109 results about "Variant strain" patented technology

The invention provides an H1N1 broad-spectrum mRNA (messenger ribonucleic acid) vaccine taking HA (hemagglutinin) and NA (neuraminidase) protein tandem as a target and a preparation method of the H1N1 broad-spectrum mRNA vaccine, and relates to the technical field of vaccine preparation, the amino acid sequence of the mRNA vaccine is shown as SEQ ID NO.1, and the nucleotide sequence of the mRNA vaccine is shown as SEQ ID NO.2, namely, the mRNA vaccine is obtained by connecting GGGSGGSGGGSGGGGS with conserved amino acid sequences of hemagglutinin HA and neuraminidase NA. The defects in the prior art are overcome, and the broad spectrum and the protection effect of the vaccine are improved, so that the vaccine can better cope with the immune escape of the latest variant in the future.

The application discloses an NLR plug-in gene for improving plant disease resistance and application thereof, and belongs to the field of plant molecular biology and biotechnology.The NLR plug-in gene StEM1 has a whole gene sequence as shown in SEQ ID NO.1 and a CDS sequence as shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO.3.The gene plays a key role in improving plant disease resistance, especially resistance to field late blight variant bacteria.In the NLR background, overexpression of the gene significantly promotes the disease resistance of tobacco and potato to pathogenic pythium, and the gene is a gene for enhancing plant disease resistance by improving ETI immunity.Overexpression of the gene in the NLR background is obtained by a genetic transformation method, and a strain line is obtained to resist field variant strains, so as to cope with field diseases of crops.The application provides an excellent gene resource for green prevention and control of late blight and disease-resistant genetic engineering breeding.

The invention belongs to the technical field of microorganisms, and discloses a bacteriophage which comprises a bacteriophage strain M01 with the preservation number of CCTCC M 20251724 or a variant strain of the bacteriophage strain M01. The variant strain and the bacteriophage strain M01 at least have 95% of average nucleotide identity on the genome. The bacteriophage M01 or the variant strain thereof provided by the invention has strong adsorption and lysis effects on aeromonas hydrophila, does not have genes for coding toxin, virulence factor or antibiotic resistance in a genome, and has good temperature stability and acid-base tolerance; the aeromonas hydrophila can be well applied to aquaculture to prevent and / or treat bacterial septicemia and other diseases caused by aeromonas hydrophila infection.

The application discloses a PEDV chimeric virus attenuation identification method based on reverse genetic operation and application of screening potential attenuated vaccine, and the PEDV chimeric virus CHM2013-SP BJ , CHM2013- BJ , CHM2013-SP BJ -ORF3 CHM , CHM2013-SP BJ -E CHM , CHM2013-SP BJ -M CHM , CHM2013-SP BJ -N CHM and CHM2013-(S+ORF3) BJ are constructed and rescued, loss-of-function test and gain-of-function test are carried out, and the attenuated chimeric virus CHM2013-SP BJ -ORF3 CHM and CHM2013-SP BJ -M CHM are obtained, and it is disclosed that the S gene of the PEDV variant BJ2011C promotes virus pathogenicity in cooperation with the ORF3, E and M genes, and the ORF3 gene is the most critical.

This invention provides a human antibody with neutralizing ability against the JN.1 variant of SARS-CoV-2 and its application, belonging to the field of biomedical technology. The antibody comprises a heavy chain sequence as shown in SEQ ID NO:1 and a light chain sequence as shown in SEQ ID NO:2; or comprises a heavy chain sequence as shown in SEQ ID NO:3 and a light chain sequence as shown in SEQ ID NO:4. The antibody of this invention binds to the extracellular domain of the JN.1 variant spike protein via ECG. 50 The value was significantly lower than that of its parent antibody, with a binding capacity increase of 3 to 5 times or more. In the pseudovirus neutralization experiment, the antibody showed a half-maximal neutralizing concentration (IC50) against JN.1 pseudovirus. 50 The antibody also showed significantly better performance than the parent antibody, with a neutralizing activity increase of 3 to 24 times or more. Furthermore, the antibody's melting temperature exceeded 75°C, demonstrating good thermal stability.

The invention discloses a neutralizing swine monoclonal antibody pO18-40 and a neutralizing swine monoclonal antibody pO18-43 for foot and mouth disease virus type O. The amino acid sequences of a heavy chain variable region (VH) and a light chain variable region (VL) of the antibody pO18-40 are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2; the amino acid sequences of VH and VL of the antibody pO18-43 are respectively as shown in SEQ ID No. 3 and SEQ ID No. 4. The antibody obtained by the invention is a full-swine-source antibody, can specifically neutralize the classical strain of the O-type foot-and-mouth disease virus, and can clearly distinguish the classical strain of the O / Cathay topological type from the variant strain of the O / Cathay topological type. A key antigen epitope recognized by the antibody is located at the 149th amino acid of a VP1 protein G-H ring, and the site is a key site of O / Cathay strain antigen variation and vaccine immune protection. The antibody provided by the invention provides an important tool and theoretical basis for serological detection of O-type FMDV, vaccine immune effect evaluation and optimal design of broad-spectrum vaccines.

The invention provides an application of CC-115 in preparation of an anti-new coronavirus drug. The chemical name of the CC-115 is 1-ethyl-7-[2-methyl-6-(1H-1, 2, 4-triazole-3-yl) pyridine-3-yl]-3, 5-dihydropyrazino [2, 3-b] pyrazine-2 (1H)-ketone, and the structural formula of the CC-115 is shown in the description. An in-vitro Vero cell infection model finds that the CC-115 can inhibit the replication of a new coronavirus (SARS-CoV-2) original strain and an Omicro variant (EG.5.1), and the IC50 (half maximal inhibitory concentration) of the CC-115 aiming at the SARS-CoV-2 original strain is 0.004 [mu] M and 0.005 [mu] M. The CC-115 has the advantages that the CC-115 can inhibit the replication of the SARS-CoV-2 original strain and the Omicro variant (EG.5.1); the CC-115 can be used for research and development of anti-new coronavirus infection drugs, and has a good development prospect.

This invention relates to an anti-swine pseudorabies virus (PRV) preparation and the application of Rehmannia glutinosa polysaccharide in its preparation, belonging to the field of biopharmaceutical technology. This invention provides an anti-swine pseudorabies virus (PRV) preparation comprising Rehmannia glutinosa polysaccharide. It also provides the application of Rehmannia glutinosa polysaccharide in the preparation of an anti-PRV preparation for the prevention and / or treatment of swine pseudorabies. This invention utilizes Rehmannia glutinosa polysaccharide to prevent infection by the PRV variant XJ5 by reducing intracellular oxidative stress levels; it also resists viral infection by affecting viral adsorption. Furthermore, when the concentration of Rehmannia glutinosa polysaccharide is between 50 and 400 μg / mL, it can also affect viral entry and replication, and has no cytotoxicity to PK-15 cells.

This invention provides an H3N2 influenza mRNA vaccine targeting the tandem HA and NA proteins and its preparation method, relating to the field of vaccine preparation technology. The H3N2 influenza mRNA vaccine is obtained by linking the conserved amino acid sequences of HA and NA of H3N2 with GGGSGGGSGGGSGGGS, and the amino acid sequence of the H3N2 influenza mRNA vaccine is shown in SEQ ID NO.1, and the nucleic acid sequence is shown in SEQ ID NO.2. This invention overcomes the shortcomings of existing technologies, improves the protective effect of the vaccine against H3N2 influenza, and enables it to better cope with immune evasion from the latest emerging H3N2 variants.

The present application belongs to the field of molecular biology detection; specifically, it relates to the detection of SARS-CoV-2; more specifically, it relates to the detection and typing of SARS-CoV-2 variants. The present application provides a kit comprising the composition, the use of the composition, and a method for detecting SARS-CoV-2 variants and typing. The present application simultaneously realizes the detection and typing of SARS-CoV-2 variants in the reaction system by detecting different characteristic functional mutation sites on SARS-CoV-2 variants, thereby enabling different strains to be treated differently, thus making treatment and prevention more efficient. The composition of the present application is low in cost and high in throughput. Moreover, the operation is simple, and the result reading process can be determined through different channels. The whole detection process is carried out in a closed condition, avoiding false positives and environmental pollution caused by cross-contamination between samples.

This invention relates to the field of genetic engineering technology. Specifically, it provides the use of a modified ACE2 protein in the preparation of drugs for treating and / or preventing diseases caused by SARS-like coronaviruses that use ACE2 as a receptor, or in the preparation of vaccines for preventing infection by SARS-like coronaviruses that use ACE2 as a receptor. The modified hACE2 fragment and hFc protein of this invention are antibody-like proteins, which can be widely used to treat diseases caused by the original and variant strains of SARS-CoV-2, and are expected to treat diseases caused by SARS-related coronaviruses or SARS-like coronaviruses that use ACE2 as a receptor.

Provided are a broad-spectrum anti-COVID-19 vaccine immunogen composition, and the preparation and a use thereof. Specifically, provided is an immunogen composition, comprising an RBD recombinant chimeric antigen, wherein the chimeric antigen comprises S protein RBD domains from two or more COVID-19 subtypes, or functional fragments thereof. The immunogen composition can further comprise a multimerization domain and a T-cell immunogen domain. Further provided are a use of the immunogen composition, a corresponding encoding molecule therefor, a vector, and / or a host cell in preparing an anti-COVID-19 vaccine. The vaccine can induce a broad-spectrum protective effect against a prototype strain and various currently prevalent variants, and can also elicit a potent cross-protective T-cell response, thereby achieving effective and broad-spectrum prevention against COVID-19 and achieving a protective effect against other coronaviruses.

The invention discloses a humanized broad-spectrum anti-HIV-1 (human immunodeficiency virus-1) monoclonal neutralizing antibody, which is obtained by screening through a single B cell flow sorting-antibody gene amplification pairing expression technology, has a unique CDR (CDR region), can be specifically combined with HIV-1, and can effectively neutralize various pseudoviruses, even Tier 3 pseudoviruses. The invention also relates to a preparation method and application of the neutralizing antibody. The antibody provided by the invention can be used for emergency prevention and / or treatment of HIV-1 variant strains, has the characteristics of full human source, high expression and good stability, and is suitable for industrialization. In addition, the antibody can also be used for preparing an HIV-1 virus detection reagent, finding effective neutralizing epitopes and developing HIV-1 vaccines.

Methods are described for rapidly detecting the presence of variants of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that contain mutations in the spike (S) protein gene in a biological or non-biological sample. The methods may include performing an amplification step, a hybridization step, and a detection step. Additionally, primers and probes that target SARS-CoV-2 variants that contain mutations in the S gene, as well as kits designed to detect SARS-CoV-2 variants that contain mutations in the S gene, are provided.

YThe invention discloses a gene II type grass carp reovirus detection primer, a probe and a detection method. The microdroplet type digital PCR detection primer and the probe for the gene II type grass carp reovirus comprise GCRV-S6-F3: 5 '-GGCTAAGGTTACTCTGCATTGC-3', GCRV-S6-F3: 5 '- GCRV-S6-R3 is 5 '-CAGTGGTGACCAAAGTG TTGAGYT-3', and GCRV-S6-R3 is 5 '- And GCRV-S6-P3: 5 '-fluorophore, namely GGTAAACCACTTAGTGCGGAGA, namely a quenching group, namely, GCRV-S6-P3: 5'-fluorophore. According to the invention, the second base at the 3'end of GCRV-S6-R3 is designed as a degenerate base 'Y', and 'C' at the 5 'end of a probe is modified as' G '. The modified primer and probe do not influence the ddPCR amplification efficiency and specificity, and the primer has higher applicability when being used for detecting variant strains.

The invention discloses a porcine epidemic diarrhea virus G2c genotype strain as well as a separation method and application thereof. Aiming at the current epidemic PEDV variant strain, the genetic variation rule of the epidemic strain is clarified by carrying out virus separation, identification and pathogenicity analysis, and the method has important significance on epidemiology, vaccine development and the like of the PEDV. Specifically, an applicant successfully separates a PEDV strain capable of realizing stable passage propagation in Vero-CCL81 cells from intestinal contents of diarrhea piglets collected from a pig farm of Jiangpermanent Province in Hunan, the PEDV strain is identified and determined as a porcine epidemic diarrhea virus G2c subtype, the PEDV strain is named PEDV CH / HNJY / 2025, the PEDV strain is preserved in China General Microbiological Culture Collection Center on December 11, 2025, and the preservation number of the PEDV strain is CGMCC NO. The preservation number is CGMCC (China General Microbiological Culture Collection Center)

The invention discloses a pharmaceutical composition for preventing and treating novel coronavirus infection, the pharmaceutical composition comprises a phthalate compound, and the phthalate compound has a structure as shown in formula I (formula I); in the formula I, R1 and R2 are the same or different and are independently selected from substituted or unsubstituted straight chain or branched chain alkyl with the carbon atom number of 1-20. The pharmaceutical composition takes a phthalate compound as an active ingredient, cell membrane fusion mediated by combination of S protein of the novel coronavirus SARS-CoV-2 and a target cell receptor ACE2 is blocked, the inhibition effect on SARS-CoV-2 virus infection is achieved, in addition, the phthalate compound not only has a remarkable inhibition effect on SARS-CoV-2 wild strains, but also has a remarkable inhibition effect on the SARS-CoV-2 wild strains. And the SARS-CoV-2 mutant strain also shows a broad-spectrum antiviral effect, and is suitable for intervention of early, mild and asymptomatic novel coronavirus infection.

This invention relates to a traditional Chinese medicine preparation for treating infectious bursal disease (IBD), its preparation method, and its application. The preparation comprises the following components: Astragalus membranaceus 45-50 parts, Rehmannia glutinosa 30-45 parts, Isatis indigotica 25-30 parts, Isatis tinctoria 25-30 parts, Gypsum fibrosum 10-45 parts, Lonicera japonica 10-20 parts, Forsythia suspensa 10-30 parts, Taraxacum mongolicum 10-20 parts, Atractylodes macrocephala 15-20 parts, Paeonia lactiflora 15-30 parts, Lilium brownii 15 parts, Anemarrhena asphodeloides 15 parts, and Glycyrrhiza uralensis 10-30 parts. The preparation is achieved through extraction and concentration processes and is effective in treating IBD in chickens caused by both traditional infectious bursal disease virus (IBDV) and novel variant infectious bursal disease virus (nvvIBDV). This medicine significantly improves the cure rate against both traditional and variant strains, showing a particularly significant advantage in treating variant strains.

The application discloses a novel coronavirus vaccine and a preparation method thereof, and relates to the technical field of immunity. The application is characterized in that the sequence of the coding region of mRNA is optimized and adjusted according to the characteristics of the mutant strain of the novel coronavirus, and the optimized mRNA can deliver the S protein with strong immunogenicity in the body, so that the antibodies generated by the body have a neutralizing effect on the mutant strain of the novel coronavirus.

The invention discloses application of BGT226 maleate in preparation of novel coronavirus resisting drugs, and belongs to the technical field of antiviral drugs. According to the application of the BGT226 maleate in preparation of the novel coronavirus resisting medicine, tests find that the IC50 of the BGT226 maleate for an SARS-CoV-2 original strain is 0.116 mu M, the IC50 of the BGT226 maleate for an Omicro variant (JN.1) is 0.084 mu M, and the BGT226 maleate has good biological safety, can be used for research and development of the novel coronavirus infection resisting medicine, is a potential medicine for treating novel coronavirus infection, and has wide application prospects. And a new direction and possibility are provided for the treatment of the novel coronavirus and the variant thereof.

The application provides a porcine epidemic diarrhea virus mutant strain and application thereof. The application obtains a porcine epidemic diarrhea virus mutant strain GX2506 from porcine intestinal tissue, and the strain is purified through passage, and the microorganism preservation number of the strain is CGMCC No. 47089. The isolated strain can stably proliferate on a passage cell, and typical cytopathic effect is generated. The porcine epidemic diarrhea virus mutant isolated strain has excellent immunogenicity; a vaccine prepared by using the isolated strain can induce piglets to generate high-level neutralizing antibodies; meanwhile, an ELISA kit prepared by using the isolated strain can better detect porcine epidemic diarrhea virus antibodies in serum.

To provide adeno-associated variants, formulations and methods for pulmonary delivery.SOLUTION: The present disclosure provides variant AAV capsid proteins that confer tropism for lung cells, as well as recombinant adeno-associated viruses comprising the variant AAVs and pharmaceutical compositions comprising the same, and their use in the delivery of heterologous nucleic acids to lung cells for the treatment of lung disorders. (ii) nucleic acids comprising, from 5 ' to 3 ', (a) AAV2 terminal repeats, (b) a promoter, (c) a nucleotide sequence encoding a human cystic fibrosis transmembrane conductance regulator (CFTR) or a biologically active truncated CFTR lacking amino acids 708 to 759 of the human CFTR sequence, (d) a poly-adenylation sequence, and (e) AAV2 terminal repeats.SELECTED DRAWING: None

The invention discloses application of a series of extremely early stem cells or differentiated cell lineages thereof in preparation and detection of influenza viruses and drug screening, and belongs to the field of cell application. Specifically, trophoblast stem cells (TSC) and amnion-like stem cells (AME) obtained by extremely early cell induced differentiation and screening are used for influenza virus infection or screening test. Experiments prove that extraembryonic differentiation cell models such as trophoblast stem cells, amniotic stem cells and / or differentiated cell lineages thereof are highly susceptible to influenza viruses, and have important application values in the aspects of efficient preparation and detection of viruses and variants thereof, preparation of preventive vaccines and screening of therapeutic drugs. The method not only aims at human-derived influenza viruses and variants thereof, but also has important significance on prevention and treatment of animal influenza and variants thereof.

This invention relates to the field of biology, specifically providing a hybridoma cell line targeting the S1 gene of the G2c variant of porcine epidemic diarrhea virus (PEDV) and the specific antigenic epitope recognized by the antibody secreted by this cell line. 680 SGQLLAFKNVTSGAVYSV 697 This invention also discloses the heavy and light chain variable region sequences of the antibody. The hybridoma cell line exhibits high specificity and stability, and the antibody it secretes can specifically recognize the S1 protein of the PEDV G2c variant. This provides key biomaterials and technical support for the rapid diagnosis, vaccine development, and pathogenic mechanism research of the PEDV G2c variant, and has significant application value in the field of livestock disease prevention and control.

The invention relates to the technical field of virus detection, and particularly discloses a dual-identification fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for foot-and-mouth disease viruses A and O. The kit comprises a specific primer combination, a specific fluorescent probe, a fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) reaction solution, a positive control and a negative control, the primer combination comprises a primer pair targeting an A type VP1 gene and an O type 3D gene, and a degenerate base exists in the primer pair so as to improve the detection coverage rate of variant strains; fAM and HEX reporter groups are respectively marked by fluorescent probe sequences; the recombinant cold shock protein and the recombinant human serum albumin are added into the reaction liquid to optimize the reaction performance; the kit also comprises an internal standard system for monitoring false negative; the kit solves the problems of insufficient broad spectrum, multiple detection interference and quality control deficiency in the prior art, has the advantages of high specificity, high sensitivity, high reliability and high throughput, and is suitable for rapid typing and monitoring of foot and mouth disease viruses.

The application provides a construction and application of a recombinant pseudorabies virus strain stably and efficiently expressing green fluorescent protein, in the research, a green fluorescent protein gene (EGFP) is inserted into different positions of a double gene deletion vaccine strain (JS-2012-△gE / gI) of a pseudorabies virus mutant strain by using a homologous recombination method. Finally, it is proved that the recombinant virus JS-2012-△gE / gI-VP1 / 2-EGFP has good genetic stability, and the EGFP gene can also be stably and efficiently expressed, and the growth rate on cells is also comparable to that of the parent virus, so that the VP1 / 2 gene is the best exogenous gene insertion site. Subsequently, the classical swine fever virus E2 gene, the parvovirus VP2 gene, the cap gene of the circovirus type 2 and the VP1 gene of the foot-and-mouth disease virus can be replaced or inserted into the EGFP expression frame in a single or combined manner to construct different types of multi-vaccines, and the multi-vaccines have extremely high research value and platform significance.

The invention discloses an S protein mutant of SARS-CoV-2, an mRNA (messenger ribonucleic acid) vaccine for encoding the S protein mutant and application of the S protein mutant. The S protein mutant or the mRNA vaccine provided by the invention has a good protection effect on mainstream variants of the current SARS-CoV-2 virus, such as the strain JN.1, the strain XBB.1, the strain KP.2, the strain KP.3, the strain XDV, the strain BA.2. 86, the strain XEC or the strain LP.8.1, and has a wide clinical application prospect.

The invention relates to a recombinant trimer immunogen with a broad-spectrum and high-level immune protection effect on a Sabebe coronavirus and application of the recombinant trimer immunogen. The recombinant trimer immunogen is formed by recombining and chimeric S protein RBD structural domains or functional active fragments of the S protein RBD structural domains of two SARS-CoV-2 virus strains and S protein RBD structural domains or functional active fragments of the S protein RBD structural domains of SARS-CoV. The recombinant trimer immunogen not only can provide balanced and efficient immune protection for an SARS-CoV-2 prototype strain, a D164G mutant strain and various types of variants of an Omicron pedigree, but also can efficiently stimulate an organism to generate high-level neutralizing antibodies aiming at various other sabbe coronavirus viruses; according to the present invention, the Sarabis coronavirus immunogen has the broad-spectrum and high-efficiency immune protection effect on the Sarabis coronavirus, such that the Sarabis coronavirus immunogen has the great potential to become the core immunogen of the broad-spectrum vaccine for the Sarabis coronavirus, and has high clinical application value and high clinical application prospect.

The purpose of the present invention is to obtain: a novel variant strain which is a yeast belonging to the genus Grease Yeast and which has excellent grease-producing ability compared to known high-grease-producing variants; and a method for producing a palm oil substitute grease using the novel variant. The invention relates to a novel grease high-yield variant strain, which belongs to a yeast of Lipomyces, and is preserved in the Japan independent administrative law product evaluation technology base plate mechanism patent microbiological preservation center with the preservation number of NITE BP-03796. The present invention relates to a novel variant strain with high yield of oil and fat, which is obtained by subjecting CBS1807, which is a wild strain of Lipomyces starkeyi, to UV irradiation to induce variation so as to obtain a variant strain N5, subjecting the variant strain N5 to UV irradiation to induce variation, separating a low-density component by a Percoll density gradient centrifugation method, and repeatedly culturing the separated low-density component.

The application provides an mRNA vaccine and a preparation method and application thereof. Specifically, the application provides application of GMCSF as an immune adjuvant in preparation of an mRNA vaccine, and further provides an mRNA molecule, which encodes a GMCSF-antigen-FC1 fusion protein, wherein the GMCSF-antigen-FC1 fusion protein comprises, from an N terminus to a C terminus, an amino acid sequence of GMCSF, an amino acid sequence of an antigen and an amino acid sequence of FC1 in sequence, wherein the antigen is an antigen from a virus. The mRNA molecule of the application can be used for preparing a vaccine for preventing infection of novel coronavirus BA2 and BA5 mutant strains, and can induce a strong immune response.