SNP (Single Nucleotide Polymorphism) molecular marker for identifying salt tolerance of grass carp and application of SNP molecular marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker for identifying salt tolerance of grass carp and application of the SNP molecular marker. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, wherein the 503rd base of the sequence is T or C. The SNP molecular marker provided by the invention can be applied to rapid identification of the salt tolerance of grass carp and auxiliary breeding of salt-tolerant grass carp, grass carp parents with excellent salt tolerance can be effectively selected under the same breeding condition by detecting the SNP molecular marker, the SNP molecular marker can be effectively used for molecular marker-assisted breeding of grass carp, and the breeding efficiency is improved. The grass carp parents can be subjected to genotype identification according to actual breeding requirements, the grass carp parents with proper genotypes are selected for breeding, grass carp offspring (fry) with high salt resistance can be obtained, breeding time is saved, cost is low, accuracy is high, the grass carp breeding process is accelerated, and economic benefits of grass carp breeding in the saline-alkaline environment are increased.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker for identifying the salt tolerance of grass carp and an application thereof. Background Art

[0002] The area of saline-alkali land in China is about 9.93×10 11 m 2 , low-lying saline water is about 4.60×10 11 m 2 , spread across 19 provinces, municipalities, and autonomous regions in my country. Due to the common characteristics of saline-alkali water, such as high salinity, high alkalinity, imbalanced ratios of major ions, and a variety of water quality types, most of it has been idle for a long time. Currently, there are few aquatic species that can be cultured in saline-alkali water. Therefore, using saline-alkali water for fish farming is one of the methods to develop and utilize saline-alkali waters. The key to this method lies in improving the salt tolerance of aquaculture species and cultivating new salt-tolerant fish species.

[0003] Grass carp (Ctenopharyngodon idella) is one of China's four major freshwater aquaculture species and a key commercial freshwater fish. Its aquaculture scale and market demand are expanding annually. According to the 2024 China Fisheries Statistical Yearbook, the annual production of grass carp reached 5.9048 million tons in 2023. Grass carp is farmed in 30 provinces (municipalities, and autonomous regions) in China, excluding Tibet, Hong Kong, Macao, and Taiwan.

[0004] With the shortage of freshwater resources and the increasing demand for the development of saline-alkali waters, improving the salt tolerance of grass carp has become a key research direction for expanding its aquaculture range and improving the economic benefits of saline-alkali waters. Traditional salt-tolerant breeding mainly relies on phenotypic screening, that is, screening salt-tolerant individuals through long-term exposure to high-salt environments. However, this method has significant drawbacks. For example, high-salt stress can easily damage the physiological functions of grass carp and even cause irreversible growth and development disorders, seriously affecting the reproductive performance of the parents. Phenotypic screening is long and costly, and is greatly affected by environmental factors, making it difficult to ensure the accuracy of breeding.

[0005] Genome-wide association studies (GWAS) can identify variants that are significantly associated with specific phenotypes or diseases by examining hundreds or even tens of millions of genetic variants in the genomes of various organisms and analyzing their associations with sample phenotypes. Single nucleotide polymorphisms (SNPs) are widely present in the genomes of plants and animals. They are DNA sequence polymorphisms caused by variations in a single nucleotide, including single-base transitions, transversions, insertions, and deletions. SNP markers have become the preferred tool for analyzing the genetic mechanisms of complex traits due to their high distribution density, high detection throughput, high level of typing automation, and low cost.

[0006] Therefore, whole genome resequencing and GWAS were used to screen SNP sites significantly associated with salt tolerance and locate the dominant salt-tolerant alleles, which is of great significance for the rapid identification of grass carp's salt tolerance and assisting salt-tolerant grass carp breeding. Summary of the Invention

[0007] The present invention provides a SNP molecular marker for identifying the salt tolerance of grass carp and its application. The SNP molecular marker can be used to quickly identify the salt tolerance of grass carp and assist in the breeding of salt-tolerant grass carp. By detecting the SNP molecular marker, grass carp parents with excellent salt tolerance can be effectively selected under the same breeding conditions, and can be effectively used in molecular marker-assisted breeding of grass carp.

[0008] According to a first aspect of the present invention, a SNP molecular marker for identifying the salt tolerance of grass carp is provided. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, wherein the 503rd base of the sequence is T or C.

[0009] After culturing grass carp under certain salinity conditions, the inventors of the present application found that there were significant differences in survival time among individual grass carp. By performing whole-genome sequencing on the tail fin tissues of a salinity-sensitive group of grass carp and a salinity-tolerant group of grass carp, and using genome-wide association analysis (GWAS), they identified candidate SNP molecular markers associated with the salt tolerance of grass carp. This is the SNP molecular marker for identifying the salt tolerance of grass carp provided by the present invention. The SNP molecular marker is located at the 503rd base of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is T / C. The SNP molecular marker provided by the present invention can be used to quickly identify the salt tolerance of grass carp and assist in the breeding of salt-tolerant grass carp. By detecting the SNP molecular marker, grass carp parents with excellent salt tolerance can be effectively selected under the same breeding conditions. It can be effectively used in molecular marker-assisted breeding of grass carp, and then the genotype of grass carp parents can be identified according to actual breeding needs, and grass carp parents with suitable genotypes can be selected for breeding. Grass carp offspring (fry) with high salt tolerance can be obtained, which saves breeding time, has low cost and high accuracy, accelerates the breeding process of grass carp, and increases the economic benefits of breeding grass carp in saline-alkali environments.

[0010] Using high-salt conditions to select grass carp with excellent salt tolerance may cause lifelong irreversible damage to the grass carp and reduce its reproductive performance. The SNP molecular markers provided by the present invention for identifying the salt tolerance of grass carp can be used to directly select grass carp parents with excellent salt tolerance, avoiding irreversible damage to the grass carp and greatly reducing the breeding cost of new salt-tolerant grass carp varieties.

[0011] Preferably, the above-mentioned SNP molecular marker is located at base 15890052 of chromosome 1 of grass carp.

[0012] Preferably, the grass carp having the CC genotype corresponding to the 503rd base of the nucleotide sequence of the above-mentioned SNP molecular marker is a grass carp with salt tolerance.

[0013] Relevant experiments have verified that the CC genotype corresponding to the 503rd base in the nucleotide sequence of grass carp as shown in SEQ ID NO: 1 is the salt-tolerant superior genotype of grass carp, which provides theoretical support for the salt tolerance of grass carp and auxiliary salt-tolerant grass carp breeding.

[0014] According to a second aspect of the present invention, there is provided a use of the above-mentioned SNP molecular marker for identifying the salt tolerance of grass carp in the preparation of a product for identifying the salt tolerance of grass carp.

[0015] Preferably, the above-mentioned product includes at least one of a primer pair, a probe, a kit, and a chip.

[0016] According to a third aspect of the present invention, there is provided the use of the above-mentioned SNP molecular marker for identifying the salt tolerance of grass carp in assisted breeding of grass carp.

[0017] According to the fourth aspect of the present invention, a primer pair is provided for detecting the above-mentioned SNP molecular marker for identifying the salt tolerance of grass carp. The primer pair comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3.

[0018] According to a fifth aspect of the present invention, a kit for identifying the salt tolerance of grass carp is provided, the kit comprising the primer pair of the SNP molecular marker for identifying the salt tolerance of grass carp.

[0019] According to a sixth aspect of the present invention, there is provided a method for identifying the salt tolerance of grass carp, comprising the following steps:

[0020] S1. Extracting genomic DNA from the grass carp to be tested;

[0021] S2. PCR amplification of the extracted genomic DNA was performed using primers for detecting the SNP molecular markers for identifying salt tolerance of grass carp to obtain a PCR amplification product;

[0022] S3. Sequence the PCR amplification products and determine the salt tolerance of the grass carp to be tested based on the sequencing results.

[0023] Based on the SNP molecular marker identified by the present invention for identifying the salt tolerance of grass carp, a primer pair targeting the SNP molecular marker is designed, the primer pair comprising an upstream primer and a downstream primer. After PCR amplification of genomic DNA extracted from a grass carp to be tested is performed using the primer pair, the PCR amplification product is sequenced, and the genotype at the 503rd base of SEQ ID NO: 1 in the genomic DNA sample to be tested is determined according to the sequencing result. If the 503rd base is a CC genotype, the grass carp has a strong salt tolerance, and if the 503rd base is a TC genotype, the grass carp has a weak salt tolerance.

[0024] Preferably, in S2, the reaction procedure of PCR amplification is as follows: pre-denaturation at 90-94°C for 3-6 min; denaturation at 90-94°C for 20-35 s, annealing at 56-60°C for 30-35 s, extension at 70-72°C for 20-30 s, 35-37 cycles; extension at 70-72°C for 3-12 min.

[0025] Preferably, in S2, the reaction system for PCR amplification is as follows: 0.1 μg of genomic DNA, 10 μL of Mix, 1 μL of upstream primer, 1 μL of downstream primer, and 20 μL of total reaction system, wherein the concentrations of the upstream primer and the downstream primer are both 0.1 nmol / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a comparison chart of the survival time of grass carp in the salinity-sensitive group and the salinity-tolerant group provided in Example 1.

[0027] Figure 2 This is the high-quality SNP obtained after sequencing provided in Example 1 and its distribution density map in the 24 chromosomes of grass carp.

[0028] Figure 3 This is the Manhattan plot of salt stress traits in the GWAS provided in Example 1.

[0029] Figure 4 The sequencing peak graph of 8 grass carps randomly selected from the grass carp population to be tested is provided for the test example.

[0030] Figure 5 The sequencing peak diagram of 100 grass carp in the salinity-sensitive group of the grass carp population provided for the test example.

[0031] Figure 6 The sequencing peak diagram of 100 grass carp in the salinity tolerance group of the grass carp population to be tested is provided for the test example. DETAILED DESCRIPTION

[0032] The following is a further clear and complete description of the technical features of the technical solution provided by the present invention in conjunction with specific embodiments. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative efforts are within the scope of protection of the present invention.

[0033] Example 1 Screening of candidate SNP molecular markers for salt-tolerant grass carp

[0034] In this example, grass carp was used as the experimental subject. Grass carp was cultured under certain salinity conditions. The tail fin tissue of the grass carp was taken for whole genome sequencing and genome-wide association analysis (GWAS) was used to screen candidate SNP molecular markers related to the salt tolerance of grass carp. The specific steps are as follows:

[0035] 1. The grass carp used in the experiment were purchased from Mingtao Fish Fry Farm in Dinghu District, Zhaoqing City, Guangdong Province. 1000 grass carp of similar size (average weight 16 g) were selected and transferred to a cement pool (5000 L, 2.5 m × 2.5 m × 0.8 m) before the experiment to adapt to it for 72 h. No feed was fed during this period. After the adaptation period, there were 948 grass carp participating in the formal experiment.

[0036] 2. At the beginning of the formal experiment, the salinity in the cement pool was increased by 3ppt every two hours. After the salinity reached 12ppt, the fish were observed every four hours. Dead grass carp were promptly removed and their survival time was recorded. The tail fins of the grass carp were collected and soaked in anhydrous ethanol and stored at 4°C for later use. The first 50 dead fish and the last 50 surviving fish were considered as the salt-sensitive group (SS group) and the salt-tolerant group (ST group), respectively. The average survival time of the grass carp in the salinity-sensitive group (SS group) and the salinity-tolerant group (ST group) was calculated. The results are as follows: Figure 1 shown.

[0037] Depend on Figure 1 It can be seen that under 12ppt salinity stress, the average survival time of grass carp was 63.70h, the average survival time of grass carp in the salinity sensitive group (SS group) and the salinity tolerant group (ST group) were 14.30±2.30h and 131.94±1.58h, respectively. The one-way analysis of variance showed that there was a significant difference in the survival time of grass carp in the sensitive group (SS group) and the salinity tolerant group (ST group) (P<0.0001).

[0038] 3. Whole genome resequencing was performed on the tail fin tissues of 100 grass carp in the above-mentioned salinity sensitive group (SS group) and salinity tolerant group (ST group). After the genomic DNA of the tail fin tissue samples was qualified, the DNA sequence was fragmented by ultrasound to form random fragments. The fragmented DNA was successively end-repaired, 3'-end A was added, and sequencing adapters were connected. Then, magnetic beads were used to adsorb and enrich fragments of about 350bp in length and amplified by PCR to form a sequencing library. The constructed library was first quality checked. The library that passed the quality check was sequenced using the DNBSeq T7TM platform. The sequencing strategy was DNBSeq T7 PE150, the total sequencing read length was 300bp, and the sequencing depth was 10×. After quality control, the sequencing results were aligned to the grass carp reference genome (GCF_019924925.1). The sequencing results showed that a total of 1,220.65G The sequencing quality score Q30 was 97.98% and the GC content was 37.77%. GATK software was used to detect SNPs. After SNP quality control, plink was used for association analysis. A large number of SNP molecular markers associated with traits were screened. After bioinformatics analysis and site filtering, 9,473,455 SNPs were used for further analysis. The high-quality SNPs obtained after sequencing and their distribution density in the 24 chromosomes of grass carp are shown in the figure below. Figure 2 As shown in Figure 2, in order to reveal the relationship between candidate SNPs and salt stress traits, the FarmCPU model was used for analysis, and the Bonferroni correction method was applied. 1.00×10E-06 was considered as the critical value of genome-wide significant p-value. The identification results of SNP molecular markers associated with salt stress traits in GWAS are shown in Figure 2. Figure 3 shown.

[0039] Depend on Figure 3 The Manhattan plot analysis results of the GWAS and salt stress traits shown in the display show that one of the SNP molecular markers has a significance of 5.68E-07 and is significantly associated with the salt tolerance trait. The SNP molecular marker is located at base 15890052 on chromosome 1 of grass carp, and is located at base 503 from the 5' end of the sequence shown in SEQ ID NO: 1. Its polymorphism is T / C, which is the SNP molecular marker for identifying the salt tolerance of grass carp provided by the present invention. By performing gene annotation on the SNP molecular marker for identifying the salt tolerance of grass carp obtained by the above screening, the protocadherin gene protocadherin7a (pcdh7a) was identified nearby, that is, the SNP molecular marker is related to the pcdh7a gene, and its function is related to calcium ion binding.

[0040] SEQ ID NO: 1

[0041] 5'-TGTCCGTTTCATTTTTTTTTTTAAATGTTCATCAACACACAGCAAGCAGT ACTTATTGACAATGAAATGTATTTTTCTACAAAAACCAATTAAAATAAATAGTTTACATTTAAATAATTAATATGAAGAAAATACAGTAAAAAAAGAATAAGTAAAAGAGAAAAGTAAAAGAAGGTTGTAATAAATTCAAAAAAATCTATAGCATTAAAAATCTAGTATTTAAAGAGGTGTCTGTGTGTACATACAAACAAAAAGAATAAAGCAACCATAACAACCATTTAAAGCTGTTTTGTATACAAGTATGCTAGTGCTGTTCCAGAGAGACATGCTGTTGTGTTTAACAATCTTATAGCCTGTGGTTAGAAGCTGTTTTATAGGAAACAGACAGAAAGTCAGGGGATCATTGAGGGCTTTTTACAATGGACCTGGCATTTCTAATCTATAGGCATATTGGCCTTCACAAGAACATATGAAGAAATGCTTTGGATATTTGATAGTTTA[N]GGTCAGTGTGTTCAGGTTTGATCCTTCTTTCATTACTGCTATGATCAAGTTGAACACAATGATGATATAAAGGTTAGTGGTGAAGGTATTTGGCCACCAAATAATTCTTTAAATAGGAGATTCAAATGTAAAATAAAAACTTAAAAGTGCAATATTGTACACTATATTGTAAGTGTAGTGTGCAAGATAGATAGATAGATAGATAGATCTAGACGTTTTTCTTTTTGCCATAATGGACCATTTAGGTTAAATAGCTTA AGTTATTATTAGTCTATCAATATTATTGTTATTATCTTATTGGTTTTGTTGTTATGTCTCTGAATCACGAAGAAGAAGTGTTCTCATTGTCTGAATGCGGCAATGCTTTTCGCTCATCCTGTT AACAATGAGCATGTATCGCACACACTCTCTCCGGTCCCAGCACGGGCTGCCCCGTAGCCACGCGGATGCGCGAGCGCAATGCAGCACTGACTGAACGTAATACAGTCACACAACAAAAGGA-3'

[0042] In SEQ ID NO: 1, the base N in [] represents T / C, which is a mutation type and is the location of the candidate SNP molecular marker associated with the salt tolerance of grass carp identified in this example.

[0043] Example 2 Primer pairs for candidate SNP molecular markers of salt-tolerant grass carp

[0044] Table 1 Primer pairs for detecting SNP molecular markers used to identify salt tolerance of grass carp

[0045] Primer name Sequence number Specific nucleotide sequence Upstream primer (Primer1-F) SEQ ID NO: 2 5'-GCAACCATAACAACCATT-3' Downstream primer (Primer1-R) SEQ ID NO: 3 5'-GGCCAAATACCTTCACCA-3'

[0046] This example aims to design the SNP molecular marker (SEQ ID NO: 1) significantly associated with the salt tolerance trait of grass carp according to Example 1, using Primer 5 to obtain the amplification primers shown in Table 1 (i.e., the primer pair provided by the present invention for detecting the SNP molecular marker for identifying the salt tolerance of grass carp). The nucleotide sequence amplified by the primer pair is shown in SEQ ID NO: 4, and the distance between its 5' end and 3' end and the SNP molecular marker site is greater than 50 bp.

[0047] SEQ ID NO: 4

[0048] GCAACCATAACAACCATTTAAAGCTGTTTTGTATACAAGTATGCTAGTGCTG

[0049] TTCCAGAGAGACATGCTGTTGTGTTTAACAATCTTATAGCCTGTGGTTAGAA

[0050] GCTGTTTTATAGGAAACAGACAGAAAGTCAGGGGATCATTGAGGGCTTTTT

[0051] ACAATGGACCTGGCATTTCTAATCTATAGGCATATTGGCCTTCACAAGAACATATGAAGAAATGCTTTGGATATTTGATAGTTTA[N]GGTCAGTGTGTTTCAGGT TTGATCCTTCTTTCATTACTGCTATGATCAAGTTGAACACAATGATGATATAA AGGTTAGTGGTGAAGGTATTTGGCC

[0052] In SEQ ID NO: 4, the base N in [] is T / C, which is a mutation type and is the location of the candidate SNP molecular marker associated with the salt tolerance of grass carp identified in Example 1.

[0053] Example 3 Method for Identifying Grass Carp Salt Tolerance

[0054] A method for identifying the salt tolerance of grass carp comprises the following steps:

[0055] S1. Extracting genomic DNA from the grass carp to be tested;

[0056] S2. PCR amplification of the extracted genomic DNA was performed using the primer pairs for detecting SNP molecular markers for identifying salt tolerance of grass carp provided in Example 2 to obtain a PCR amplification product;

[0057] The PCR amplification reaction procedure was as follows: pre-denaturation at 90-94°C for 3-6 min; denaturation at 90-94°C for 20-35 s, annealing at 56-60°C for 30-35 s, extension at 70-72°C for 20-30 s, 35-37 cycles; extension at 70-72°C for 3-12 min;

[0058] The PCR amplification reaction system was as follows: 0.1 μg of genomic DNA, 10 μL of Taq Master Mix, 1 μL of upstream primer, 1 μL of downstream primer, 20 μL of total reaction system (filled with H O to 20 μL), and the concentrations of upstream and downstream primers were both 0.1 nmol / mL;

[0059] Taq Master Mix is a PCR premix containing Taq DNA polymerase, dNTPs, standard Taq enzyme reaction buffer, enzyme stabilizer, and bromophenol blue dye;

[0060] S3. Sequence the PCR amplification products and determine the salt tolerance of the grass carp to be tested based on the sequencing results.

[0061] Test Case

[0062] This test example aims to verify the polymorphism of the SNP molecular marker related to the salt tolerance of grass carp identified in Example 1 using the primer pair provided in Example 2 and the method provided in Example 3. The specific operation steps are as follows:

[0063] 1. Eight grass carp were randomly selected from the test population (purchased from Mingtao Fish Fry Farm, Dinghu District, Zhaoqing City, Guangdong Province) and the genomic DNA of the grass carp fin rays was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology). The quality of the genomic DNA was detected by 1.0% agarose gel electrophoresis, and the genomic DNA concentration was detected using an ultraviolet spectrophotometer (Eppendorf, AG2231). The DNA was then stored at -20°C for future use.

[0064] 2. PCR amplification was performed on 8 grass carp using the primer pair shown in Table 1 (the upstream primer with the nucleotide sequence shown in SEQ ID NO: 2 and the downstream primer with the nucleotide sequence shown in SEQ ID NO: 3) and referring to the PCR amplification reaction system shown in Table 2 and the PCR amplification reaction procedure shown in Table 3. The obtained PCR amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The SNP sites and peak diagrams of the sequencing results were statistically analyzed. The results are shown in FIG. Figure 4 shown.

[0065] Table 1 PCR amplification reaction system

[0066] Components Dosage DNA template (grass carp fin ray genomic DNA) 0.1 μg Mix 10 μL Upstream primer 1 μL Downstream primer 1 μL <![CDATA[H2O]]> Make up to 20 μL

[0067] Table 2 PCR amplification reaction program

[0068]

[0069] The sequencing results and Figure 4It can be seen that there is a SNP molecular marker at the 503rd base of the nucleotide sequence shown in SEQ ID NO: 1 in 8 randomly selected grass carp from the test population. The genome of the grass carp population to be tested is polymorphic at the above SNP molecular marker, and the polymorphism is T / C. The SNP molecular marker contains three genotypes, namely CC, TC and TT. Among them, the CC genotype accounts for 50% of the 8 grass carp, the TC genotype accounts for 37.5%, and the TT genotype accounts for 12.5%.

[0070] 3. Referring to the above steps 1 and 2, 100 salinity-sensitive grass carp and 100 salinity-tolerant grass carp were obtained from the above test population. The grass carp fin genomic DNA was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology). The genomic DNA quality was detected by 1.0% agarose gel electrophoresis, and the concentration was detected by an ultraviolet spectrophotometer (Eppendorf, AG2231). The DNA was stored at -20°C for future use. The primer pair shown in Table 1 (the nucleotide sequence is the upstream primer shown in SEQ ID NO: 2 and the nucleotide sequence is the upstream primer shown in SEQ ID NO: 3) was used. NO: 3) and referring to the PCR amplification reaction system shown in Table 2 and the PCR amplification reaction procedure shown in Table 3, PCR amplification was performed on the genomic DNA of 100 salinity-sensitive grass carp and 100 salinity-tolerant grass carp. The obtained PCR amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The SNP sites and peak diagrams of the sequencing results of the salinity-sensitive group and the salinity-tolerant group in the grass carp population to be tested are shown as follows: Figure 5 、 Figure 6 As shown, the genotypes of the grass carp population to be tested were statistically analyzed based on the SNP sites and peak diagrams of the sequencing results, and the results are shown in Table 3.

[0071] Table 3 Genotypes of the grass carp populations tested

[0072]

[0073] According to the sequencing results, Figure 5 、 Figure 6 As shown in Table 3, there are 90 grass carp with CC genotype in the salinity-tolerant grass carp population, accounting for 90% of the total salinity-tolerant population, while there are only 22 grass carp with CC genotype in the salinity-sensitive grass carp population, accounting for 22% of the total sensitive population (Table 3).

[0074] The above results can prove that the 503rd SNP site of the grass carp genome sequence SEQ ID NO: 1 can provide a reliable basis for the identification of salt-tolerant grass carp.

[0075] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents, but these modifications or replacements are all within the scope of protection of the present invention.

Claims

1. A SNP molecular marker for identifying salt tolerance in grass carp, characterized by: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, wherein the 503rd base of the sequence is T or C.

2. The SNP molecular marker for identifying salt tolerance of grass carp according to claim 1, wherein: The SNP molecular marker is located at base 15890052 of grass carp chromosome 1.

3. The SNP molecular marker for identifying salt tolerance of grass carp according to claim 1, wherein: The grass carp whose genotype corresponding to the 503rd base of the nucleotide sequence of the SNP molecular marker is CC is a grass carp with salt tolerance.

4. Use of the SNP molecular marker for identifying the salt tolerance of grass carp according to any one of claims 1 to 3 in the preparation of a product for identifying the salt tolerance of grass carp.

5. Use of the SNP molecular marker for identifying the salt tolerance of grass carp as claimed in claim 4 in the preparation of a product for identifying the salt tolerance of grass carp, characterized in that: The product includes at least one of a primer pair, a probe, a kit, and a chip.

6. Use of the SNP molecular marker for identifying the salt tolerance of grass carp according to any one of claims 1 to 3 in grass carp assisted breeding.

7. A primer pair for detecting the SNP molecular marker for identifying the salt tolerance of grass carp according to any one of claims 1 to 3, characterized in that: The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

8. A kit for identifying the salt tolerance of grass carp, characterized in that: The kit comprises the primer pair of SNP molecular markers for identifying the salt tolerance of grass carp as claimed in claim 7.

9. A method for identifying the salt tolerance of grass carp, characterized in that: The following steps are involved: S1. Extracting genomic DNA from the grass carp to be tested; S2. performing PCR amplification on the extracted genomic DNA using the primer pair for detecting the SNP molecular marker for identifying the salt tolerance of grass carp as described in claim 7 to obtain a PCR amplification product; S3. Sequencing the PCR amplification product, and determining the salt tolerance of the grass carp to be tested based on the sequencing results.

10. The method for identifying the salt tolerance of grass carp according to claim 9, wherein: In the S2, the reaction procedure of the PCR amplification is as follows: pre-denaturation at 90-94°C for 3-6 min; denaturation at 90-94°C for 20-35 s, annealing at 56-60°C for 30-35 s, extension at 70-72°C for 20-30 s, 35-37 cycles; extension at 70-72°C for 3-12 min.

Images