1 μl of genomic DNA as a template, and use gB and gD specific primers respectively:

[0073] gBSF: 5′ CTAGGGGGCGTCGGGGTCCTCGT 3′ and

[0074] gBSR: 5′ATGCCCGCTGGTGGCGGTCTTTGG3′

[0075] gDSF: 5′ ATGCTGCTCGCAGCGCTATTGGC 3′ and

[0076] gDSR: 5′CTACGGACCGGGCTGCGCTTTTAG3′

[0077] Perform PCR amplification using TAKARA's high-fidelity enzymes HS DNA Polymerase with GC Buffer, gB amplification conditions are: 94°C for 3min; 98°C for 10s, 68°C for 3min, 30cycles; 68°C for 5min, the PCR product is named as gB. The gD ampli...

Embodiment 2

[0086] Implementation 2 Preparation of porcine pseudorabies virus vaccine composition

[0087] Take the gB and gD proteins prepared in Example 1, slowly add them to the adjuvant, and continuously stir with an emulsifier at 800 rpm for 12 minutes during the addition process, mix well, and store at 4°C, which is the vaccine composition of porcine pseudorabies virus . See Table 1 for specific ratios.

[0088] Table 1 Composition ratio of porcine pseudorabies virus vaccine composition

[0089]

Embodiment 3

[0090] Example 3 Immunogenicity Test of Porcine Pseudorabies Virus Vaccine Composition

[0091] 36 PRV antibody-negative piglets at the age of 21 days were randomly divided into 9 groups, 4 heads / group, that is, 1-7 groups were respectively vaccine 1, vaccine 2, vaccine 3, vaccine 4, vaccine 5, and vaccine prepared in Example 1 of the present invention. 6. Vaccine 7 immunization group, the 8th group and 9th group were injected with the same amount of PBS, single immunization. 28 days after immunization, the virus was challenged, and the dose of the virus challenge was 2×10 porcine pseudorabies virus HN1201 strain 8.0 TCID 50 / head, observe the clinical condition and measure the body temperature at a fixed time every day for 7 days after the challenge.

[0092] Results Under the challenge dose, the 4 piglets in the 1st to 7th immunization groups were all protected, showed transient clinical signs and gradually returned to normal after 5 days, and finally survived. Died with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a porcine pseudorabies virus vaccine composition. The porcine pseudorabies virus vaccine composition contains a porcine pseudorabies virus subunit antigen, or a recombinant Newcastle disease virus, namely a porcine pseudorabies virus vector. The invention further provides the preparation method and application of the vaccine composition. The vaccine composition can effectively prevent related diseases of a porcine pseudorabies virus and related diseases infected by the porcine pseudorabies virus. The combination of immunogenicity antigens in the porcine pseudorabies virus vaccine composition can be induced to generate a synergetic immune effect, thereby having good immune effect, and further lowering the immune usage amount to lower the immunization cost.

Description

technical field [0001] The invention belongs to the field of veterinary biological products, and in particular relates to a vaccine composition of porcine pseudorabies virus and a preparation method thereof, and the use of the immune antigen in the preparation of prevention and / or treatment of diseases related to porcine pseudorabies virus and porcine pseudorabies virus Use of the composition for infection caused by rabies virus. Background technique [0002] Pseudorabies, also known as Aujeszky's disease, is a disease caused by swine herpesvirus type Ⅰ (Suid herpesvirus 1strain) in the α subfamily of the Herpesviridae family (Herpesviridae) in pigs, cattle, sheep and other domestic animals, poultry and wild animals. An acute infectious disease characterized by fever, severe itching (except pigs) and encephalomyelitis. Pseudorabies in pigs is widespread in our country and is seriously harmful. It is one of the main diseases restricting the production of large-scale pig farm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/245A61P31/22
Inventor 田克恭孙进忠张超林张许科
Owner PU LIKE BIO ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com