168 results about "Variant strain" patented technology

The invention provides an H1N1 broad-spectrum mRNA (messenger ribonucleic acid) vaccine taking HA (hemagglutinin) and NA (neuraminidase) protein tandem as a target and a preparation method of the H1N1 broad-spectrum mRNA vaccine, and relates to the technical field of vaccine preparation, the amino acid sequence of the mRNA vaccine is shown as SEQ ID NO.1, and the nucleotide sequence of the mRNA vaccine is shown as SEQ ID NO.2, namely, the mRNA vaccine is obtained by connecting GGGSGGSGGGSGGGGS with conserved amino acid sequences of hemagglutinin HA and neuraminidase NA. The defects in the prior art are overcome, and the broad spectrum and the protection effect of the vaccine are improved, so that the vaccine can better cope with the immune escape of the latest variant in the future.

The invention discloses a novel coronavirus neutralizing antibody, a detection kit and application of the novel coronavirus neutralizing antibody. The amino acid sequence of a heavy chain variable region of the neutralizing antibody is shown as SEQ ID No.1, and the amino acid sequence of a light chain variable region of the neutralizing antibody is shown as SEQ ID No.2. The antibody with mature affinity is screened through bioinformatics analysis of a single B cell, the antibody screening process is optimized by combining single cell RNA sequencing, VDJ rearrangement analysis and somatic cell hypermutation research, blindness of a traditional method is avoided, and the accuracy and effectiveness of antibody screening are improved. According to the neutralizing antibody GR12 provided by the invention, a heavy chain variable region and a light chain variable region of the neutralizing antibody GR12 can be specifically combined with an RBD structural domain of the SARS-CoV-2 and an S-Trimer structural domain of an Omicro variant, so that a broad-spectrum neutralizing effect on the SARS-CoV-2 virus and the variant thereof is realized. The binding activity of the antibody GR12 to S-Trimer and RBD under 2-fold and 300-fold dilution conditions is obviously superior to that of other antibodies, which indicates that the antibody GR12 has high affinity and dilution stability and is suitable for clinical large-dose administration.

The application discloses an NLR plug-in gene for improving plant disease resistance and application thereof, and belongs to the field of plant molecular biology and biotechnology.The NLR plug-in gene StEM1 has a whole gene sequence as shown in SEQ ID NO.1 and a CDS sequence as shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO.3.The gene plays a key role in improving plant disease resistance, especially resistance to field late blight variant bacteria.In the NLR background, overexpression of the gene significantly promotes the disease resistance of tobacco and potato to pathogenic pythium, and the gene is a gene for enhancing plant disease resistance by improving ETI immunity.Overexpression of the gene in the NLR background is obtained by a genetic transformation method, and a strain line is obtained to resist field variant strains, so as to cope with field diseases of crops.The application provides an excellent gene resource for green prevention and control of late blight and disease-resistant genetic engineering breeding.

The invention discloses a novel coronavirus neutralizing antibody, a detection kit and application of the novel coronavirus neutralizing antibody. The amino acid sequence of a heavy chain variable region of the neutralizing antibody is shown as SEQ ID No.1, and the amino acid sequence of a light chain variable region of the neutralizing antibody is shown as SEQ ID No.2. The antibody with mature affinity is screened through bioinformatics analysis of a single B cell, the antibody screening process is optimized by combining single cell RNA sequencing, VDJ rearrangement analysis and somatic cell hypermutation research, blindness of a traditional method is avoided, and the accuracy and effectiveness of antibody screening are improved. According to the neutralizing antibody GR75 provided by the invention, a heavy chain variable region and a light chain variable region of the neutralizing antibody GR75 can be specifically combined with an RBD structural domain of the SARS-CoV-2 and an S-Trimer structural domain of an Omicro variant, so that a broad-spectrum neutralizing effect on the SARS-CoV-2 virus and the variant thereof is realized. The binding activity of the antibody GR75 to S-Trimer and RBD under 2-fold and 300-fold dilution conditions is obviously superior to that of other antibodies, which indicates that the antibody GR75 has high affinity and dilution stability and is suitable for clinical large-dose administration.

The invention discloses a novel coronavirus neutralizing antibody GR46, a detection kit and application of the novel coronavirus neutralizing antibody GR46. The amino acid sequence of a heavy chain variable region of the neutralizing antibody is shown as SEQ ID No.1, and the amino acid sequence of a light chain variable region of the neutralizing antibody is shown as SEQ ID No.2. The antibody with mature affinity is screened through bioinformatics analysis of a single B cell, the antibody screening process is optimized by combining single cell RNA sequencing, VDJ rearrangement analysis and somatic cell hypermutation research, blindness of a traditional method is avoided, and the accuracy and effectiveness of antibody screening are improved. According to the neutralizing antibody GR46 provided by the invention, a heavy chain variable region and a light chain variable region of the neutralizing antibody GR46 can be specifically combined with an RBD structural domain of the SARS-CoV-2 and an S-Trimer structural domain of an Omicro variant, so that a broad-spectrum neutralizing effect on the SARS-CoV-2 virus and the variant thereof is realized. The binding activity of the antibody GR46 to S-Trimer and RBD under 2-time and 300-time dilution conditions is obviously superior to that of other antibodies, which indicates that the antibody GR46 has high affinity and dilution stability and is suitable for clinical large-dose administration.

The invention discloses a primer probe combination for identifying a group A streptococcus M1UK strain and application of the primer probe combination, and belongs to the technical field of streptococcus mutant strain detection. The primer probe combination provided by the invention can specifically amplify the target gene of the M1UK strain. Furthermore, a method for identifying the M1UK strain is designed according to the primer probe combination, the M1UK strain and other group A streptococcus can be effectively distinguished, and besides the advantages of being high in specificity and accurate in detection result, the method is easy, convenient and rapid to operate and high in detection efficiency, labor cost and time cost are reduced, and the method is suitable for popularization and application. The method can realize rapid and effective non-sequencing-dependent variant strain detection, and has important significance in disease prevention and control and improvement of disease treatment efficiency.

The invention belongs to the technical field of microorganisms, and discloses a bacteriophage which comprises a bacteriophage strain M01 with the preservation number of CCTCC M 20251724 or a variant strain of the bacteriophage strain M01. The variant strain and the bacteriophage strain M01 at least have 95% of average nucleotide identity on the genome. The bacteriophage M01 or the variant strain thereof provided by the invention has strong adsorption and lysis effects on aeromonas hydrophila, does not have genes for coding toxin, virulence factor or antibiotic resistance in a genome, and has good temperature stability and acid-base tolerance; the aeromonas hydrophila can be well applied to aquaculture to prevent and / or treat bacterial septicemia and other diseases caused by aeromonas hydrophila infection.

The invention relates to the technical field of biology, and particularly discloses a recombinant vector, a recombinant baculovirus and a preparation method and application of the recombinant vector and the recombinant baculovirus. According to the method for preparing the recombinant vector, pFastBac Dual is adopted as a vector to prepare a recombinant plasmid vector inserted into a VP2 gene of an avian bursal disease virus classic strain, and the recombinant plasmid vector is named as pDual-V1; the method comprises the following steps: preparing a recombinant plasmid vector into which VP2 genes of a classical strain and a variant strain of the avian bursal disease virus are inserted at the same time, and naming the recombinant plasmid vector as pDual-V1-V2; the method comprises the following steps: preparing a recombinant plasmid vector inserted into a group I type 4 fowl adenovirus Fiber-2 gene, and naming the recombinant plasmid vector as pDual-F2; the method comprises the following steps: preparing a recombinant plasmid vector into which a Fiber-2 gene and an avian reovirus sigma C gene sequence are inserted at the same time, wherein the recombinant plasmid vector is named as pDual-F2-sigma C; carrying out double enzyme digestion on the pDual-V1-V2, recovering small fragments, carrying out double enzyme digestion on the pDual-F2-sigma C, recovering large fragments, and then carrying out mixed enzyme ligation. The recombinant baculovirus can express four antigens at the same time, and effective preparation of a multi-combined vaccine is achieved.

The present disclosure relates to the use of DNA-peptide hybrid molecules to detect target molecules in a sample. In some embodiments, the DNA-peptide hybrid molecules comprise target-specific binding peptides which selectively bind to a target molecule. Kits comprising DNA-peptide hybrid molecules are also provided.

The invention provides an application of CC-115 in preparation of an anti-new coronavirus drug. The chemical name of the CC-115 is 1-ethyl-7-[2-methyl-6-(1H-1, 2, 4-triazole-3-yl) pyridine-3-yl]-3, 5-dihydropyrazino [2, 3-b] pyrazine-2 (1H)-ketone, and the structural formula of the CC-115 is shown in the description. An in-vitro Vero cell infection model finds that the CC-115 can inhibit the replication of a new coronavirus (SARS-CoV-2) original strain and an Omicro variant (EG.5.1), and the IC50 (half maximal inhibitory concentration) of the CC-115 aiming at the SARS-CoV-2 original strain is 0.004 [mu] M and 0.005 [mu] M. The CC-115 has the advantages that the CC-115 can inhibit the replication of the SARS-CoV-2 original strain and the Omicro variant (EG.5.1); the CC-115 can be used for research and development of anti-new coronavirus infection drugs, and has a good development prospect.

The application discloses a PEDV chimeric virus attenuation identification method based on reverse genetic operation and application of screening potential attenuated vaccine, and the PEDV chimeric virus CHM2013-SP BJ , CHM2013- BJ , CHM2013-SP BJ -ORF3 CHM , CHM2013-SP BJ -E CHM , CHM2013-SP BJ -M CHM , CHM2013-SP BJ -N CHM and CHM2013-(S+ORF3) BJ are constructed and rescued, loss-of-function test and gain-of-function test are carried out, and the attenuated chimeric virus CHM2013-SP BJ -ORF3 CHM and CHM2013-SP BJ -M CHM are obtained, and it is disclosed that the S gene of the PEDV variant BJ2011C promotes virus pathogenicity in cooperation with the ORF3, E and M genes, and the ORF3 gene is the most critical.

This invention provides a human antibody with neutralizing ability against the JN.1 variant of SARS-CoV-2 and its application, belonging to the field of biomedical technology. The antibody comprises a heavy chain sequence as shown in SEQ ID NO:1 and a light chain sequence as shown in SEQ ID NO:2; or comprises a heavy chain sequence as shown in SEQ ID NO:3 and a light chain sequence as shown in SEQ ID NO:4. The antibody of this invention binds to the extracellular domain of the JN.1 variant spike protein via ECG. 50 The value was significantly lower than that of its parent antibody, with a binding capacity increase of 3 to 5 times or more. In the pseudovirus neutralization experiment, the antibody showed a half-maximal neutralizing concentration (IC50) against JN.1 pseudovirus. 50 The antibody also showed significantly better performance than the parent antibody, with a neutralizing activity increase of 3 to 24 times or more. Furthermore, the antibody's melting temperature exceeded 75°C, demonstrating good thermal stability.

The invention discloses a neutralizing swine monoclonal antibody pO18-40 and a neutralizing swine monoclonal antibody pO18-43 for foot and mouth disease virus type O. The amino acid sequences of a heavy chain variable region (VH) and a light chain variable region (VL) of the antibody pO18-40 are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2; the amino acid sequences of VH and VL of the antibody pO18-43 are respectively as shown in SEQ ID No. 3 and SEQ ID No. 4. The antibody obtained by the invention is a full-swine-source antibody, can specifically neutralize the classical strain of the O-type foot-and-mouth disease virus, and can clearly distinguish the classical strain of the O / Cathay topological type from the variant strain of the O / Cathay topological type. A key antigen epitope recognized by the antibody is located at the 149th amino acid of a VP1 protein G-H ring, and the site is a key site of O / Cathay strain antigen variation and vaccine immune protection. The antibody provided by the invention provides an important tool and theoretical basis for serological detection of O-type FMDV, vaccine immune effect evaluation and optimal design of broad-spectrum vaccines.

The invention discloses a respiratory syncytial virus F protein mutant and a vaccine, and belongs to the technical field of biological medicines. The mutant is capable of inducing a higher neutralizing antibody titer against the respiratory syncytial virus. According to the invention, the amino acid sequence of the RSV pre-fusion protein is mutated and transformed, so that the stability is enhanced, the immunogenicity of the vaccine to different RSV variants is improved, and the protection effect of the vaccine is improved.

The invention provides an application of CC-115 in preparation of an anti-new coronavirus drug. The chemical name of the CC-115 is 1-ethyl-7-[2-methyl-6-(1H-1, 2, 4-triazole-3-yl) pyridine-3-yl]-3, 5-dihydropyrazino [2, 3-b] pyrazine-2 (1H)-ketone, and the structural formula of the CC-115 is shown in the description. An in-vitro Vero cell infection model finds that the CC-115 can inhibit the replication of a new coronavirus (SARS-CoV-2) original strain and an Omicro variant (EG.5.1), and the IC50 (half maximal inhibitory concentration) of the CC-115 aiming at the SARS-CoV-2 original strain is 0.004 [mu] M and 0.005 [mu] M. The CC-115 has the advantages that the CC-115 can inhibit the replication of the SARS-CoV-2 original strain and the Omicro variant (EG.5.1); the CC-115 can be used for research and development of anti-new coronavirus infection drugs, and has a good development prospect.

This invention relates to an anti-swine pseudorabies virus (PRV) preparation and the application of Rehmannia glutinosa polysaccharide in its preparation, belonging to the field of biopharmaceutical technology. This invention provides an anti-swine pseudorabies virus (PRV) preparation comprising Rehmannia glutinosa polysaccharide. It also provides the application of Rehmannia glutinosa polysaccharide in the preparation of an anti-PRV preparation for the prevention and / or treatment of swine pseudorabies. This invention utilizes Rehmannia glutinosa polysaccharide to prevent infection by the PRV variant XJ5 by reducing intracellular oxidative stress levels; it also resists viral infection by affecting viral adsorption. Furthermore, when the concentration of Rehmannia glutinosa polysaccharide is between 50 and 400 μg / mL, it can also affect viral entry and replication, and has no cytotoxicity to PK-15 cells.

This invention provides an H3N2 influenza mRNA vaccine targeting the tandem HA and NA proteins and its preparation method, relating to the field of vaccine preparation technology. The H3N2 influenza mRNA vaccine is obtained by linking the conserved amino acid sequences of HA and NA of H3N2 with GGGSGGGSGGGSGGGS, and the amino acid sequence of the H3N2 influenza mRNA vaccine is shown in SEQ ID NO.1, and the nucleic acid sequence is shown in SEQ ID NO.2. This invention overcomes the shortcomings of existing technologies, improves the protective effect of the vaccine against H3N2 influenza, and enables it to better cope with immune evasion from the latest emerging H3N2 variants.

The present application belongs to the field of molecular biology detection; specifically, it relates to the detection of SARS-CoV-2; more specifically, it relates to the detection and typing of SARS-CoV-2 variants. The present application provides a kit comprising the composition, the use of the composition, and a method for detecting SARS-CoV-2 variants and typing. The present application simultaneously realizes the detection and typing of SARS-CoV-2 variants in the reaction system by detecting different characteristic functional mutation sites on SARS-CoV-2 variants, thereby enabling different strains to be treated differently, thus making treatment and prevention more efficient. The composition of the present application is low in cost and high in throughput. Moreover, the operation is simple, and the result reading process can be determined through different channels. The whole detection process is carried out in a closed condition, avoiding false positives and environmental pollution caused by cross-contamination between samples.

This invention relates to the field of genetic engineering technology. Specifically, it provides the use of a modified ACE2 protein in the preparation of drugs for treating and / or preventing diseases caused by SARS-like coronaviruses that use ACE2 as a receptor, or in the preparation of vaccines for preventing infection by SARS-like coronaviruses that use ACE2 as a receptor. The modified hACE2 fragment and hFc protein of this invention are antibody-like proteins, which can be widely used to treat diseases caused by the original and variant strains of SARS-CoV-2, and are expected to treat diseases caused by SARS-related coronaviruses or SARS-like coronaviruses that use ACE2 as a receptor.

The invention discloses a recombinant vector for expressing varIBDV VP2 gene Meg Gene-deficient Marek's disease virus strain and its construction method and application. Meg The gene-deficient Marek's disease virus strain is obtained by using recombinant cloning technology to insert the gene fragment CMV-VP2 containing the CMV promoter sequence, varIBDV VP2 gene and terminator sequence into the Meg The gene-deleted Marek's disease virus strain rMSΔMeq US2 gene was obtained by replacing the nucleotide sequence between positions 156501-157116 of the rMSΔMeq genome, and was named rMDV-varVP2. Studies have shown that the recombinant obtained by the present invention Meg The gene-deficient Marek's disease virus rMDV-varVP2 has the same in vitro replication ability and good genetic stability as the parent virus rMSΔMeq strain, and rMDV-varVP2 can provide good protection against IBDV mutants after immunizing chickens. The present invention provides a technical means for the development of a recombinant MDV live vector vaccine.

Provided are a broad-spectrum anti-COVID-19 vaccine immunogen composition, and the preparation and a use thereof. Specifically, provided is an immunogen composition, comprising an RBD recombinant chimeric antigen, wherein the chimeric antigen comprises S protein RBD domains from two or more COVID-19 subtypes, or functional fragments thereof. The immunogen composition can further comprise a multimerization domain and a T-cell immunogen domain. Further provided are a use of the immunogen composition, a corresponding encoding molecule therefor, a vector, and / or a host cell in preparing an anti-COVID-19 vaccine. The vaccine can induce a broad-spectrum protective effect against a prototype strain and various currently prevalent variants, and can also elicit a potent cross-protective T-cell response, thereby achieving effective and broad-spectrum prevention against COVID-19 and achieving a protective effect against other coronaviruses.

The invention relates to the technical field of biological medicine, in particular to application of GW4064 in preparation of drugs for resisting porcine reproductive and respiratory syndrome virus. The invention discloses a novel application of a farnesyl ester X receptor stimulant GW4064 in preparation of a PRRSV (porcine reproductive and respiratory syndrome virus) resisting medicine. The GW4064 has strong antiviral activity on PRRSV (Porcine Reproductive and Respiratory Syndrome Virus), and particularly has a remarkable inhibition effect on a high-pathogenicity strain (HP-PRRSV). The GW4064 interferes with the life cycle of the virus by targeting the NSP3 protein of the PRRSV, so that the replication and propagation of the virus are inhibited. The GW4064 has a remarkable antiviral effect on various variants of the PRRSV, and shows a broad-spectrum antiviral effect. Meanwhile, the GW4064 is small in molecular weight, can easily enter cells, and can efficiently play a role without carrier delivery. The invention also provides a pharmaceutical composition taking GW4064 as a main active component, and a theoretical basis and a practical basis are provided for development of PRRSV antiviral drugs.

The invention discloses a humanized broad-spectrum anti-HIV-1 (human immunodeficiency virus-1) monoclonal neutralizing antibody, which is obtained by screening through a single B cell flow sorting-antibody gene amplification pairing expression technology, has a unique CDR (CDR region), can be specifically combined with HIV-1, and can effectively neutralize various pseudoviruses, even Tier 3 pseudoviruses. The invention also relates to a preparation method and application of the neutralizing antibody. The antibody provided by the invention can be used for emergency prevention and / or treatment of HIV-1 variant strains, has the characteristics of full human source, high expression and good stability, and is suitable for industrialization. In addition, the antibody can also be used for preparing an HIV-1 virus detection reagent, finding effective neutralizing epitopes and developing HIV-1 vaccines.

Methods are described for rapidly detecting the presence of variants of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that contain mutations in the spike (S) protein gene in a biological or non-biological sample. The methods may include performing an amplification step, a hybridization step, and a detection step. Additionally, primers and probes that target SARS-CoV-2 variants that contain mutations in the S gene, as well as kits designed to detect SARS-CoV-2 variants that contain mutations in the S gene, are provided.

YThe invention discloses a gene II type grass carp reovirus detection primer, a probe and a detection method. The microdroplet type digital PCR detection primer and the probe for the gene II type grass carp reovirus comprise GCRV-S6-F3: 5 '-GGCTAAGGTTACTCTGCATTGC-3', GCRV-S6-F3: 5 '- GCRV-S6-R3 is 5 '-CAGTGGTGACCAAAGTG TTGAGYT-3', and GCRV-S6-R3 is 5 '- And GCRV-S6-P3: 5 '-fluorophore, namely GGTAAACCACTTAGTGCGGAGA, namely a quenching group, namely, GCRV-S6-P3: 5'-fluorophore. According to the invention, the second base at the 3'end of GCRV-S6-R3 is designed as a degenerate base 'Y', and 'C' at the 5 'end of a probe is modified as' G '. The modified primer and probe do not influence the ddPCR amplification efficiency and specificity, and the primer has higher applicability when being used for detecting variant strains.

The invention discloses a porcine epidemic diarrhea virus G2c genotype strain as well as a separation method and application thereof. Aiming at the current epidemic PEDV variant strain, the genetic variation rule of the epidemic strain is clarified by carrying out virus separation, identification and pathogenicity analysis, and the method has important significance on epidemiology, vaccine development and the like of the PEDV. Specifically, an applicant successfully separates a PEDV strain capable of realizing stable passage propagation in Vero-CCL81 cells from intestinal contents of diarrhea piglets collected from a pig farm of Jiangpermanent Province in Hunan, the PEDV strain is identified and determined as a porcine epidemic diarrhea virus G2c subtype, the PEDV strain is named PEDV CH / HNJY / 2025, the PEDV strain is preserved in China General Microbiological Culture Collection Center on December 11, 2025, and the preservation number of the PEDV strain is CGMCC NO. The preservation number is CGMCC (China General Microbiological Culture Collection Center)

The invention relates to a traditional Chinese medicine preparation for treating infectious bursal disease as well as a preparation method and application of the traditional Chinese medicine preparation. The medicament is prepared from the following raw material components: 45 to 50 parts of radix astragali, 30 to 45 parts of radix rehmanniae, 25 to 30 parts of radix isatidis, 25 to 30 parts of folium isatidis, 10 to 45 parts of gypsum, 10 to 20 parts of honeysuckle flower, 10 to 30 parts of fructus forsythiae, 10 to 20 parts of herba taraxaci, 15 to 20 parts of rhizoma atractylodis macrocephalae, 15 to 30 parts of radix paeoniae rubra, 15 parts of bulbus lilii, 15 parts of rhizoma anemarrhenae and 10 to 30 parts of liquorice root. The medicament is prepared by extraction and concentration processes, and can effectively treat the chicken infectious bursal disease caused by the traditional infectious bursal disease virus (IBDV) and the novel variable infectious bursal disease virus (nvvIBDV). The medicine can significantly improve the cure rate of traditional and variant strains, and especially has significant advantages in the treatment of variant strains.

The invention discloses a pharmaceutical composition for preventing and treating novel coronavirus infection, the pharmaceutical composition comprises a phthalate compound, and the phthalate compound has a structure as shown in formula I (formula I); in the formula I, R1 and R2 are the same or different and are independently selected from substituted or unsubstituted straight chain or branched chain alkyl with the carbon atom number of 1-20. The pharmaceutical composition takes a phthalate compound as an active ingredient, cell membrane fusion mediated by combination of S protein of the novel coronavirus SARS-CoV-2 and a target cell receptor ACE2 is blocked, the inhibition effect on SARS-CoV-2 virus infection is achieved, in addition, the phthalate compound not only has a remarkable inhibition effect on SARS-CoV-2 wild strains, but also has a remarkable inhibition effect on the SARS-CoV-2 wild strains. And the SARS-CoV-2 mutant strain also shows a broad-spectrum antiviral effect, and is suitable for intervention of early, mild and asymptomatic novel coronavirus infection.

This invention relates to a traditional Chinese medicine preparation for treating infectious bursal disease (IBD), its preparation method, and its application. The preparation comprises the following components: Astragalus membranaceus 45-50 parts, Rehmannia glutinosa 30-45 parts, Isatis indigotica 25-30 parts, Isatis tinctoria 25-30 parts, Gypsum fibrosum 10-45 parts, Lonicera japonica 10-20 parts, Forsythia suspensa 10-30 parts, Taraxacum mongolicum 10-20 parts, Atractylodes macrocephala 15-20 parts, Paeonia lactiflora 15-30 parts, Lilium brownii 15 parts, Anemarrhena asphodeloides 15 parts, and Glycyrrhiza uralensis 10-30 parts. The preparation is achieved through extraction and concentration processes and is effective in treating IBD in chickens caused by both traditional infectious bursal disease virus (IBDV) and novel variant infectious bursal disease virus (nvvIBDV). This medicine significantly improves the cure rate against both traditional and variant strains, showing a particularly significant advantage in treating variant strains.

The application discloses a novel coronavirus vaccine and a preparation method thereof, and relates to the technical field of immunity. The application is characterized in that the sequence of the coding region of mRNA is optimized and adjusted according to the characteristics of the mutant strain of the novel coronavirus, and the optimized mRNA can deliver the S protein with strong immunogenicity in the body, so that the antibodies generated by the body have a neutralizing effect on the mutant strain of the novel coronavirus.