124 results about "Grass carp" patented technology

The invention relates to the technical field of cytology, in particular to a grass carp brain astrocyte line and application thereof, the grass carp brain astrocyte line is preserved in China Center for Type Culture Collection on May 7, 2025, and the preservation number of the grass carp brain astrocyte line is CCTCC NO: C2025149. The grass carp brain astroglia cell line provided by the invention has the capability of efficiently proliferating GCRV-II, and the virus titer of the GCRV-II replicated in the cell line at least can reach 1.38 * 10 < 8 > pfu / mL or above; after the GCRV-II is blindly passed for 5 generations in a grass carp astroglia cell line, the grass carp can still have typical bleeding symptoms and death due to the virus. And the exogenous plasmid transfected grass carp brain astroglia cell line has similar transfection efficiency to commercial grass carp kidney cells. Therefore, the invention lays an important foundation for deep research of pathogenic mechanism of GCRV-II, vaccine preparation, antiviral drug screening and prevention and control of grass carp viral hemorrhagic disease.

The invention belongs to the technical field of immunology and in vitro diagnosis, and particularly relates to a rabbit-derived recombinant monoclonal antibody for specific recognition of type II grass carp reovirus VP4 protein, an eukaryotic expression method and application. According to the invention, a target gene S6 is transfected to an HEK293 cell for expression and purification, a New Zealand white rabbit is immunized in cooperation with a Freund's adjuvant, and the rabbit-derived recombinant monoclonal antibody capable of specifically recognizing the GCRV-II VP4 protein is obtained by using ELISA, single B cell screening and eukaryotic expression technologies. The antibody has strong specificity, provides support for further establishment of a specific II-type grass carp reovirus diagnosis technology, and has great application value in development of GCRV-II related scientific research.

The invention belongs to the technical field of aquatic animal molecular markers and aquatic genetic breeding, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker remarkably related to grass carp body weight traits and application thereof. The SNP molecular marker is shown as follows: (1) SLG1123629389 with the polymorphic base being T / C, (2) SLG1127776299 with the polymorphic base being A / G, (3) SLG1127776356 with the polymorphic base being G / A, and (4) SLG1235362696 with the polymorphic base being T / C. The invention also discloses application of the SNP molecular marker, the amplification primer or the kit in breeding grass carp with excellent growth traits. The SNP molecular marker disclosed by the invention can be used for early breeding of grass carp with excellent growth traits, so that the breeding workload is greatly reduced, the breeding time can be remarkably shortened, the breeding process is accelerated, the breeding efficiency is improved, and the breeding cost is reduced; the method has important guiding significance for improving the production performance of the grass carp, reducing the culture cost of the grass carp and increasing the culture income, and is suitable for popularization and application.

The invention belongs to the technical field of aquatic animal molecular markers and aquatic genetic breeding, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker remarkably related to growth traits of grass carp and application of the SNP molecular marker. The SNP molecular marker is located at the position of 23608308bp of the eleventh chromosome (SLG1123608308) of the grass carp, and is Tgt; and A basic group mutation. Experiments show that the SNP molecular marker developed by the invention has significant influence on four growth traits (Plt; 0.05), and the allele A has more excellent growth traits. The invention discloses application of an SNP (Single Nucleotide Polymorphism) molecular marker, an amplification primer or a kit in breeding grass carp with excellent growth traits. The SNP molecular marker provided by the invention is not limited by the age, sex and the like of the grass carp, can be used for breeding grass carp varieties with excellent growth traits, and even can be accurately screened after being hatched, so that the breeding process of the grass carp varieties with excellent growth traits is greatly accelerated.

The invention discloses a grass carp gamma interferon fusion protein as well as a mutant, a coding gene and application thereof. In order to improve the expression quantity or expression efficiency of the grass carp gamma interferon, codon optimization and mutation are carried out on the coding gene of the grass carp gamma interferon to obtain the grass carp gamma interferon mutant. The fusion protein is further obtained by connecting the grass carp gamma interferon mutant with the C end of the grass carp ferritin heavy chain subunit of which the last 17 amino acids are removed through a connecting peptide. In order to further improve the antiviral activity of the fusion protein, the obtained fusion protein is subjected to single-point mutation, and the titer of the fusion protein is remarkably improved. The fusion protein is expressed by a silkworm cell eukaryotic expression system, and the fusion protein shows a conformation suitable for the interferon to play functions based on the ferritin self-assembly characteristic, so that the titer of the interferon in a host is effectively improved, and the in-vivo and in-vitro half-life period of the interferon is prolonged. The invention has application prospects in preparation of drugs or reagents for preventing or treating viral diseases of grass carp and the like.

The invention discloses an application of lactic acid (Lactate) in prevention and treatment of infection of CyHV-2 (Cyprinid Herpesvirus, CyHV-2), SVCV (Spring Viraemia of Carp Virus) and GCRV (Grass Carp Reovirus), a result of a cell line infection model shows that the lactic acid has a significant protection effect on cells infected by CyHV-2, SVCV and GCRV, and the lactic acid has a significant protection effect on cells infected by CyHV-2, SVCV and GCRV. Furthermore, a molecular biology experiment result shows that the transcription level of the virus related genes treated by lactic acid is obviously inhibited. Therefore, the lactic acid can be used as a medicine or an additive for preventing and treating CyHV-2, SVCV and GCRV infection, and has the advantages of low dosage and good protection effect.

The invention discloses a grass carp marker release effect evaluation method, which specifically comprises the following steps: dividing released grass carps into large grass carps and small grass carps, implanting microsatellite markers into abdominal cavities of the large grass carps, and fixing external markers on dorsal fins of the small grass carps; the released grass carp is subjected to fin ray cutting sampling, and the age, the weight and the shape of the grass carp are recorded; constructing a sample genetic archive; recapturing the released groups; and identifying the recaptured individuals, and counting released individuals in the recaptured grass carp. The larger the recapture rate is, the better the enhancement and release effect is, so that the contribution of the enhancement and release of the grass carps to the ecological quantity of all the grass carps in the river is estimated, and the enhancement and release effect of the grass carps is determined. The method is beneficial to recovery of the number of the grass carps in the river, the releasing effect of the grass carps can be known, the releasing method is improved in time, and the method has great popularization value.

The application belongs to the technical field of immunology and in vitro diagnosis, and particularly relates to a rabbit-derived recombinant monoclonal antibody specifically recognizing type II grass carp reovirus VP4 protein, a eukaryotic expression method and application. The S6 gene in GCRV-II encodes VP4 protein, the application transfects the target gene S6 into HEK293 cells for expression and purification, cooperates with Freund's adjuvant to immunize New Zealand white rabbits, and uses ELISA, single B cell screening and eukaryotic expression technology to obtain a rabbit-derived recombinant monoclonal antibody specifically recognizing GCRV-II VP4 protein. The antibody has strong specificity, provides support for further establishment of specific type II grass carp reovirus diagnosis technology, and has great application value for development of GCRV-II related scientific research.

The invention discloses application of capsaicin to resistance of grass carp to hypoxia stress, and belongs to the technical field of agricultural cultivation. Aiming at the problems of red blood cell function damage, liver and gill tissue damage and the like of grass carps under hypoxia stress, a trace amount of capsaicin is added into the grass carp feed, so that the feed formula is optimized, the reduction of red blood cell quantity and brittleness increase of grass carps in the later growth period caused by hypoxia stress are relieved, liver damage is relieved, and the growth period of grass carps is prolonged. The death rate of the grass carp in a low-oxygen environment is reduced, the culture risk is reduced, and the method has the characteristics of being green, safe, low in cost and remarkable in economic benefit and is suitable for large-scale grass carp culture industry.

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker for identifying salt tolerance of grass carp and application of the SNP molecular marker. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, wherein the 503rd base of the sequence is T or C. The SNP molecular marker provided by the invention can be applied to rapid identification of the salt tolerance of grass carp and auxiliary breeding of salt-tolerant grass carp, grass carp parents with excellent salt tolerance can be effectively selected under the same breeding condition by detecting the SNP molecular marker, the SNP molecular marker can be effectively used for molecular marker-assisted breeding of grass carp, and the breeding efficiency is improved. The grass carp parents can be subjected to genotype identification according to actual breeding requirements, the grass carp parents with proper genotypes are selected for breeding, grass carp offspring (fry) with high salt resistance can be obtained, breeding time is saved, cost is low, accuracy is high, the grass carp breeding process is accelerated, and economic benefits of grass carp breeding in the saline-alkaline environment are increased.

The invention belongs to the technical field of aquatic animal breeding, and particularly relates to a grass carp parent salinity tolerance related molecular marker suitable for fry salinity domestication and application of the grass carp parent salinity tolerance related molecular marker in grass carp salt tolerance breeding. The nucleotide sequence of the SNP molecular marker related to the salinity tolerance character of the grass carp is as shown in SEQ ID NO: 1; a / C polymorphism exists at the 111st site in the DNA fragment shown in the nucleotide sequence, and when the genotype of the SNP molecular marker is CC or AC, the to-be-detected sample is the salinity-tolerant grass carp; when the genotype of the SNP molecular marker is AA, the to-be-detected sample is the salinity-sensitive grass carp. The SNP molecular marker closely related to the salt tolerance character is screened through a salinity tolerance test. Therefore, the molecular marker provided by the invention can be used for carrying out breeding work and detection work of the salt-tolerant grass carp.

The invention belongs to the technical field of aquatic genetic breeding, and particularly relates to a grass carp disease-resistant character genome breeding method and related application thereof. According to the method, filial generation juvenile fish families produced by non-family grass carp parents from different geographical sources are used for constructing an anti-hemorrhagic disease reference group, the disease-resistant SNP site provided by the invention is used for calculating a genome estimation breeding value of a candidate group, and individuals with high breeding value are relatively high in disease resistance and can be used for breeding disease-resistant improved varieties of grass carp.

The invention belongs to the technical field of antibody preparation, and particularly relates to a recombinant rabbit monoclonal antibody for specifically recognizing type II grass carp reovirus VP56 protein and application of the recombinant rabbit monoclonal antibody. The amino acid sequence of a light chain variable region of the monoclonal antibody is as shown in SEQ ID NO.3, and the amino acid sequence of a heavy chain variable region of the monoclonal antibody is as shown in SEQ ID NO.1. The recombinant rabbit monoclonal antibody for resisting the II type grass carp reovirus VP56 protein prepared by the invention has relatively strong specificity and titer, can specifically recognize the virus VP56 protein in tissues and cells in a natural state, has high affinity for recognizing and combining the virus VP56 protein, has strong anti-interference capability, and can be used for preparing the recombinant rabbit monoclonal antibody for resisting the II type grass carp reovirus VP56 protein. The method is suitable for establishing a high-specificity, high-sensitivity and high-accuracy type II grass carp reovirus diagnosis technology.

The application provides a body shape trait evaluation method and system of Procypridium, and relates to the technical field of body shape evaluation; the method comprises the following steps: selecting a plurality of Procypridium that reach a preset weight, implanting PIT chips of different numbers into the bodies of the plurality of Procypridium for individual marking, and continuing to breed the Procypridium according to preset breeding conditions for a set number of days; photographing the plurality of Procypridium that reach the number of breeding days to obtain a plurality of Procypridium images; performing contour processing on the plurality of Procypridium images to obtain a plurality of body shape trait outer contours; performing difference calculation on the plurality of body shape trait outer contours through a Procrustes analysis algorithm to obtain a plurality of Procrustes distances, and converting the plurality of Procrustes distances into indexes for evaluating the body shape of the Procypridium. The body shape trait evaluation of the Procypridium is freed from subjective judgment based on naked eye observation, and scientific evaluation and accurate screening based on quantitative genetics are realized in the breeding process.

The invention provides a novel ecological feed capable of preventing multiple grass-bream diseases, the novel ecological feed comprises a feed matrix and an ecological feed leavening agent, and the ecological feed leavening agent comprises probiotics with surface expression antigens, the antigen is any one or more of a grass carp reovirus antigen, a flavobacterium johnsonii antigen, an aeromonas veronii antigen and a clonorchis sinensis antigen. The novel ecological feed with a disease-resistant function in a parabramis pekinensis breeding mode is prepared for the first time, the resistance of the parabramis pekinensis to various pathogens can be enhanced, and the survival rate of the parabramis pekinensis in the disease attack peak period can be increased by 50% or above after immunization. An oral immunization mode is adopted and can be completed in the feeding process, and the immunization and breeding cost is greatly saved.

The invention discloses a material using method suitable for overwintering culture of grass carps in South China. The material using method comprises the following steps: (1) selecting floating puffed compound feed in the early overwintering period and the later overwintering period; the feeding rate is 0.8-1.5%, and the feeding frequency is 2 times per day; (2) in the middle stage of overwintering, sinking puffed compound feed is selected, the feeding rate is controlled to be about 0.5%, and the feeding frequency is one time per day. In the early overwintering period and the later overwintering period, the fishes are active on the surface layer, the floating puffed compound feed is selected, the water temperature is low in the middle overwintering period, the sinking puffed compound feed is selected, the fishes can settle deep in the water body, and ingestion of the fishes is facilitated. In the overwintering culture period of the grass carps, materials are scientifically used as a whole, and the problems that in actual production, feed waste or insufficient feeding is caused, overwintering fish bodies do not lose fat, and fish diseases break out after the beginning of spring, so that culture benefits are affected are avoided.

The invention discloses a grass carp muscle nutritional ingredient prediction model based on small sample data enhancement, and the method comprises the steps: S1, collecting original sample data containing environmental factors and grass carp muscle nutritional ingredients, and generating an original data set; s2, performing data standardization preprocessing on the original data set, and injecting Gaussian noise into the preprocessed data to generate an enhanced data set; s3, training a conditional generative adversarial network CTGAN model by using an enhanced data set to generate synthetic data, and performing quality evaluation on the synthetic data based on a preset quality evaluation index and an early stop mechanism; s4, merging the synthetic data meeting the preset quality standard and the original data set, and dividing according to a preset proportion to obtain a training set and a prediction set; s5, training a random forest regression model by using the training set and through hyper-parameter optimization, and generating a nutrition prediction model; and S6, receiving environmental factor data input by the user, and outputting a prediction result of the grass carp muscle nutritional ingredients based on the nutrition prediction model.

The invention belongs to the technical field of aquaculture, and particularly relates to a fermented feed for improving the growth performance of aquatic animals and a preparation method thereof. The preparation method of the fermented feed for improving the growth performance of the aquatic animals comprises the following steps: (1) preparing maggot powder; (2) weighing soybean meal, orange peel powder, corn starch, maggot powder, paper mulberry bark pulp, sodium selenite and monopotassium phosphate to obtain a fermentation medium; (3) inoculating the schizophyllum commune liquid into the fermentation culture medium in the step (2) to obtain a fermentation mixture; and (4) adding lactobacillus plantarum liquid, sucrose fatty acid ester, phospholipid and sunflower bud extract into the fermented mixture in the step (3), and fermenting for a period of time to obtain the fermented feed. By feeding the grass carps with the prepared fermented feed, the growth and development capability of the grass carps can be promoted, the immunity of the grass carps is improved, and the fermented feed has a wide application prospect.

The invention belongs to the technical field of equipment for feed production, and particularly relates to efficient fermentation equipment for grass carp feed production. The high-efficiency fermentation equipment structurally comprises a tank body and a stirring motor, and further comprises a cover plate unit which is arranged on the tank body and is provided with the stirring motor, a central stirring shaft unit arranged on the stirring motor, and a plurality of side stirring frame body units arranged on the central stirring shaft unit, the electric heating rod is arranged on the cover plate unit and is positioned between the central stirring shaft unit and the side stirring frame body unit. The stirring device has the beneficial effects that the central stirring shaft unit, the electric heating rod and the side stirring frame body unit are sequentially arranged in the radial direction of the tank body from inside to outside, so that the grass carp feed raw materials in the tank body can obtain a relatively sufficient and efficient heating and uniform mixing effect, and the quality of a fermentation process is further improved.

The invention relates to the field of aquatic food traceability, in particular to a system for identifying wild and culture sources of grass carps and application of the system. The system comprises: a sample processing module, wherein the sample processing module is at least used for processing a grass carp sample to obtain original data of a polypeptide as shown in any one of SEQ ID NO.1-114, and obtaining proteome component response of a to-be-detected sample; the data processing module is at least used for importing the proteome component response of the sample to be detected into an OPLS-DA classification discriminant analysis model to obtain a score plot for discriminant analysis of subsequent sample data; and the result output module is at least used for outputting a result. The system can be effectively used for identifying wild and culture sources of grass carps, is high in stability and specificity, does not need to use a large instrument, is low in detection cost, and has a wide application prospect in the aspect of aquatic product traceability.

This invention discloses a method for co-culturing giant freshwater prawns (Macrobrachium rosenbergii) with shrimp, grass, and fish based on probiotic regulation, and its application. This invention constructs a three-dimensional ecological system with shrimp as the main body, grass as the protector, and fish as a supplement. Elodea and water spinach purify the water, silver carp and crucian carp decompose uneaten feed and feces, and a compound microbial preparation of Lactococcus gasseri C6a2 regulates water quality, while a biological bottom conditioner improves the bottom sediment, achieving precise ecological regulation of the aquaculture environment. This invention does not rely on chemical agents, effectively inhibits ammonia nitrogen accumulation, reduces disease incidence, and significantly improves the survival rate and size of giant freshwater prawns, achieving a win-win situation for both ecological and economic benefits.

The present invention relates to the field of biotechnology. The present invention provides a grass carp brain cell line sensitive to grass carp reovirus type II, which was deposited in the China Center for Type Culture Collection on October 19, 2024, with a deposit number of CCTCC NO: C2024101. The grass carp brain cell line constructed by the present invention shows remarkable stability and successfully achieved 60 stable passages. When inoculated with GCRV‑II, an atypical cytopathic effect can be exhibited. In addition, the grass carp brain cell line has the ability to efficiently replicate GCRV‑II, and even after three generations of blind transmission, the generated cytotoxin can still cause grass carp to become ill and die. Therefore, the present invention has laid a solid foundation for in-depth exploration of the pathogenic mechanism of GCRV‑II, vaccine development, and antiviral drug screening, which will help promote further progress in related research and provide a key cell model and research basis for the formulation of grass carp reovirus-related research and prevention and control strategies.

YThe invention discloses a gene II type grass carp reovirus detection primer, a probe and a detection method. The microdroplet type digital PCR detection primer and the probe for the gene II type grass carp reovirus comprise GCRV-S6-F3: 5 '-GGCTAAGGTTACTCTGCATTGC-3', GCRV-S6-F3: 5 '- GCRV-S6-R3 is 5 '-CAGTGGTGACCAAAGTG TTGAGYT-3', and GCRV-S6-R3 is 5 '- And GCRV-S6-P3: 5 '-fluorophore, namely GGTAAACCACTTAGTGCGGAGA, namely a quenching group, namely, GCRV-S6-P3: 5'-fluorophore. According to the invention, the second base at the 3'end of GCRV-S6-R3 is designed as a degenerate base 'Y', and 'C' at the 5 'end of a probe is modified as' G '. The modified primer and probe do not influence the ddPCR amplification efficiency and specificity, and the primer has higher applicability when being used for detecting variant strains.

The application belongs to the technical field of aquatic animal molecular marker and aquatic genetic breeding, and particularly relates to a SNP molecular marker significantly related to growth traits of grass carp and application thereof. The SNP molecular marker is located at 23608308 bp of the 11th chromosome of the grass carp (SLG11_23608308), and is a T>A base mutation. Experiments show that the SNP molecular marker developed in the application has a significant influence on four growth traits of the grass carp, including body length, body height, body width and body weight (P<0.05), and the allele A has more excellent growth traits. The application discloses application of the SNP molecular marker, amplification primers or kits in breeding of the grass carp with excellent growth traits. The SNP molecular marker provided in the application is not limited by the age and gender of the grass carp, and can be used for breeding of the grass carp with excellent growth traits, and even accurate screening can be performed just after hatching, so that the breeding process of the grass carp with excellent growth traits is greatly accelerated.

The application discloses application of sodium butyrate in preparation of a medicine for preventing and treating grass carp hemorrhagic disease, wherein a structural formula of the sodium butyate is molecular formula C4H7NaO2, and a CAS number is 156-54-7; and the application further provides a medicine composition which comprises an effective dose of the sodium butyrate as an active ingredient, and further comprises a pharmaceutically acceptable carrier or excipient, and the dosage form comprises tablets, granules, powders, powders, suspensions, oral liquids, and the concentration of the sodium butyrate is 0.1-20 mM. Through a cell experiment, it is found that the sodium butyrate can significantly inhibit replication of grass carp reovirus in grass carp kidney cells, and improve expression of immune genes of the grass carp kidney cells, and it is proved that the sodium butyrate has a high efficient inhibiting effect on infection of the grass carp reovirus, and has the advantages of high safety and wide application prospect for preparing the medicine for preventing and treating the grass carp hemorrhagic disease caused by the grass carp reovirus.

The invention discloses application of RMTE in preparation of a medicine for preventing and controlling grass carp reovirus. The hemorrhagic disease caused by the grass carp reovirus (GCRV) is a key bottleneck restricting healthy development of the grass carp breeding industry, and the current vaccine for treating the grass carp reovirus (GCRV) has the problems of unstable immune protection effect, low protection rate for crossing of strains of different genotypes and the like, so that the research and development process of antiviral drugs is slow. The invention discloses an influence and a potential mechanism of a rhodamine B-ethyl sulfide condensation compound (RMTE) on GCRV (Growth Factor Receptor Virus) infection. Results show that the RMTE can significantly inhibit expression of VP6 and VP7 genes in GCRV infected cells, can effectively relieve expression inhibition of GCRV on GPX4, Caspase and p53 genes and promote expression of the three genes, and prove that the RMTE has a significant inhibition effect on GCRV infection and plays an antiviral effect through multiple ways. Research results provide new potential drugs and theoretical basis for prevention and control of GCRV.

The invention discloses a bacillus subtilis strain for producing amide compounds and application of the bacillus subtilis strain. The preservation number of the bacillus subtilis DZNBS-11-032 is CGMCC (China General Microbiological Culture Collection Center) NO.29593, and the preservation number of the bacillus subtilis DZNBS-11-032 is CGMCC NO.29593. The invention provides bacillus subtilis DZNBS-11-032 capable of generating amide compounds, and the bacillus subtilis DZNBS-11-032 is added into a feed for culturing crisped grass carps, so that the content of amino acids in muscle fat and the content of highly unsaturated fatty acids can be increased, and the interest of people in the application of the bacillus subtilis in the culture of the crisped grass carps can be stimulated.

The invention discloses application of cortisol in prevention and treatment of infection of cyprinid herpesvirus II (CyHV-2), spring viraemia of carp (SVCV) and grass carp reovirus (GCRV), results of a cell line infection model show that the cortisol can play a significant role in protecting cells infected by the CyHV-2, the SVCV and the GCRV, and the cortisol can play a significant role in preventing and treating the infection of the cyprinid herpesvirus II, the SVCV and the GCRV, so that the cortisol can be used for preventing and treating the infection of the cyprinid herpesvirus II, the SVCV and the GCRV, and the application of the cortisol in the prevention and treatment of the infection of the cyprinid herpesvirus II, the SVCV and the GCRV. Furthermore, a molecular biology experiment result shows that the transcription level of the virus related genes treated by cortisol is obviously inhibited. Therefore, cortisol can be used as a medicine or an additive for preventing and treating CyHV-2, SVCV and GCRV infection, and has the advantages of low dosage and good protection effect.

The invention discloses a method for identifying germ cells of grass carps and carps by using dazl genes. The method comprises the following steps: cloning dazl cDNA sequences of the grass carps and the carps, and performing comparative analysis by using DNAMAN software; designing a universal non-specific primer, a grass carp specific primer and a carp specific primer according to sequence differences; extracting total RNA (Ribonucleic Acid) of testis of 12-month-old grass carp and carp, and reversely transcribing into cDNA Respectively carrying out PCR (Polymerase Chain Reaction) amplification by using three pairs of primers by taking the cDNA as a template; carrying out 1% agarose gel electrophoresis and imaging on the PCR product, and identifying and distinguishing germ cells according to the size of a strip; the method is simple in structure and reasonable in design, high-specificity primers are designed based on small difference of dazl gene sequences for the first time, precise amplification is achieved by combining with optimized annealing temperature (60 DEG C / 65 DEG C), special instruments are not needed, operation is easy and convenient, sensitivity is high, grass carp germ cells in carp gonads after transplantation can be rapidly identified, development of the'belly borrowing reproduction 'technology is supported, and the method is suitable for large-scale popularization and application. The grass carp breeding period is remarkably shortened, and the important industrialization prospect is achieved.

The invention relates to the technical field of grass carp feed, and particularly discloses functional feed based on American cockroach chitin as well as a preparation method and application of the functional feed. The functional feed based on the American cockroach chitin is a grass carp compound feed. Comprising 2.5-20% by weight of American cockroach chitin. The periplaneta americana chitin is added into the grass carp compound feed, so that digestion, absorption and utilization of nutrient substances by juvenile grass carps can be remarkably improved, growth of the juvenile grass carps can be promoted, the disease resistance of the juvenile grass carps can be enhanced, and the conversion rate of the feed can be increased. After a proper amount of the feed is added, the feed does not generate adverse effects on various physiological functions of the grass carp, the formula cost is effectively reduced, and the feed has relatively high cost performance. By using the additive, the culture benefit of the grass carp can be remarkably improved. The problem that in the prior art, no functional feed is prepared from American cockroach chitin as a feed additive is solved.