Cas9 nuclease K918A and application thereof

A technology of nuclease and nuclease activity, applied in application, hydrolase, DNA preparation, etc., to achieve the effect of precise editing

Active Publication Date: 2017-07-18
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the editing of DNA fragments can be realized through the CRISPR/Cas9 system, but for the in-depth study of the precise functi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9 nuclease K918A and application thereof
  • Cas9 nuclease K918A and application thereof
  • Cas9 nuclease K918A and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0077] Example 1 Studying the connection of DNA fragment editing adapters and discovering a new mechanism of Cas9 cleavage

[0078] For HS51 locus, construct sgRNAs plasmid for HS51 locus:

[0079] (1) Purchase primers

[0080] Purchase from Shanghai Sunny Biotechnology Co., Ltd. the forward and reverse deoxy oligos with 5'hanging ends "ACCG" and "AAAC" for HS51 locus and sgRNAs targeting sequence respectively;

[0081] Targeting sequence of sgRNAs for the above HS51 locus:

[0082] HS51 RE1sgRNA1: GCCACACATCCAAGGCTGAC (SEQ ID NO.1)

[0083] HS51 RE1sgRNA2: GAGATTTGGGGCGTCAGGAAG (SEQ ID NO. 2)

[0084] (2) Obtain complementary paired double-stranded DNA with hanging ends

[0085] 1) Use ddH 2 O Dissolve the deoxy oligonucleotide to 100 μM and dilute to 20 μM;

[0086] 2) Add positive and negative deoxy oligonucleotides to the following reaction system:

[0087]

[0088] Reaction conditions: 95°C water bath for 5 min, then open the lid of the water bath and the temperature drops to about 60°C...

Example Embodiment

[0152] Example 2 Mutant SpCas9 obtains specific Cas9 with changed cutting mode to achieve precise DNA fragment editing

[0153] 1. Construction of Cas9 mutants

[0154] 1) Use NEB Mutagenesis Kit (Q5Site-Directed Mutagenesis Kit, #E0554S) to construct Cas9 mutant, first carry out PCR amplification, the reaction is as follows:

[0155]

[0156]

[0157] 2) KLD (Kinase, Ligase & DpnI) treatment, the reaction is as follows:

[0158]

[0159] Reaction conditions: 10 minutes at room temperature

[0160] 3) All the reaction products in 2) were used for transformation of competent bacteria Stbl3 (50 μl), and cultured on an LB plate containing ampicillin antibiotic (Amp, 100 mg / L) overnight at 37°C. Pick a single clone, extract the plasmid and send it to sequencing.

[0161] The amino acid sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO. 7, specifically:

[0162]

[0163]

[0164] The coding nucleotide sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO. 8, specifically:

[0165]

[0166]

[0167...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biology and particularly relates to Cas9 nuclease and application. The Cas9 nuclease (Cas9-K918A) disclosed by the invention has the activity of the Cas9 nuclease, is suitable for a CRISPR/Cas9 system and is obtained by mutating 918th lysine of wild type Cas9 nuclease into alanine. The Cas9 nuclease (Cas9-K918A) is adopted for cutting DNA (Deoxyribonucleic Acid) double strands to generate a predominantly-broken terminal; a basic group complemented with the predominantly-broken terminal can be added in a connection filling-in mode, so that accurate edition of a specific position of a genomic DNA fragment can be realized.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a Cas9 nuclease K918A and its application. Background technique [0002] Since the completion of the Human Genome Project and the Encyclopedia of DNA Elements, scientists have analyzed and identified a large number of genes and DNA regulatory elements in the genome [1,2]. DNA regulatory elements that play an important role in the regulation of gene expression include promoters, enhancers, silencers, and insulators. However, the functions of most regulatory elements have not been experimentally verified and elucidated [2-8]. Exploring the function of genes and DNA regulatory elements can be studied through genetic DNA segment editing. [0003] Early gene editing and gene function modification were achieved through gene transposition and transgenesis [9-14]. With the development of sequencing technology, reverse genetics has been applied to make specific mutations in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/22C12N15/55C12N15/63C12N15/10
CPCC12N9/22C12N15/102C12N15/63C12N2310/10
Inventor 吴强李金环寿佳
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products