422 results about "Base J" patented technology

The disclosure provides, for example, double stranded DNA (dsDNA) molecules comprising one or more chemically modified nucleobases. In some embodiments, the dsDNA molecule is circular and comprises a first strand and a second strand, wherein the first strand comprises one or more chemically modified nucleobases, and the second strand is free of chemically modified nucleobases. In some embodiments, the dsDNA molecule comprises a promoter sequence and an effector sequence that encodes an effector.

A composition of matter includes an antisense phosphorodiamidate morpholino oligomer (MO) that includes an MO base sequence. The MO base sequence is arranged to bind a corresponding complementary base sequence of messenger RNA (mRNA) transcribed from one or more genes for the beta subunit of human chorionic gonadotropin (hCG-β). An inventive method, for suppressing intracellular synthesis of a beta subunit of human chorionic gonadotropin (hCG-β), includes introducing such an MO into one or more cells.

The invention discloses a divalent nucleic acid aptamer fluorescence detection method based on an exonuclease I auxiliary target circulation strategy, and belongs to the field of analysis and detection.The divalent nucleic acid aptamer is a repetitive sequence composed of two monovalent nucleic acid aptamers and can form double-stranded DNA through base complementary pairing with complementary strand cDNA of the divalent nucleic acid aptamer, and the divalent nucleic acid aptamer can be used for fluorescence detection of the divalent nucleic acid aptamer. The method comprises the following steps: taking a bivalent nucleic acid aptamer as a template, forming a DNA silver nanocluster (DNA-AgNCs) under the action of silver nitrate and sodium borohydride, and when the target okadaic acid exists, combining the bivalent nucleic acid aptamer with the target, so that cDNA can be replaced from double-stranded DNA by the target. Exonuclease I is added to perform enzyme digestion on the cDNA and the divalent nucleic acid aptamer, so that the fluorescence intensity of the DNA-AgNCs can be rapidly reduced. The content of the okadaic acid can be judged by detecting the change of the fluorescence intensity. The invention provides a simple, convenient, rapid, high-sensitivity and high-specificity detection method for okadaic acid detection based on a divalent nucleic acid aptamer for the first time.

Provided is a reverse prime editing system, which is used for achieving site-specific and precise small-fragment DNA editing upstream of a target site. In the reverse prime editing system, a targeted strand nickase (such as D10A-Cas9) is used to cleave a nick on a targeted strand, thereby enabling precise small-fragment DNA base insertion, deletion and substitution upstream of the target site under the action of a reverse transcriptase.

The disclosure provides, for example, double stranded DNA (dsDNA) molecules comprising one or more chemically modified nucleobases. In some embodiments, the dsDNA molecule is circular and comprises a first strand and a second strand, wherein the first strand comprises one or more chemically modified nucleobases, and the second strand is free of chemically modified nucleobases. In some embodiments, the dsDNA molecule comprises a promoter sequence and an effector sequence that encodes an effector.

The invention discloses a high-efficiency wide-targeting-range C-to-G double-enzyme synergistic base editor and application thereof, and belongs to the technical field of gene editing. The editor is a fusion protein comprising a Cas protein having reduced or lost endonuclease activity, a cytosine deaminase (CDA), and a cytosine DNA glycosylase (CDG). In order to solve the problems that an existing C-to-G editor is low in efficiency and limited in targeting range, the C-to-G editor synergistically and efficiently generates a base removal (AP) site on a target DNA through the dual effects of CDA and CDG, so that C-to-G base transversion is promoted. According to the editor, the C-to-G editing efficiency is remarkably improved, an editing window can be effectively expanded or moved, the targeting flexibility is greatly enhanced, meanwhile, high genome specificity is kept, and the editor shows strong application potential in various organisms such as yeast and plants.

Provided is an efficient and precise plant gene knockout method. First, a sequence containing a stop codon cluster is inserted into a genome by means of dual pegRNA to obtain, by means of screening, a stop codon cluster sequence capable of efficiently and precisely knocking out a target gene. A prime editing system and multiple pegRNA programming can be used in combination with the method to enable various genomic modifications such as efficient and precise knockout of one or more target genes, base substitutions, and small fragment insertions, deletions, and substitutions with just one prime editing protein.

The invention discloses a whole genome methylation detection method based on MeDIP-MSRE, and belongs to the technical field of epigenetics detection. According to the method, methylation immunoprecipitation sequencing and a methylation sensitive restriction enzyme technology are innovatively combined, firstly, a methylation specific antibody is used for conducting immunoprecipitation on sample DNA, and whole genome methylation fragments are enriched; then carrying out enzyme digestion on the enriched product by adopting methylation sensitive restriction enzyme, specifically removing an unmethylated DNA region, and reserving a complete methylation sequence; and finally, constructing a methylation map through high-throughput sequencing. According to the method, traditional hydrosulfite chemical conversion is not needed, DNA damage and base conversion deviation caused by the traditional hydrosulfite chemical conversion are avoided, meanwhile, high sensitivity of MeDIP and high specificity of methylation sensitive restriction endonuclease are fused, and the fidelity, sensitivity and specificity of detection are remarkably improved.

The objective of this invention is to provide: aerobic-tolerant Bifidobacterium spp. capable of being cultured under aerobic conditions, a method for culturing the same and a method for screening it, and a composition comprising aerobic-tolerant Bifidobacterium spp. and a method for manufacturing the same. The present invention that solves this problem is a method for culturing Bifidobacterium bacteria, comprising the step of culturing Bifidobacterium bacteria having any one of the following (1) to (7) under aerobic conditions: (1) a gene consisting of a base sequence shown in sequence number 1 or 2; (2) a gene having more than 90% identity with a base sequence shown in sequence number 1 or 2; (3) a gene consisting of a base sequence in which 1 to several bases are missing, substituted, or added to a base sequence shown in sequence number 1 or 2; (4) a gene consisting of a base sequence of DNA that can hybridize under strict conditions with a DNA consisting of a complementary sequence of a base sequence shown in sequence number 1 or 2; (5) a gene consisting of a degenerate isomer of a base sequence shown in sequence number 1 or 2; (6) a gene encoding a protein consisting of an amino acid sequence shown in sequence number 3 or 4; (7) a gene encoding a protein consisting of an amino acid sequence in which 1 to several amino acids are missing, substituted, or added to an amino acid sequence shown in sequence number 3 or 4.

Provided herein, inter alia, are methods for sequencing polynucleotides. In addition, provided herein are methods for detecting base modifications, such as methylation interpretation, in polynucleotides by sequencing only native strands. The key innovation of the method is that after hybridization, a second strand is generated, and the second strand is configured to allow the adaptor to be connected to only one end. This limits sequencing to native strands, i.e., unique strands with potential modifications.

A primer pair, method, and use for rapidly identifying newborn nude mice. On the basis that a deletion mutation occurs in the base G at position 337 of a coding region of the Foxn1 gene in nude mice, a primer pair introducing an enzyme digestion site is designed according to sequence characteristics. Using the genome of a mouse to be tested as a template, the Foxn1 gene is amplified according to a PCR-RFLP method. The PCR product is then digested with a SmaI restriction endonuclease, and the digested product is genotyped by agarose gel electrophoresis. In addition, a reaction system that can be combined with lateral flow technology is screened, thereby achieving instant detection of the newborn nude mice. The method has the characteristics of simple operation, short time consumption, low cost, instant detection, etc.

The present invention relates to a recombinant antisense oligonucleotide that targets CD33 mRNA and to a method of preparing a substantially pure population of edited eukaryotic cells comprising the steps of i) editing a population of eukaryotic cells by the use of base editors, (ii) treating the same population with antisense oligonucleotides according to the invention to transiently downregulate CD33 and iii) enriching the population of edited eukaryotic cells that is negative for CD33.

The invention relates to an intron variant capable of accurately splicing and enhancing gene transcription and application of the intron variant, and belongs to the technical field of biological breeding, the intron variant is a variant of a Cat1mu intron, the Cat1mu intron has a nucleotide sequence as shown in SEQ ID NO.2, and the nucleotide sequence of the intron variant is formed by mutating base AG at the 182th to 183th sites of the sequence as shown in SEQ ID NO.2 into tG, Ac, At, cG, Aa, ta, tt, tc, cc, ct or ca. According to the present invention, the sequence analysis and the saturation mutation are performed on the Cat1mu, the screening is performed to obtain the Cat1mu series variant Cat1mu2-12, the accurate splicing effect of the Cat1mu2-12 during the fusion gene expression process is verified, and the Cat1mu6, the Cat1mu7, the Cat1mu8 and the Cat1mu10 can further enhance the fusion gene expression effect.

The invention relates to a full-length sequence amplification primer, an amplification method and a three-generation sequencing method of an HLA-I antigen gene, and belongs to the field of gene detection. The HLA-I antigen gene is subjected to PCR (Polymerase Chain Reaction) amplification by using 8 pairs of characteristic amplification primers. And each gene can be subjected to high-yield specific amplification on a full-length sequence containing complete intron and exon regions only through one round of amplification and enrichment, and 7.8 Kb long-fragment genes can be captured once at most. The experimental deviation caused by simultaneous amplification of a single gene by using a plurality of pairs of segmented primers and the indirect error caused by gene splicing are effectively avoided. The method comprises the following steps: carrying out quality inspection and purification on amplicon PCR (Polymerase Chain Reaction) products, mixing samples, constructing an HLA-I type antigen gene library, carrying out accurate and complete sequencing on the full-length sequence of the HLA-I type antigen gene by adopting a three-generation PacBio Sequel II platform, and ensuring that the Hifi reads base accuracy can reach 99% or above. The reading of HLA-I type antigen gene full-length sequence variation information and the haplotype analysis at a high resolution level can be realized.

The invention provides a novel base editor and application thereof. Specifically, the invention provides a novel double-stranded DNA deaminase, and a fusion protein (novel base editor), a base editing system, a base editing method and the like based on the novel double-stranded DNA deaminase, so as to improve the DNA editing efficiency of eukaryotic cell genes (especially mitochondrial genes), and especially improve the editing efficiency of non-TC DNA fragments such as' AC ',' GC 'and the like. According to the method, the types of the DNA fragments which can be effectively edited are expanded, and a wider prospect is provided for clinical application of DNA editing.

The invention discloses a lysosome targeted degradation system based on a DNA phase separation aggregate as well as a preparation method and application of the lysosome targeted degradation system, and belongs to the technical field of biological medicine and nanotechnology. The lysosome targeted degradation system based on the DNA phase separation aggregate comprises an RNA-DNA tetrahedral framework with a cohesive end, the RNA-DNA tetrahedral framework is formed by self-assembly of a core chain and an edge chain through complementary base pairing, the edge chain is a DNA-RNA chimeric oligonucleotide chain, and the DNA-RNA chimeric oligonucleotide chain is a DNA-RNA chimeric oligonucleotide chain. One or more sections of RNA ribonucleotide sequences which can be specifically recognized and cut by RNase H enzyme are embedded in the sequence, and the tail end of the RNA ribonucleotide sequence is modified with a cohesive tail end for driving phase separation and a cell membrane anchoring group; the RNA-DNA tetrahedral framework is modified with an aptamer of a targeted membrane protein. After entering cells, the system is subjected to liquid-liquid phase separation in a lysosome acid environment through interaction of cohesive ends, a micron-sized large-size aggregate is formed in situ, the residence time of a nano-drug in the lysosome is prolonged, and efficient degradation of target membrane protein is realized.

The invention belongs to the technical field of biology, and particularly relates to ANK1 gene nonsense mutation and application. The invention firstly provides an ANK1 gene non-sense mutation c.2230 Cgt and an ANK1 gene non-sense mutation c.2230 Cgt. The invention relates to the field of genetic engineering, and in particular relates to nonsense mutation T (p.Q744X), the nonsense mutation significantly reduces the expression of ankyrin, and further causes phenotypic changes such as abnormal cell morphology and increased osmotic fragility after K562 erythroid differentiation, which indicates that the K562 is related to the pathological process of hereditary polycythemia spheroides (HS), and indicates that the mutation has pathogenicity; secondly, a treatment evaluation system taking drug-induced translation readthrough and adenine base editing as a core is constructed around the mutation, a new strategy and a technical platform are provided for precise molecular treatment of the ANK1 nonsense mutant HS, and important clinical transformation prospects and application values are achieved.

The present invention relates to methods and devices for identification and quantification, including low abundance nucleotide base mutations, insertions, deletions, translocations, splice variants, miRNA variants, alternative transcripts, alternative start sites, alternative coding sequences, alternative non-coding sequences, alternative splicing, exon insertions, exon deletions, intron insertions, or other rearrangements and / or methylated nucleotide bases at the genomic level.

Provided is an accurate guide RNA (gRNA) screening method for base editing of an asialoglycoprotein receptor 1 (ASGR1) gene, including the following steps: (1) gRNA design; (2) primer design; (3) in vitro transcription of gRNA; (4) cell transfection; (5) collection of cells, and extraction and polymerase chain reaction (PCR) of a genome; and (6) Sanger sequencing.

The present disclosure provides base editor fusion proteins, complexes, and systems capable of installation of multiple edits across large genomic windows (e.g., between 4bps and 500 bps) and which may be useful, for example, for mutating one or more nucleotides in a target nucleic acid. The disclosure describes gene editing systems comprising a first fusion protein comprising a C-terminal portion of a split deaminase and a first epitope binding domain, a second fusion protein comprising a N-terminal portion of a split deaminase and a second epitope binding domain, and a third fusion protein comprising a DNA binding protein domain and one or more epitope domains to which the first and second fusion proteins may bind (along the one or more epitope domains), thereby forming an active deaminase domain. The base editor fusion proteins, complexes and systems can be used in certain embodiments in methods of performing mutational screens in a gene of interest. Other aspects of the disclosure relate to methods, for example, methods of mutating one or more nucleotides in a target nucleic acid and methods of performing mutational screens. The disclosure also provides compositions, polynucleotides, vectors, pharmaceutical compositions, cells, kits, and systems comprising the base editor fusion proteins and complexes contemplated herein.

A 2-bromoacrylamide assisted cyclization sequencing (BACS) method allows quantitative profiling of pseudouridine (psi) at single base resolution. Based on bromoacrylamide cyclization chemistry, BACS induces psi-to-C mutations during reverse transcription (RT) instead of truncation or deletion of features, thus providing higher resolution and enabling more accurate quantification of psi stoichiometry compared to CMC and BS based methods. The BACS of the invention allows for precise identification of psi positions, in particular in densely modified psi regions and continuous uridine sequences, compared to known methods. Accordingly, methods, compositions, and kits for detecting psi are possible. In the case of RNA molecules, this allows psi to be detected and sequenced in such sequences.

The invention discloses a method for improving the water-resistant straw-like dwarf virus capability of rice based on D14 protein site editing and application of the method, according to the scheme, an interaction interface of RGSV P3 and rice D14 protein is analyzed through a structural biology means, and it is determined that the 102nd part, with the D14 binding site, of D14 and P3 is aspartic acid (Asp, D). Then, accurate editing of the D14 gene in the rice is realized by utilizing a cytidine base editor (CBE) system, and the site is mutated into asparagine (Asn, N), so that D14 (D102N) transgenic rice is obtained. Disease resistance identification confirms that the mutant has significant resistance to RGSV. Furthermore, a homozygous non-transgenic disease-resistant material which does not contain exogenous transgenic ingredients is obtained through genetic screening and has a good breeding application prospect.

The present invention relates to a method for determining the sequence of a nucleic acid molecule. Specifically, the present invention provides a method comprising: i. Providing a nucleic acid molecule comprising a 5 '-region and a 3'-region wherein the 5 '-region and the 3'-region are covalently linked by a nucleotide sequence that can bind to a primer wherein the 5 '-region and the 3'-region are covalently linked by a nucleotide sequence that can bind to the primer, the base identity in one of the 5'region or the 3 'region and the base identity in the other region independently provide information about the base identity in the corresponding locus in the original nucleic acid molecule wherein the molecule further comprises: a linker located at the 5'end of the molecule; a linker located at the 3'end of the molecule; ii. Sequencing the molecule provided in step (i) using at least two different primers wherein the at least two different primers bind to at least three, preferably at least four, different regions of the nucleic acid molecule provided in (i), wherein: 1. At least one of the primers is capable of binding at least partially to at least a portion of the linker at the 5'end of said molecule for sequencing at least a portion of the 5 'region of the nucleic acid molecule provided in (i); 2. At least one of the primers is capable of at least partially binding to a nucleotide sequence region covalently linking the 5'region and the 3 'region of the nucleic acid molecule provided in (i) to sequence the 3' region of the nucleic acid molecule provided in (i); 3. At least one of the primers is capable of binding at least partially to at least a portion of the linker at the 3'end of the molecule to sequence at least a portion of the 3 'region of the nucleic acid molecule provided in (i); and / or 4. At least one of the primers is capable of at least partially binding to a region covalently linked to the 5'region and the 3 'region of the nucleic acid molecule provided in a to sequence the 5' region of the nucleic acid molecule provided in (i).

YThe invention discloses a gene II type grass carp reovirus detection primer, a probe and a detection method. The microdroplet type digital PCR detection primer and the probe for the gene II type grass carp reovirus comprise GCRV-S6-F3: 5 '-GGCTAAGGTTACTCTGCATTGC-3', GCRV-S6-F3: 5 '- GCRV-S6-R3 is 5 '-CAGTGGTGACCAAAGTG TTGAGYT-3', and GCRV-S6-R3 is 5 '- And GCRV-S6-P3: 5 '-fluorophore, namely GGTAAACCACTTAGTGCGGAGA, namely a quenching group, namely, GCRV-S6-P3: 5'-fluorophore. According to the invention, the second base at the 3'end of GCRV-S6-R3 is designed as a degenerate base 'Y', and 'C' at the 5 'end of a probe is modified as' G '. The modified primer and probe do not influence the ddPCR amplification efficiency and specificity, and the primer has higher applicability when being used for detecting variant strains.

This invention provides a novel DNA glycosylase Bph and its application in base editing. Specifically, it provides a novel DNA glycosylase Bph and a novel base editor containing this novel DNA glycosylase. This novel base editor can achieve adenine-based base transversions. The novel DNA glycosylase of this invention can be applied to precise genome editing and has promising application prospects.

Provided are systems for strand-specific editing of DNA, including mitochondrial DNA in humans. The systems provided herein comprise a nickase and a single-stranded (ss) DNA deaminase each, or together, associated with a double-stranded DNA binding polypeptide such that DNA editing occurs in an editing region. Also provided herein are components of the systems for editing DNA taught herein, and methods of use thereof.

The application discloses application of long-chain non-coding RNA LncZFHX2 in preparation of a drug for treating osteoarthritis. LncZFHX2 is specifically combined with KLF4 protein through a specific structure and a base sequence of LncZFHX2, and promotes transcriptional regulation of the KLF4 protein on RIF1 protein. LncZFHX2 indirectly regulates RIF1 protein to improve a cell state. Overexpression of LncZFHX2 inhibits osteoarthritis in vitro. In the results of the examples of the application, it is verified that overexpression of LncZFHX2 inhibits development of osteoarthritis, and a new intervention approach and a candidate drug are provided for clinical prevention and treatment of osteoarthritis. LncZFHX2 has a short sequence, does not need to be translated into a protein to play a role, has the characteristics of quick effect, high efficiency and low cost, and has high cost performance in synthesis and application.

The application discloses a method for constructing a tag sequence-containing vector library by short oligonucleotides and application thereof. The method needs two oligonucleotides, i.e. a customized tag primer and a universal primer which can be used for all library constructions. The middle of the tag primer is a tag sequence, and both sides are annealing sequences. The universal primer has sequences complementary to the annealing sequences of the tag primer on both sides, and a modified base which can be recognized as a base damage by a host microorganism in the middle. The tag primer library is annealed with an equal amount of the universal primer to obtain primer dimers. The primer dimers have base-paired DNA double strands on both sides, and are cohesive ends. The middle of the primer dimers is an unpaired omega loop structure, and the double strands of the omega loop contain the tag information carried by the tag primer and the modified base carried by the universal primer respectively. The primer dimers are connected with linearized vectors, and then are transformed into E. coli, so that the region of the modified base of the omega loop is replaced by the tag sequence through the base excision repair mechanism of the endogenous cells.

The present invention provides: a compound which is an antisense oligonucleotide capable of regulating the expression of a RasGRP4 gene and treating myositis and rheumatoid arthritis, and which has a nucleic acid base sequence consisting of 8-80 linked nucleosides and comprising at least 8 consecutive nucleic acid bases complementary to a transcript of RasGRP4; or a pharmacologically acceptable salt thereof.

The present disclosure provides a technique for inhibiting ubiquitin ligase RFFL function and improving the plasma-membrane expression of a mutant CFTR protein. The present disclosure also provides a novel therapeutic agent for CF.　The present inventors have found that a modified oligonucleotide, or a salt thereof, having a specific base sequence and a modified structure, can inhibit ubiquitin ligase RFFL function and improve the plasma-membrane expression of a mutant CFTR protein.