Cas9 nuclease K918A and application thereof
A technology of nuclease and nuclease activity, applied in application, hydrolase, DNA preparation, etc., to achieve the effect of precise editing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0077] Example 1 Studying the connection of DNA fragment editing adapters and discovering a new mechanism of Cas9 cleavage
[0078] For HS51 locus, construct sgRNAs plasmid for HS51 locus:
[0079] (1) Purchase primers
[0080] Purchase from Shanghai Sunny Biotechnology Co., Ltd. the forward and reverse deoxy oligos with 5'hanging ends "ACCG" and "AAAC" for HS51 locus and sgRNAs targeting sequence respectively;
[0081] Targeting sequence of sgRNAs for the above HS51 locus:
[0082] HS51 RE1sgRNA1: GCCACACATCCAAGGCTGAC (SEQ ID NO.1)
[0083] HS51 RE1sgRNA2: GAGATTTGGGGCGTCAGGAAG (SEQ ID NO. 2)
[0084] (2) Obtain complementary paired double-stranded DNA with hanging ends
[0085] 1) Use ddH 2 O Dissolve the deoxy oligonucleotide to 100 μM and dilute to 20 μM;
[0086] 2) Add positive and negative deoxy oligonucleotides to the following reaction system:
[0087]
[0088] Reaction conditions: 95°C water bath for 5 min, then open the lid of the water bath and the temperature drops to about 60°C...
Example Embodiment
[0152] Example 2 Mutant SpCas9 obtains specific Cas9 with changed cutting mode to achieve precise DNA fragment editing
[0153] 1. Construction of Cas9 mutants
[0154] 1) Use NEB Mutagenesis Kit (Q5Site-Directed Mutagenesis Kit, #E0554S) to construct Cas9 mutant, first carry out PCR amplification, the reaction is as follows:
[0155]
[0156]
[0157] 2) KLD (Kinase, Ligase & DpnI) treatment, the reaction is as follows:
[0158]
[0159] Reaction conditions: 10 minutes at room temperature
[0160] 3) All the reaction products in 2) were used for transformation of competent bacteria Stbl3 (50 μl), and cultured on an LB plate containing ampicillin antibiotic (Amp, 100 mg / L) overnight at 37°C. Pick a single clone, extract the plasmid and send it to sequencing.
[0161] The amino acid sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO. 7, specifically:
[0162]
[0163]
[0164] The coding nucleotide sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO. 8, specifically:
[0165]
[0166]
[0167...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap