80 results about "Grass carp" patented technology

The invention discloses a grass carp marker release effect evaluation method, which specifically comprises the following steps: dividing released grass carps into large grass carps and small grass carps, implanting microsatellite markers into abdominal cavities of the large grass carps, and fixing external markers on dorsal fins of the small grass carps; the released grass carp is subjected to fin ray cutting sampling, and the age, the weight and the shape of the grass carp are recorded; constructing a sample genetic archive; recapturing the released groups; and identifying the recaptured individuals, and counting released individuals in the recaptured grass carp. The larger the recapture rate is, the better the enhancement and release effect is, so that the contribution of the enhancement and release of the grass carps to the ecological quantity of all the grass carps in the river is estimated, and the enhancement and release effect of the grass carps is determined. The method is beneficial to recovery of the number of the grass carps in the river, the releasing effect of the grass carps can be known, the releasing method is improved in time, and the method has great popularization value.

The application belongs to the technical field of immunology and in vitro diagnosis, and particularly relates to a rabbit-derived recombinant monoclonal antibody specifically recognizing type II grass carp reovirus VP4 protein, a eukaryotic expression method and application. The S6 gene in GCRV-II encodes VP4 protein, the application transfects the target gene S6 into HEK293 cells for expression and purification, cooperates with Freund's adjuvant to immunize New Zealand white rabbits, and uses ELISA, single B cell screening and eukaryotic expression technology to obtain a rabbit-derived recombinant monoclonal antibody specifically recognizing GCRV-II VP4 protein. The antibody has strong specificity, provides support for further establishment of specific type II grass carp reovirus diagnosis technology, and has great application value for development of GCRV-II related scientific research.

The invention belongs to the technical field of aquatic genetic breeding, and particularly relates to a grass carp disease-resistant character genome breeding method and related application thereof. According to the method, filial generation juvenile fish families produced by non-family grass carp parents from different geographical sources are used for constructing an anti-hemorrhagic disease reference group, the disease-resistant SNP site provided by the invention is used for calculating a genome estimation breeding value of a candidate group, and individuals with high breeding value are relatively high in disease resistance and can be used for breeding disease-resistant improved varieties of grass carp.

The application provides a body shape trait evaluation method and system of Procypridium, and relates to the technical field of body shape evaluation; the method comprises the following steps: selecting a plurality of Procypridium that reach a preset weight, implanting PIT chips of different numbers into the bodies of the plurality of Procypridium for individual marking, and continuing to breed the Procypridium according to preset breeding conditions for a set number of days; photographing the plurality of Procypridium that reach the number of breeding days to obtain a plurality of Procypridium images; performing contour processing on the plurality of Procypridium images to obtain a plurality of body shape trait outer contours; performing difference calculation on the plurality of body shape trait outer contours through a Procrustes analysis algorithm to obtain a plurality of Procrustes distances, and converting the plurality of Procrustes distances into indexes for evaluating the body shape of the Procypridium. The body shape trait evaluation of the Procypridium is freed from subjective judgment based on naked eye observation, and scientific evaluation and accurate screening based on quantitative genetics are realized in the breeding process.

The invention provides a novel ecological feed capable of preventing multiple grass-bream diseases, the novel ecological feed comprises a feed matrix and an ecological feed leavening agent, and the ecological feed leavening agent comprises probiotics with surface expression antigens, the antigen is any one or more of a grass carp reovirus antigen, a flavobacterium johnsonii antigen, an aeromonas veronii antigen and a clonorchis sinensis antigen. The novel ecological feed with a disease-resistant function in a parabramis pekinensis breeding mode is prepared for the first time, the resistance of the parabramis pekinensis to various pathogens can be enhanced, and the survival rate of the parabramis pekinensis in the disease attack peak period can be increased by 50% or above after immunization. An oral immunization mode is adopted and can be completed in the feeding process, and the immunization and breeding cost is greatly saved.

The invention discloses a grass carp muscle nutritional ingredient prediction model based on small sample data enhancement, and the method comprises the steps: S1, collecting original sample data containing environmental factors and grass carp muscle nutritional ingredients, and generating an original data set; s2, performing data standardization preprocessing on the original data set, and injecting Gaussian noise into the preprocessed data to generate an enhanced data set; s3, training a conditional generative adversarial network CTGAN model by using an enhanced data set to generate synthetic data, and performing quality evaluation on the synthetic data based on a preset quality evaluation index and an early stop mechanism; s4, merging the synthetic data meeting the preset quality standard and the original data set, and dividing according to a preset proportion to obtain a training set and a prediction set; s5, training a random forest regression model by using the training set and through hyper-parameter optimization, and generating a nutrition prediction model; and S6, receiving environmental factor data input by the user, and outputting a prediction result of the grass carp muscle nutritional ingredients based on the nutrition prediction model.

The invention relates to the field of aquatic food traceability, in particular to a system for identifying wild and culture sources of grass carps and application of the system. The system comprises: a sample processing module, wherein the sample processing module is at least used for processing a grass carp sample to obtain original data of a polypeptide as shown in any one of SEQ ID NO.1-114, and obtaining proteome component response of a to-be-detected sample; the data processing module is at least used for importing the proteome component response of the sample to be detected into an OPLS-DA classification discriminant analysis model to obtain a score plot for discriminant analysis of subsequent sample data; and the result output module is at least used for outputting a result. The system can be effectively used for identifying wild and culture sources of grass carps, is high in stability and specificity, does not need to use a large instrument, is low in detection cost, and has a wide application prospect in the aspect of aquatic product traceability.

This invention discloses a method for co-culturing giant freshwater prawns (Macrobrachium rosenbergii) with shrimp, grass, and fish based on probiotic regulation, and its application. This invention constructs a three-dimensional ecological system with shrimp as the main body, grass as the protector, and fish as a supplement. Elodea and water spinach purify the water, silver carp and crucian carp decompose uneaten feed and feces, and a compound microbial preparation of Lactococcus gasseri C6a2 regulates water quality, while a biological bottom conditioner improves the bottom sediment, achieving precise ecological regulation of the aquaculture environment. This invention does not rely on chemical agents, effectively inhibits ammonia nitrogen accumulation, reduces disease incidence, and significantly improves the survival rate and size of giant freshwater prawns, achieving a win-win situation for both ecological and economic benefits.

YThe invention discloses a gene II type grass carp reovirus detection primer, a probe and a detection method. The microdroplet type digital PCR detection primer and the probe for the gene II type grass carp reovirus comprise GCRV-S6-F3: 5 '-GGCTAAGGTTACTCTGCATTGC-3', GCRV-S6-F3: 5 '- GCRV-S6-R3 is 5 '-CAGTGGTGACCAAAGTG TTGAGYT-3', and GCRV-S6-R3 is 5 '- And GCRV-S6-P3: 5 '-fluorophore, namely GGTAAACCACTTAGTGCGGAGA, namely a quenching group, namely, GCRV-S6-P3: 5'-fluorophore. According to the invention, the second base at the 3'end of GCRV-S6-R3 is designed as a degenerate base 'Y', and 'C' at the 5 'end of a probe is modified as' G '. The modified primer and probe do not influence the ddPCR amplification efficiency and specificity, and the primer has higher applicability when being used for detecting variant strains.

The application belongs to the technical field of aquatic animal molecular marker and aquatic genetic breeding, and particularly relates to a SNP molecular marker significantly related to growth traits of grass carp and application thereof. The SNP molecular marker is located at 23608308 bp of the 11th chromosome of the grass carp (SLG11_23608308), and is a T>A base mutation. Experiments show that the SNP molecular marker developed in the application has a significant influence on four growth traits of the grass carp, including body length, body height, body width and body weight (P<0.05), and the allele A has more excellent growth traits. The application discloses application of the SNP molecular marker, amplification primers or kits in breeding of the grass carp with excellent growth traits. The SNP molecular marker provided in the application is not limited by the age and gender of the grass carp, and can be used for breeding of the grass carp with excellent growth traits, and even accurate screening can be performed just after hatching, so that the breeding process of the grass carp with excellent growth traits is greatly accelerated.

The application discloses application of sodium butyrate in preparation of a medicine for preventing and treating grass carp hemorrhagic disease, wherein a structural formula of the sodium butyate is molecular formula C4H7NaO2, and a CAS number is 156-54-7; and the application further provides a medicine composition which comprises an effective dose of the sodium butyrate as an active ingredient, and further comprises a pharmaceutically acceptable carrier or excipient, and the dosage form comprises tablets, granules, powders, powders, suspensions, oral liquids, and the concentration of the sodium butyrate is 0.1-20 mM. Through a cell experiment, it is found that the sodium butyrate can significantly inhibit replication of grass carp reovirus in grass carp kidney cells, and improve expression of immune genes of the grass carp kidney cells, and it is proved that the sodium butyrate has a high efficient inhibiting effect on infection of the grass carp reovirus, and has the advantages of high safety and wide application prospect for preparing the medicine for preventing and treating the grass carp hemorrhagic disease caused by the grass carp reovirus.

The invention discloses application of RMTE in preparation of a medicine for preventing and controlling grass carp reovirus. The hemorrhagic disease caused by the grass carp reovirus (GCRV) is a key bottleneck restricting healthy development of the grass carp breeding industry, and the current vaccine for treating the grass carp reovirus (GCRV) has the problems of unstable immune protection effect, low protection rate for crossing of strains of different genotypes and the like, so that the research and development process of antiviral drugs is slow. The invention discloses an influence and a potential mechanism of a rhodamine B-ethyl sulfide condensation compound (RMTE) on GCRV (Growth Factor Receptor Virus) infection. Results show that the RMTE can significantly inhibit expression of VP6 and VP7 genes in GCRV infected cells, can effectively relieve expression inhibition of GCRV on GPX4, Caspase and p53 genes and promote expression of the three genes, and prove that the RMTE has a significant inhibition effect on GCRV infection and plays an antiviral effect through multiple ways. Research results provide new potential drugs and theoretical basis for prevention and control of GCRV.

The invention discloses a method for identifying germ cells of grass carps and carps by using dazl genes. The method comprises the following steps: cloning dazl cDNA sequences of the grass carps and the carps, and performing comparative analysis by using DNAMAN software; designing a universal non-specific primer, a grass carp specific primer and a carp specific primer according to sequence differences; extracting total RNA (Ribonucleic Acid) of testis of 12-month-old grass carp and carp, and reversely transcribing into cDNA Respectively carrying out PCR (Polymerase Chain Reaction) amplification by using three pairs of primers by taking the cDNA as a template; carrying out 1% agarose gel electrophoresis and imaging on the PCR product, and identifying and distinguishing germ cells according to the size of a strip; the method is simple in structure and reasonable in design, high-specificity primers are designed based on small difference of dazl gene sequences for the first time, precise amplification is achieved by combining with optimized annealing temperature (60 DEG C / 65 DEG C), special instruments are not needed, operation is easy and convenient, sensitivity is high, grass carp germ cells in carp gonads after transplantation can be rapidly identified, development of the'belly borrowing reproduction 'technology is supported, and the method is suitable for large-scale popularization and application. The grass carp breeding period is remarkably shortened, and the important industrialization prospect is achieved.

The invention discloses a sargassum powder-containing compound feed for improving intestinal health of grass carps and a preparation method of the sargassum powder-containing compound feed, and relates to the technical field of aquaculture. The feed comprises the following components in percentage by weight: 15-30% of soybean meal, 18% of rapeseed meal, 7% of cottonseed protein concentrate, 0-17% of sunflower seed meal, 4% of rice bran, 23% of flour, 4% of corn dry vinasse, 0.15-7.32% of microcrystalline cellulose, 0.2% of choline chloride, 3.8% of soybean oil, 1.5% of monocalcium phosphate, 1% of premix, 0-0.21% of lysine hydrochloride, 0-0.04% of methionine, 0.03% of a mildew preventive, 0.01% of an antioxidant and 2-5% of sargassum powder. The feed can promote ingestion of the grass carps under the condition of low soybean meal, improves the average weight, the weight gain rate and the specific growth rate of the grass carps, and improves intestinal health of the grass carps at the same time.

The invention discloses shewanella putrefaciens bacteriophage SpuP2 and application thereof. The preservation number of the shewanella putrefaciens bacteriophage SpuP2 is CCTCC (China Center For Type Culture Collection) NO: M 20251492. The method belongs to the brachycauda family. The titer of a lysate prepared based on the bacteriophage is 108-9PFU / mL, and the lysate can be stably applied under the conditions that the temperature is less than or equal to 50 DEG C and the pH is 5-10. The bacteriophage and the preparation thereof can efficiently inhibit the growth of shewanella putrefaciens, significantly inhibit the formation of a biofilm, remove a mature biofilm, and achieve a sterilization rate of 99-99.99% in aquatic products such as grass carp fillets and the like. The preparation is safe and residue-free, can replace a chemical antibacterial agent to be used for rot prevention and control in the food storage, transportation and processing processes, and has good safety and application prospects.

The invention relates to the technical field of water environment treatment and ecological restoration, in particular to a shellfish and grass carp bacteria-algae symbiotic synergistic water ecological restoration method which comprises the following steps: firstly, constructing a three-dimensional multi-element symbiotic system containing composite flora, functional algae and the like, then putting bacteria and algae to form a purification subsystem, and introducing fish and shellfish to regulate biomass and convert pollutants, so as to achieve the purpose of ecological restoration of the shellfish and grass carp bacteria-algae symbiotic synergistic water ecological restoration. Aquatic plants are configured, seasonal regulation and control are implemented, the biological proportion is regulated according to water body characteristics, and the method is suitable for ecological restoration of black and odorous water bodies, eutrophicated lakes and the like. A three-dimensional multi-element symbiotic system is constructed, multi-biological components such as composite flora and functional algae are fused to form a cascade purification chain, pollutants are efficiently removed, the transparency of the repaired water body is larger than or equal to 0.8 m, the total nitrogen is smaller than or equal to 1.0 mg / L, the total phosphorus is smaller than or equal to 0.05 mg / L, the water body is adaptive to different water bodies through multi-dimensional dynamic regulation and control, the stability is improved, the integrity index of aquatic organisms is increased by 30% or above, and the water quality is improved. The remediation effect and sustainability are both considered, and the method is suitable for various polluted water bodies.

The application belongs to the technical field of breeding feed, and specifically provides a low-feed-coefficient biological feed for grass carp, which comprises, in terms of weight fraction, 100-200 parts of pork peptides, 510-1750 parts of plant raw materials, 10-30 parts of aquatic premix, 10-30 parts of calcium dihydrogen phosphate and 1-3 parts of choline chloride. The biological feed with low feed coefficient provided by the application uses pork peptides as animal protein raw materials, which are used in combination with plant raw materials, so as to not only ensure reasonable collocation of animal and plant protein sources to balance various amino acids in the feed, but also effectively improve the digestibility of protein, thereby ensuring that the protein digestion and absorption rate is greatly improved on the premise that the formula cost does not increase greatly. The biological feed can also promote the proliferation of Cetobacterium in the intestinal tract of grass carp, thereby improving the utilization efficiency of the feed.

This invention belongs to the field of aquaculture technology and relates to a novel use of capsaicin, particularly its use in the preparation of drugs and / or feed additives for the prevention and treatment of fish viral infections. The core of this invention lies in the significant protective effect of capsaicin against carp spring viremia virus (SVCV), grass carp reovirus (GCRV), and carp herpesvirus type 2 (CyHV-2) infections, effectively inhibiting the transcription of SVCV, GCRV, and CyHV-2 viral genes and the expression of viral proteins. Feed additives and / or drugs containing capsaicin can be used for the prevention and treatment of fish viral diseases, offering advantages such as high protective efficiency and environmental friendliness.

The application belongs to the technical field of aquatic animal molecular markers, and specifically discloses a grass carp general parent-offspring identification SNP marker combination, which contains 34 SNP sites. The cumulative probability of exclusion (CPE) of the marker combination is 0.999986706, which is greater than 0.9999, meets the parent-offspring identification industry standard, and has high universality and accuracy. The marker combination can play a good auxiliary role in grass carp breeding work, obtain more accurate pedigree information, and improve the breeding efficiency. Meanwhile, when the SNP marker combination is used, the combination of multiplex PCR and the third-generation Nanopore sequencing technology can further reduce the use cost.

The invention belongs to the field of aquatic organism breeding, and particularly relates to SNP loci related to grass carp TLR1 genes and aquatic pathogenic bacterium resistance, a locus combination and application of the SNP loci. According to the invention, PCR (Polymerase Chain Reaction) amplification sequencing and PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) technology correlation analysis are carried out to successfully screen out SNP (Single Nucleotide Polymorphism) loci, related to aeromonas hydrophila resistance, of the grass carp TLR1 gene, and the SNP loci are respectively positioned at the 21444058 and the 21444916 basic groups of the 14 # chromosome. Aiming at the two SNP sites, an SNP site combination related to aeromonas hydrophila resistance is further developed, and aeromonas hydrophila resistant individuals of grass carp can be screened by detecting the SNP site combination of the grass carp TLR1 gene. Therefore, the SNP molecular marker provided by the invention can be used for molecular marker-assisted breeding of grass carp, accelerates breeding of disease-resistant grass carp varieties, and provides a reference basis for disease-resistant breeding of grass carp.

The invention relates to the technical field of cytology, in particular to a grass carp cerebrovascular smooth muscle cell line and application, and the preservation number of the cell line is CCTCC NO: C202607. The cerebral vascular smooth muscle cell line of grass carp provided by the invention has the capability of efficiently proliferating GCRV-II. The highest titer of the GCRV-II copied in the cell line can reach 6.32 * 10 < 9 > TCID50 / mL; the GCRV-II cytotoxicity enriched by the cell line can cause typical bleeding symptoms and death of the grass carp. When the cell is used for enriching cytotoxicity and used for inactivated vaccine trial-production experiments, multiple experiments prove that the relative protection rate of the inactivated vaccine is stably higher than 80%. A freezing electron microscope can observe that a large number of complete virus particles exist in the concentrated cytotoxic sample. Therefore, the invention lays an important foundation for deep research of GCRV-II pathogenic mechanism, vaccine preparation, virus structure analysis, antiviral drug screening and prevention and control of grass carp viral hemorrhagic disease.

The application belongs to the technical field of aquatic organism breeding, and discloses a method for creating grass carp resistant to hemorrhagic disease by knocking out dhcr7 a gene and application thereof. dhcr7 The method utilizes CRISPR-Cas9 technology to generate an insertion / deletion mutation in a grass carp dhcr7 gene, so that the gene cannot encode a protein or the encoded protein does not have a function. dhcr7 The application first knocks out the innate immune negative regulation gene dhcr7 in grass carp, obtains a F0 generation population with a high mutation rate, and finds that knocking out significantly improves the resistance of grass carp to GCRV-II virus, thereby providing a method and breeding material for breeding grass carp resistant to hemorrhagic disease and having important industrial application value.

The application relates to the technical field of aquaculture, in particular to a composition, a feed additive, a feeding method and application. Embodiments disclose a composition composed of cinnamyl aldehyde, thymol, carvacrol and lauric acid monoglyceride, which is used for feeding Chinese soft-shelled turtles and grass carp, can effectively promote the growth of the Chinese soft-shelled turtles and the grass carp, improve the daily weight gain of livestock and poultry, improve the feed conversion rate, improve the meat quality and the protein content, improve the immune capacity of the aquaculture animals, and has the characteristics of easy availability of raw materials and low cost.

The invention belongs to the technical field of aquatic immunity and biological preparations, and discloses a mutant IL-7 protein and application of the mutant IL-7 protein as a grass carp reovirus inactivated vaccine adjuvant. The applicant obtains the IL-7 mutant mIL-7 with higher receptor binding capacity on the basis of grass carp IL-7. After the mIL-7 and the GCRV-II type inactivated vaccine are combined to immunize the grass carp, the expression of immune related genes is obviously up-regulated, the IL-10 is obviously reduced, the enzyme activities of CAT, ACP and Gpx in serum are also obviously improved, and the AST is obviously reduced. A challenge experiment result shows that the survival rate of the grass carp combined with the mIL-7 and the inactivated vaccine is increased by about 10%, and the VP56 virus load in the body is reduced. As an immunologic adjuvant, the mutant IL-7 can effectively enhance the specific immune response and disease resistance of the grass carp, can be used as an efficient and safe adjuvant of a grass carp inactivated vaccine, and has good safety and application prospects.

The invention discloses an SNP molecular marker related to grass carp feed utilization rate and application thereof, and belongs to the technical field of aquatic animal molecular markers and aquatic genetic breeding. According to the invention, an SNP (Single Nucleotide Polymorphism) site obviously related to the feed utilization rate of the grass carp is screened out, the SNP molecular marker is positioned at the 51653399 site on the chromosome 2 of the grass carp, the polymorphic site of the SNP molecular marker is G / T, and when the genotype of the site is GG, the feed utilization rate of the grass carp is relatively high. The invention also discloses application of the SNP molecular marker, the amplification primer or the kit in breeding of grass carp with high feed utilization rate. The SNP molecular marker provided by the invention can be used for early breeding of grass carp with high feed utilization rate, greatly reduces the breeding workload, can significantly shorten the breeding time, accelerates the breeding process, improves the breeding efficiency, and reduces the breeding cost.

The present application relates to a kind of grass carp circulating water aquaculture tail water comprehensive treatment system based on MABR and its use method, it relates to aquaculture water treatment technical field.Processing system is sequentially connected physical filtration unit, biological filtration unit, MABR processing unit, disinfection unit and reuse unit, air supply unit is separately arranged;Use method is to apply MABR technology to biological filtration unit after, before disinfection unit, utilize physical filtration unit to remove large particle impurities and part of suspended solids in water body, the microorganism attached to biological filter material in biological filter carries out biological degradation to organic matter, ammonia nitrogen and other pollutants in water body, the microorganism attached to MABR membrane in MABR processing unit carries out depth degradation to the pollutants in water body, again, to the water body after treatment ultraviolet disinfection is killed pathogenic microorganism, subsequent water body oxygenation recycling or discharge is discharged.The present application has integrated technology removal effect, good stability, save external carbon source and other advantages.

The invention belongs to the technical field of culture, and discloses a grass carp culture method capable of shortening sexual maturity time, which comprises the following steps: 1, parent screening; feeding with feed; managing water temperature. By systematically analyzing the synergistic effect of antioxidant regulation of tocopherol (vitamin E), feed nutrition optimization and water temperature accurate management, the sexual maturity period of large-scale cultured grass carp is successfully and stably controlled within 3 years. The breakthrough has important practical significance on reduction of breeding cost and guarantee of offspring seed supply.

The invention discloses a grass carp high-density whole genome 50K SNP (Single Nucleotide Polymorphism) chip and application thereof. Genetic typing objects of the chip comprise 49 and 635 SNP sites on the whole genome of the grass carp, the SNP sites cover 23835 genes of the grass carp, and the positions and genotypes of the SNP sites on the genome (PRJNA1368393) of the grass carp are shown in the specification table 1. The SNP is derived from re-sequencing results of 351 samples, is rich in gene region sites, high in typing accuracy and high in repeatability, is an accurate and efficient molecular breeding chip, can be widely applied to application scenes of grass carp germplasm resource identification, genetic diversity evaluation, target character gene mining and whole genome selective breeding, and has a wide application prospect. The method has the advantage of low detection cost and is beneficial to further improving the grass carp breeding efficiency.

The invention belongs to the technical field of aquatic immunity and biological preparations, and discloses a CXCL20a protein mutant and application of the CXCL20a protein mutant as a grass carp reovirus inactivated vaccine adjuvant. In order to improve the immunomodulatory activity of CXCL20a, the applicant constructs and obtains a CXCL20a mutant protein. After the mutant and a GCRV-II type inactivated vaccine are combined to immunize grass carp, the expression of immune related genes can be remarkably promoted, the activity of serum acid phosphatase and superoxide dismutase is enhanced, and meanwhile, the level of lactic dehydrogenase is reduced. A challenge experiment proves that the survival rate of the grass carp combined with the inactivated vaccine for immunization is increased by about 8% compared with that of a non-mutant combined group, and the in-vivo virus load is reduced. As an immunologic adjuvant, the CXCL20a mutant M-C20 provided by the invention can effectively enhance early immune response and overall protection effect in vaccine immunity, and has good safety, stability and application prospect.

The application belongs to the technical field of biology, and particularly relates to a grass carp reovirus (GCRV-Ⅱ type) subunit recombinant vaccine, a preparation method and application. 274‑367 , VP5 105‑336 , NS38 143‑338 sequence fragments, and the three sequence fragments are recombined and expressed in a prokaryotic expression vector to prepare the subunit recombinant vaccine. The recombinant vaccine has high safety, strong activity and broad spectrum, and has good application potential.