64 results about "Variant strain" patented technology

The application discloses a PEDV chimeric virus attenuation identification method based on reverse genetic operation and application of screening potential attenuated vaccine, and the PEDV chimeric virus CHM2013-SP BJ , CHM2013- BJ , CHM2013-SP BJ -ORF3 CHM , CHM2013-SP BJ -E CHM , CHM2013-SP BJ -M CHM , CHM2013-SP BJ -N CHM and CHM2013-(S+ORF3) BJ are constructed and rescued, loss-of-function test and gain-of-function test are carried out, and the attenuated chimeric virus CHM2013-SP BJ -ORF3 CHM and CHM2013-SP BJ -M CHM are obtained, and it is disclosed that the S gene of the PEDV variant BJ2011C promotes virus pathogenicity in cooperation with the ORF3, E and M genes, and the ORF3 gene is the most critical.

This invention provides a human antibody with neutralizing ability against the JN.1 variant of SARS-CoV-2 and its application, belonging to the field of biomedical technology. The antibody comprises a heavy chain sequence as shown in SEQ ID NO:1 and a light chain sequence as shown in SEQ ID NO:2; or comprises a heavy chain sequence as shown in SEQ ID NO:3 and a light chain sequence as shown in SEQ ID NO:4. The antibody of this invention binds to the extracellular domain of the JN.1 variant spike protein via ECG. 50 The value was significantly lower than that of its parent antibody, with a binding capacity increase of 3 to 5 times or more. In the pseudovirus neutralization experiment, the antibody showed a half-maximal neutralizing concentration (IC50) against JN.1 pseudovirus. 50 The antibody also showed significantly better performance than the parent antibody, with a neutralizing activity increase of 3 to 24 times or more. Furthermore, the antibody's melting temperature exceeded 75°C, demonstrating good thermal stability.

The invention discloses a neutralizing swine monoclonal antibody pO18-40 and a neutralizing swine monoclonal antibody pO18-43 for foot and mouth disease virus type O. The amino acid sequences of a heavy chain variable region (VH) and a light chain variable region (VL) of the antibody pO18-40 are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2; the amino acid sequences of VH and VL of the antibody pO18-43 are respectively as shown in SEQ ID No. 3 and SEQ ID No. 4. The antibody obtained by the invention is a full-swine-source antibody, can specifically neutralize the classical strain of the O-type foot-and-mouth disease virus, and can clearly distinguish the classical strain of the O / Cathay topological type from the variant strain of the O / Cathay topological type. A key antigen epitope recognized by the antibody is located at the 149th amino acid of a VP1 protein G-H ring, and the site is a key site of O / Cathay strain antigen variation and vaccine immune protection. The antibody provided by the invention provides an important tool and theoretical basis for serological detection of O-type FMDV, vaccine immune effect evaluation and optimal design of broad-spectrum vaccines.

The invention provides an application of CC-115 in preparation of an anti-new coronavirus drug. The chemical name of the CC-115 is 1-ethyl-7-[2-methyl-6-(1H-1, 2, 4-triazole-3-yl) pyridine-3-yl]-3, 5-dihydropyrazino [2, 3-b] pyrazine-2 (1H)-ketone, and the structural formula of the CC-115 is shown in the description. An in-vitro Vero cell infection model finds that the CC-115 can inhibit the replication of a new coronavirus (SARS-CoV-2) original strain and an Omicro variant (EG.5.1), and the IC50 (half maximal inhibitory concentration) of the CC-115 aiming at the SARS-CoV-2 original strain is 0.004 [mu] M and 0.005 [mu] M. The CC-115 has the advantages that the CC-115 can inhibit the replication of the SARS-CoV-2 original strain and the Omicro variant (EG.5.1); the CC-115 can be used for research and development of anti-new coronavirus infection drugs, and has a good development prospect.

This invention relates to an anti-swine pseudorabies virus (PRV) preparation and the application of Rehmannia glutinosa polysaccharide in its preparation, belonging to the field of biopharmaceutical technology. This invention provides an anti-swine pseudorabies virus (PRV) preparation comprising Rehmannia glutinosa polysaccharide. It also provides the application of Rehmannia glutinosa polysaccharide in the preparation of an anti-PRV preparation for the prevention and / or treatment of swine pseudorabies. This invention utilizes Rehmannia glutinosa polysaccharide to prevent infection by the PRV variant XJ5 by reducing intracellular oxidative stress levels; it also resists viral infection by affecting viral adsorption. Furthermore, when the concentration of Rehmannia glutinosa polysaccharide is between 50 and 400 μg / mL, it can also affect viral entry and replication, and has no cytotoxicity to PK-15 cells.

This invention provides an H3N2 influenza mRNA vaccine targeting the tandem HA and NA proteins and its preparation method, relating to the field of vaccine preparation technology. The H3N2 influenza mRNA vaccine is obtained by linking the conserved amino acid sequences of HA and NA of H3N2 with GGGSGGGSGGGSGGGS, and the amino acid sequence of the H3N2 influenza mRNA vaccine is shown in SEQ ID NO.1, and the nucleic acid sequence is shown in SEQ ID NO.2. This invention overcomes the shortcomings of existing technologies, improves the protective effect of the vaccine against H3N2 influenza, and enables it to better cope with immune evasion from the latest emerging H3N2 variants.

The present application belongs to the field of molecular biology detection; specifically, it relates to the detection of SARS-CoV-2; more specifically, it relates to the detection and typing of SARS-CoV-2 variants. The present application provides a kit comprising the composition, the use of the composition, and a method for detecting SARS-CoV-2 variants and typing. The present application simultaneously realizes the detection and typing of SARS-CoV-2 variants in the reaction system by detecting different characteristic functional mutation sites on SARS-CoV-2 variants, thereby enabling different strains to be treated differently, thus making treatment and prevention more efficient. The composition of the present application is low in cost and high in throughput. Moreover, the operation is simple, and the result reading process can be determined through different channels. The whole detection process is carried out in a closed condition, avoiding false positives and environmental pollution caused by cross-contamination between samples.

Methods are described for rapidly detecting the presence of variants of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that contain mutations in the spike (S) protein gene in a biological or non-biological sample. The methods may include performing an amplification step, a hybridization step, and a detection step. Additionally, primers and probes that target SARS-CoV-2 variants that contain mutations in the S gene, as well as kits designed to detect SARS-CoV-2 variants that contain mutations in the S gene, are provided.

YThe invention discloses a gene II type grass carp reovirus detection primer, a probe and a detection method. The microdroplet type digital PCR detection primer and the probe for the gene II type grass carp reovirus comprise GCRV-S6-F3: 5 '-GGCTAAGGTTACTCTGCATTGC-3', GCRV-S6-F3: 5 '- GCRV-S6-R3 is 5 '-CAGTGGTGACCAAAGTG TTGAGYT-3', and GCRV-S6-R3 is 5 '- And GCRV-S6-P3: 5 '-fluorophore, namely GGTAAACCACTTAGTGCGGAGA, namely a quenching group, namely, GCRV-S6-P3: 5'-fluorophore. According to the invention, the second base at the 3'end of GCRV-S6-R3 is designed as a degenerate base 'Y', and 'C' at the 5 'end of a probe is modified as' G '. The modified primer and probe do not influence the ddPCR amplification efficiency and specificity, and the primer has higher applicability when being used for detecting variant strains.

The invention discloses a porcine epidemic diarrhea virus G2c genotype strain as well as a separation method and application thereof. Aiming at the current epidemic PEDV variant strain, the genetic variation rule of the epidemic strain is clarified by carrying out virus separation, identification and pathogenicity analysis, and the method has important significance on epidemiology, vaccine development and the like of the PEDV. Specifically, an applicant successfully separates a PEDV strain capable of realizing stable passage propagation in Vero-CCL81 cells from intestinal contents of diarrhea piglets collected from a pig farm of Jiangpermanent Province in Hunan, the PEDV strain is identified and determined as a porcine epidemic diarrhea virus G2c subtype, the PEDV strain is named PEDV CH / HNJY / 2025, the PEDV strain is preserved in China General Microbiological Culture Collection Center on December 11, 2025, and the preservation number of the PEDV strain is CGMCC NO. The preservation number is CGMCC (China General Microbiological Culture Collection Center)

The invention discloses a pharmaceutical composition for preventing and treating novel coronavirus infection, the pharmaceutical composition comprises a phthalate compound, and the phthalate compound has a structure as shown in formula I (formula I); in the formula I, R1 and R2 are the same or different and are independently selected from substituted or unsubstituted straight chain or branched chain alkyl with the carbon atom number of 1-20. The pharmaceutical composition takes a phthalate compound as an active ingredient, cell membrane fusion mediated by combination of S protein of the novel coronavirus SARS-CoV-2 and a target cell receptor ACE2 is blocked, the inhibition effect on SARS-CoV-2 virus infection is achieved, in addition, the phthalate compound not only has a remarkable inhibition effect on SARS-CoV-2 wild strains, but also has a remarkable inhibition effect on the SARS-CoV-2 wild strains. And the SARS-CoV-2 mutant strain also shows a broad-spectrum antiviral effect, and is suitable for intervention of early, mild and asymptomatic novel coronavirus infection.

The application provides a porcine epidemic diarrhea virus mutant strain and application thereof. The application obtains a porcine epidemic diarrhea virus mutant strain GX2506 from porcine intestinal tissue, and the strain is purified through passage, and the microorganism preservation number of the strain is CGMCC No. 47089. The isolated strain can stably proliferate on a passage cell, and typical cytopathic effect is generated. The porcine epidemic diarrhea virus mutant isolated strain has excellent immunogenicity; a vaccine prepared by using the isolated strain can induce piglets to generate high-level neutralizing antibodies; meanwhile, an ELISA kit prepared by using the isolated strain can better detect porcine epidemic diarrhea virus antibodies in serum.

To provide adeno-associated variants, formulations and methods for pulmonary delivery.SOLUTION: The present disclosure provides variant AAV capsid proteins that confer tropism for lung cells, as well as recombinant adeno-associated viruses comprising the variant AAVs and pharmaceutical compositions comprising the same, and their use in the delivery of heterologous nucleic acids to lung cells for the treatment of lung disorders. (ii) nucleic acids comprising, from 5 ' to 3 ', (a) AAV2 terminal repeats, (b) a promoter, (c) a nucleotide sequence encoding a human cystic fibrosis transmembrane conductance regulator (CFTR) or a biologically active truncated CFTR lacking amino acids 708 to 759 of the human CFTR sequence, (d) a poly-adenylation sequence, and (e) AAV2 terminal repeats.SELECTED DRAWING: None

The invention discloses application of a series of extremely early stem cells or differentiated cell lineages thereof in preparation and detection of influenza viruses and drug screening, and belongs to the field of cell application. Specifically, trophoblast stem cells (TSC) and amnion-like stem cells (AME) obtained by extremely early cell induced differentiation and screening are used for influenza virus infection or screening test. Experiments prove that extraembryonic differentiation cell models such as trophoblast stem cells, amniotic stem cells and / or differentiated cell lineages thereof are highly susceptible to influenza viruses, and have important application values in the aspects of efficient preparation and detection of viruses and variants thereof, preparation of preventive vaccines and screening of therapeutic drugs. The method not only aims at human-derived influenza viruses and variants thereof, but also has important significance on prevention and treatment of animal influenza and variants thereof.

This invention relates to the field of biology, specifically providing a hybridoma cell line targeting the S1 gene of the G2c variant of porcine epidemic diarrhea virus (PEDV) and the specific antigenic epitope recognized by the antibody secreted by this cell line. 680 SGQLLAFKNVTSGAVYSV 697 This invention also discloses the heavy and light chain variable region sequences of the antibody. The hybridoma cell line exhibits high specificity and stability, and the antibody it secretes can specifically recognize the S1 protein of the PEDV G2c variant. This provides key biomaterials and technical support for the rapid diagnosis, vaccine development, and pathogenic mechanism research of the PEDV G2c variant, and has significant application value in the field of livestock disease prevention and control.

The invention discloses an S protein mutant of SARS-CoV-2, an mRNA (messenger ribonucleic acid) vaccine for encoding the S protein mutant and application of the S protein mutant. The S protein mutant or the mRNA vaccine provided by the invention has a good protection effect on mainstream variants of the current SARS-CoV-2 virus, such as the strain JN.1, the strain XBB.1, the strain KP.2, the strain KP.3, the strain XDV, the strain BA.2. 86, the strain XEC or the strain LP.8.1, and has a wide clinical application prospect.

The application provides an mRNA vaccine and a preparation method and application thereof. Specifically, the application provides application of GMCSF as an immune adjuvant in preparation of an mRNA vaccine, and further provides an mRNA molecule, which encodes a GMCSF-antigen-FC1 fusion protein, wherein the GMCSF-antigen-FC1 fusion protein comprises, from an N terminus to a C terminus, an amino acid sequence of GMCSF, an amino acid sequence of an antigen and an amino acid sequence of FC1 in sequence, wherein the antigen is an antigen from a virus. The mRNA molecule of the application can be used for preparing a vaccine for preventing infection of novel coronavirus BA2 and BA5 mutant strains, and can induce a strong immune response.

The application discloses a novel coronavirus neutralizing antibody, a detection kit and application thereof, an amino acid sequence of a heavy chain variable region of the neutralizing antibody is shown as SEQ ID No. 1, and an amino acid sequence of a light chain variable region is shown as SEQ ID No. 2. The application screens the affinity-matured antibody through bioinformatics analysis of a single B cell, combines single-cell RNA sequencing, VDJ rearrangement analysis and somatic hypermutation research, optimizes the antibody screening process, avoids blindness of a traditional method, and improves the accuracy and effectiveness of antibody screening. The neutralizing antibody GR58 provided by the application can specifically combine with a RBD domain of SARS-CoV-2 and a S-Trimer domain of an Omicron mutant strain through the heavy chain and light chain variable regions, realizes broad-spectrum neutralization of SARS-CoV-2 and mutant strains thereof, and the antibody GR58 is significantly superior to other antibodies in the binding activity of S-Trimer and RBD under 2-fold and 300-fold dilution conditions, indicating that the antibody has high affinity and dilution stability, and is suitable for clinical large-dose administration requirements.

The present application belongs to the technical field of biological pharmacy, and particularly relates to a polypeptide composition of a novel coronavirus, a vaccine prepared therefrom and application thereof. The polypeptide composition of the novel coronavirus comprises four polypeptides of GY, VV, VS and DL. Experiments show that the polypeptide or the composition thereof can effectively induce T cell immune response and specific humoral immunity against SARS-CoV-2 and its mutant strains, stimulate the body to produce antigen-specific antibodies, provide a basis for constructing SARS-CoV2 preventive and / or therapeutic antibodies with high affinity, high quality and strong specificity, and have high application value for prevention and treatment of the novel coronavirus.

The invention provides a nucleocapsid protein mutant, a gene, a recombinant expression vector, a mutant virus strain and application, and belongs to the technical field of biological medicine. On the basis of an SARS-CoV-2 virus-like particle (VLP) pseudotyping technology, it is found that N protein alanine mutation occurs, a hydrophobic pocket of N protein CTD is destroyed by L353A, H356A, I357A, D358A and Y360A, and the nucleic acid binding affinity is reduced; it is also found that F403A, F407A and M411A lead to increase of N protein monomers, decrease of tetramers and increase of abnormally high poly N protein, and replication of SARS-CoV-2 wild living viruses and variants is inhibited. Meanwhile, the chiral D-type polypeptide is designed for the CTD region, and it is found that the chiral D-type polypeptide can effectively inhibit assembling of the VLP pseudovirus.

The invention belongs to the technical field of plant virus molecular detection, particularly discloses a multiplex RT-PCR method and a kit for detecting important blueberry viruses, and particularly provides a multiplex RT-PCR detection primer for the blueberry viruses, and the sequence of the primer is shown as SEQ ID NO.1-12. The technical scheme provided by the invention is wide in detection range, high in specificity, high in specificity and high in sensitivity. The kit can be used for simultaneously detecting blueberry scorching virus, blueberry shock virus standard strains and variants thereof, tomato fruit ring spot virus, blueberry necrotic mottle virus and apple mosaic virus, solves the problem that the variants and different virus strains cannot be detected by a traditional ELISA method, covers main blueberry viruses and trans-boundary infected key virus types, and is high in specificity and high in sensitivity. The sensitivity is high.

The present application belongs to the field of biotechnology, and in particular relates to a pathogen detection composition, a kit and use thereof, and more particularly relates to a pathogen detection composition, a kit and use thereof based on metagenomic sequencing. Using the composition of the present application, multiple types of targets can be captured and enriched simultaneously in one tube, and multiple pathogens and their derived mutant strains can be quickly identified. At the same time, through enrichment, the amount of data required for subsequent sequencing is significantly reduced, and the possibility of missing detection of low-load pathogens is avoided.

An object of the system according to the embodiment is to perform quick and effective prediction and measures for preventing occurrence of a new pandemic.SOLUTION: A system includes a variant prediction unit, a vaccine design unit, a data collection unit, and a preventive measure proposal unit. The variant prediction unit predicts a variant of a virus. The vaccine design unit designs a vaccine based on the structure information of the variant predicted by the variant prediction unit. The data collection unit collects and analyzes disease data collected from around the world in real time. A preventive measure proposal part proposes preventive measures in cooperation with an international health organization on the basis of the data collected and analyzed by the data collection part.SELECTED DRAWING: Figure 1

The invention discloses a composition containing a G4 stabilizer and a TLS pathway inhibitor and application of the composition. The G4 stabilizer is TMPyP4, the TLS pathway inhibitor is JH-RE-06, and the mass ratio of the G4 stabilizer to the TLS pathway inhibitor is (15-30): 1; the composition can be used for preparing drugs for preventing or treating pseudorabies virus infection or diseases related to pseudorabies virus infection, or can be used for preparing products for inhibiting replication and proliferation of pseudorabies virus or DNA synthesis. Therefore, the invention provides a novel antiviral strategy of blocking virus DNA synthesis through double targets instead of directly acting on virus protein, and provides a new drug research and development path and treatment thought for coping with PRV variants and breaking through the insufficient protection of existing vaccines.

The invention provides a monoclonal antibody aiming at human SARS-CoV-2 or an antigen binding fragment of the monoclonal antibody, a related product of the monoclonal antibody, and a preparation method and application of the monoclonal antibody and the related product. The monoclonal antibody or the antigen binding fragment of the monoclonal antibody can be specifically bound with highly conservative S2 subunits in S proteins of various SARS-CoV-2 variants with relatively high affinity, and has relatively high neutralizing activity on viruses of various SARS-CoV-2 variants, so that the monoclonal antibody or the antigen binding fragment of the monoclonal antibody has extremely high potential and is developed into a broad-spectrum detection kit and a therapeutic antibody aiming at the SARS-CoV-2; the kit can be used as a treatment emergency plan standby scheme when severe infection is caused by the new SARS-CoV-2 variant, shows a remarkable application prospect in the fields of clinical detection, treatment and emergency prevention and control of SARS-CoV-2, and has an extremely high application value.

This application relates to the field of virus detection technology, specifically disclosing a dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus (FMD) types A and O. The kit includes a specific primer set, specific fluorescent probes, a fluorescent RT-PCR reaction solution, a positive control, and a negative control. The primer set contains primer pairs targeting the type A VP1 gene and the type O 3D gene, and includes degenerate bases to improve the detection coverage of variant strains. The fluorescent probe sequences are labeled with FAM and HEX reporter groups, respectively. Recombinant cold shock protein and recombinant human serum albumin are added to the reaction solution to optimize reaction performance. The kit also includes an internal standard system to monitor for false negatives. This kit solves the problems of insufficient broad-spectrum detection, multiple detection interference, and lack of quality control in existing technologies, and has the advantages of high specificity, high sensitivity, high reliability, and high throughput, making it suitable for rapid typing and monitoring of FMD virus.

The application belongs to the technical field of animal vaccine preparation, and discloses an African swine fever virus (ASFV) multi-epitope fusion protein, a ferritin nanoparticle vaccine of the ASFV multi-epitope fusion protein and application. The application obtains 16 dominant B cell epitopes by using an ASFV phage display library in combination with reverse screening of clinical positive serum, and constructs a nanoparticle vaccine by linking the 16 epitopes with ferritin self-assembly. The vaccine has excellent biosafety, can induce high-level and sustained specific antibodies and significant IFN-gamma cellular immune response in pigs, can effectively delay the clinical onset and death process of pigs in ASFV virulent challenge experiments, and can significantly reduce the virus load in whole-body organ tissues, thereby providing 25% survival protection rate. The application provides an effective new strategy for the development of a subunit vaccine for responding to various ASFV mutant strains.

The invention discloses a method for realizing wheat haploid induction through function knockout of a wheat phospholipase gene TaPLD3. The nucleotide sequences of three subgenomes A, B and D of the TaPLD3 gene are respectively SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and the coded amino acid sequences are respectively SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6. The TaPLD3 gene has the advantages that the nucleotide sequences of the three subgenomes A, B and D of the TaPLD3 gene are shown in the description; according to the invention, a homozygous three-protrusion variant strain TaPLD3-KO of the TaPLD3 gene is created, a mutant plant with the TaPLD3 gene knocked out is used as a male parent to be hybridized with Xu wheat 19129, and a haplobiont is screened out from later generations. Therefore, the haploid induction capability of the wheat is endowed with the function knockout TaPLD3. The TaPLD3-KO has potential value in the aspects of improving wheat haploid induction efficiency and improving a wheat double haploid breeding method, and has important significance in accelerating wheat germplasm innovation.

The invention discloses a primer and a probe for real-time RPA (recombinase polymerase amplification) detection of goose parvovirus and a detection method. The primer comprises an upstream primer G-F1 and a downstream primer G-R1, the sequences of the upstream primer G-F1 and the downstream primer G-R1 are as shown in SEQ ID No.1-2, the probe is an Exo probe, and the sequence of the Exo probe is as shown in SEQ ID No.3. The detection limit of the detection method established by using the primer and the probe is as low as 3.0 * 10 < 1 > copy number / mu L, cross reaction with other waterfowl viruses is avoided, the clinical coincidence rate reaches 98.1%, detection is completed within 30 min in the whole process, a thermal cycler is not needed, and the method is suitable for field application. The matched kit comprises a primer pair, a probe and an RPA basic reagent, is simple and convenient to operate and controllable in cost, can be used for rapid diagnosis and epidemiological monitoring of GPV classical strains and variants (MDGPV and SBDSV), and has important application value.

Techniques are provided for determining pan-HLA binding of viral proteins. A trained classifier model is operable to determine, independently per HLA, at least one of (a) an average binding prediction of overlapping peptides at each position of a viral protein, (b) a maximum value of a binding prediction of overlapping peptides at each position of the viral protein, (c) standard deviation of a binding prediction of overlapping peptides at each position of the viral protein, and (d) a combination of one or more of (a)-(c). A classification engine uses the classifier model to determine average binding predictions of overlapping peptides at each position of the viral protein independently for test HLA-I and HLA-II functional groupings, where a peptide is classified as a binder when an average binding prediction corresponding to the peptide satisfies a binding value threshold.