253 results about "DNA polymerase" patented technology

The invention discloses a kit for detecting miRNAs of multiple extracellular vesicles based on a TtAgo-driven rolling circle amplification technology and application of the kit, a platform combines TtAgo protein and RCA reaction, cooperates with endonuclease activity and DNA polymerase activity of TtAgo, accurately controls reaction kinetic balance between temperature and enzyme activity, not only does not damage the cutting activity of TtAgo, but also can detect miRNAs of multiple extracellular vesicles. The method provided by the invention can be used for detecting multiple extracellular vesicles miRNAs, ensures strong polymerization amplification performance, creates a strong one-step single-tube experiment, greatly simplifies the experimental process, shortens the detection time, realizes ultra-sensitive and specific detection of nucleic acid markers, and can be used for detecting multiple extracellular vesicles miRNAs.

The invention relates to the technical field of biology, in particular to a cis-trans typing method for drug-resistant gene mutation EGFR T790M / C797S. The invention provides an EGFR (Epidermal Growth Factor Receptor) T790M / C797S cis-trans typing method based on a locked nucleic acid LNA (Low Nucleic Acid) probe, ultrahigh-specificity DNA (Deoxyribose Nucleic Acid) polymerase and a primer probe combination. The typing method can be used for accurately distinguishing EGFR T790M / C797S double-mutation cis-configuration and trans-configuration; meanwhile, the kit has the advantages of high sensitivity, high specificity, simple steps and low cost, is suitable for detecting low-abundance samples such as circulating tumor DNA (ctDNA) and can meet the clinical rapid detection requirement.

The invention relates to the technical field of food safety detection, in particular to a food crop pathogenic mycotoxin detection method based on double signal amplification. The core of the method is a section of linear lock-type probe containing a mycotoxin specific nucleic acid aptamer, under the condition that target mycotoxin exists in a sample, the aptamer is combined with the mycotoxin, the probe is induced to generate conformational change, and the probe is closed into annular DNA under the catalysis of DNA ligase; then, the circular DNA is used as a template, isothermal rolling circle amplification is carried out through Phi29 DNA polymerase, and a long-chain DNA product containing a large number of repetitive sequences is generated; subsequently, the long-chain product is used as a molecular scaffold, and two kinds of gold nanoparticles of which the surfaces are modified with different complementary probes are cross-linked at the same time, so that the nanoparticles are quickly gathered, the color of the solution is changed from wine red to blue or purple, and convenient visual detection is realized. The method has the outstanding advantages of ultrahigh sensitivity, rapid detection and the like, and is suitable for on-site rapid screening of mycotoxin pollution.

The present disclosure provides an aptamer capable of inhibiting the activity of a strand-displacing DNA polymerase, the aptamer including: an oligonucleotide region 1 comprising a sequence in which a sequence X1a is linked to the 3'-end of a first sequence or the sequence X1a is linked to the 3'-end of a mutant sequence of the first sequence; and an oligonucleotide region 2 comprising a sequence in which a sequence X1b is linked to the 5'-end of a second sequence or the sequence X1b is linked to the 5'-end of a mutant sequence of the second sequence. The present disclosure also provides: a composition and a kit each containing the aptamer; and a method for amplifying a nucleic acid using the composition or the kit.

The invention relates to the technical field of biological detection, and discloses a method for double-ring detection of lung cancer L858R mutation based on CRISPR / Cas9 and DNA, and the method comprises the following steps: enriching circulating tumor cells CTC from a blood sample; extracting genomic DNA (deoxyribonucleic acid) of the enriched CTC; carrying out amplification on the DNA fragment containing the L858R mutation by adopting recombinase polymerase amplification RPA (recombinase polymerase amplification); the amplified DNA fragment is hybridized with a recognition ring in a DNA double-ring structure, a DNA double ring is composed of the recognition ring and a report ring, and a part of region of the recognition ring is hybridized with a corresponding fragment of the report ring to form a staggered double-chain region; when L858R mutation exists, the mutated DNA and a recognition ring are hybridized to activate a CRISPR / Cas9 system, and under the guidance of sgRNA, Cas9 cuts hybrid double strands and releases a report ring; carrying out rolling circle amplification RCA under the action of DNA polymerase by taking the released report ring as a template; a fluorescent probe is used for detecting an RCA amplification product, and whether L858R mutation exists or not is judged according to a fluorescence signal. The CRISPR / Cas9 system is combined with a DNA double-ring structure, so that the ultra-sensitive and specific detection on the lung cancer L858R mutation is realized.

The application discloses a kind of compositions, reagents and its detection method for high-throughput gene sequencing, belong to gene sequencing technical field, the composition includes Tris-HCl buffer 80-120 parts, potassium chloride 40-60 parts, ammonium sulfate 10-20 parts, magnesium chloride 15-25 parts, dNTPs mixed solution 30-50 parts, heat-stable DNA polymerase mutant 8-15 parts, PCR promoter complex 5-12 parts, modified iridium quinoline ketone complex 1-5 parts, glycerol 150-250 parts, Tween-20 1-3 parts, EDTA disodium salt 0.5-2 parts and nuclease-free ultrapure water, by introducing the modified iridium quinoline ketone complex of innovation, effectively solve the technical problems of low amplification efficiency, poor multiplex PCR reaction uniformity and high non-specific amplification background for high GC content, complex secondary structure genomic template, significantly improve the specificity of amplification, uniformity and the quality and reliability of final sequencing data.

The invention discloses a method for synthesizing millions of unique DNA tags through primer combination and application of the method, and relates to the field of molecular biology. According to the method, partial complementary pairing characteristics of F, X and Y primers are utilized, and under the synergistic effect of T4 DNA polymerase and ligase, millions of unique DNA tags are generated through one-time reaction through annealing-filling-ligation three-step reaction. The label structure comprises 5'end functional modification sites (such as amino and biotin) and a customizable sequencing joint, and is suitable for high-throughput labeling scenes such as single-cell multiomics, space proteomics and antibody coupling (AOC). Compared with a traditional one-by-one synthesis method, the method has the advantages that the single-tag synthesis cost is reduced by 80% or above, a reaction system is compatible with automatic operation, the tag combination complexity can reach 5.6 * 10 (based on 384 * 384 * 384 primer combination), and an efficient solution is provided for large-scale molecular marking.

The present invention relates to cells comprising an orthogonal DNA replication machine, linear plasmids replicable by said machine, uses of said cells and said linear plasmids, methods of maintaining linear plasmids in cells, methods of evolving sequences of interest, and methods of preparing polypeptides or nucleic acids. The invention also relates to error-prone DNA polymerases, nucleic acids encoding said polymerases and uses thereof.

Provided are a method for constructing a library based on an RNA sample and uses thereof. The method includes: step 1 of subjecting the RNA sample to a reverse transcription reaction to obtain DNA-RNA hybrid strands; step 2 of performing reaction of the DNA-RNA hybrid strands with an endoribonuclease, a first DNA polymerase, a second DNA polymerase, and dATPs to obtain a double-stranded DNA added with dA-tail, where the first DNA polymerase has a 5′-3′ exonuclease activity and a 3′-5′ exonuclease activity, and the second DNA polymerase has no 3′-5′ exonuclease activity; step 3 of ligating the double-stranded DNA added with dA-tail and a sequencing adaptor to obtain a ligated product; and step 4 of subjecting the ligated product to PCR amplification to obtain a sequencing library.

The present invention provides a method of stabilizing a phi29 DNA polymerase by contacting the phi29 DNA polymerase with a stabilized oligonucleotide that is free from degradation by a 3'exonuclease. The phi29 polymerase exhibits improved temperature stability in the presence thereof compared to the absence of the stabilized oligonucleotide. The method involves preparing a composition comprising a phi29 DNA polymerase and a stabilized oligonucleotide comprising one or more modified nucleotides. The compositions can be used in methods for performing polymerase reactions, nucleic acid replication, and detection of a target nucleic acid or target analyte in a sample. The compositions are particularly useful in rolling circle amplification reactions in which the targets are produced by proximity ligation assay, in particular cyclized lock probes.

The invention provides a CPA-LFD method for detecting Rahnella aquatilis and a detection kit, and belongs to the technical field of microbiological detection. On the basis of a single cross primer isothermal amplification technology (CPA) and in combination with a transverse flow test strip (LFD) prepared by colloidal gold, a real-time detection method for Rahnella aquatilis under the condition of 63 DEG C isothermal amplification is developed. According to the method, a specific primer is designed, and a probe containing Biotin and an FAM label is used for identifying a DNA specific region, so that rahnella aquatica is effectively detected within 1 hour; the optimized Bst DNA polymerase can be directly applied to isothermal amplification reaction of DNA, so that the detection process is simplified, and the time is shortened; the method is simple to operate, does not need to depend on professional detection personnel, has low requirements on instruments, realizes visual interpretation of detection results, has relatively high sensitivity and specificity, can detect Rahnella aquatica with the lower limit of 48fg / mu L, is suitable for rapid detection of Rahnella aquatica in human clinical samples, animals, fishes and food pollution, and can be widely applied to detection of Rahnella aquatica. The method has important significance on monitoring, diagnosis and epidemiological prevention and control of diseases caused by rahnella aquatica.

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

In an aspect, provided is a DNA polymerase with an amino acid sequence of at least 80% sequence identity with SEQ ID NO: 1 and having one or more amino acid substitution, wherein the one or more amino acid substitution is selected from the group consisting of A83S, N91I, R96H, R96C, M97V, G108D, G111V, R113H, V118S, S122N, L126I, P127L, A134T, D145V, D145N, D147V, H149R, H149L, Q171L, Q171S, I173V, L178K, I179L, Q180M, F181L, K182D, D186T, G197S, D200K, S215P, K220N, V222I, W232Y, M336L, D341K, D341I, D341L, S349R, S349G, T368Y, D398I, V399R, Q560H, and any combination of two or more of the foregoing. Also provided are a kit including the polymerase, a polynucleotide encoding the polymerase, a method of synthesizing a polynucleotide using the polymerase, and a method of sequence a polynucleotide synthesized by the polynucleotide.

The invention provides a DNA polymerase mutant and application thereof. Compared with a wild type KOD DNA polymerase, the DNA polymerase mutant has amino acid mutation at the 408th site, the 409th site or a functional equivalent site; and an amino acid mutation of at least one site selected from the following 23 sites and functional equivalence sites: 141 site, 143 site, 147 site, 383 site, 384 site, 389 site, 485 site, 584 site, 589 site, 397 site, 424 site, 432 site, 445 site, 523 site, 553 site, 561 site, 564 site, 461 site, 481 site, 605 site, 663 site, 711 site, and 725 site; the amino acid sequence except the amino acid mutation site of the mutant has at least 90% identity with the corresponding amino acid sequence of the wild type KODDNA polymerase; the wild type KOD DNA polymerase has an amino acid sequence as shown in SEQ ID NO: 2.

Provided is a conditional multiplex QPCR method. A QPCR amplification system, for each DNA sample, comprises a set of conditional primers 1 and 2. Forward conditional primers 1 and 2 are paired with a template strand, and reverse conditional primers 1 and 2 are paired with a complementary strand of the template strand. A conditional primer 2 is located downstream of a conditional primer 1, the 5' end of the conditional primer 2 is connected to an amplification primer of a DNA fragment to be detected, and the amplification primer is not paired with an upstream sequence of a binding site between the conditional primer 2 and the template strand. In the method, only when both the conditional primers 1 and 2 are bound to the template strand and the conditional primer 1 extends to the 5' end of the conditional primer 2, the DNA polymerase cleaves the amplification primer of the DNA fragment to be detected, which is free at the 5' end of the conditional primer 2, into an amplification system. The method reduces the possibility of unnecessary pairing between the amplification primer of the DNA fragment to be detected and other different DNA samples, thereby improving the specificity of the amplification reaction.

The invention relates to a helper adenovirus genome wherein expression of one or more of the adenoviral early E1 genes, E2 genes including DNA-binding protein (DBP), pre-terminal protein (pTP) and DNA polymerase, or production of functional proteins are regulated. The invention also relates to a process for delivery of the helper-dependent or gutless adenovirus vector genome and modulating replication of the helper virus DNA in the manufacturing cells, in which to allow a sufficient length of time before excision, cutting, or recombination to removal of the viral packaging signal DNA sequence from the helper adenovirus genome prior to induction of viral DNA replication, and expression of helper proteins that are required for adenovirus capsid particle formation and packaging, or encapsidation, of the helper-dependent or gutless adenovirus vector genomes, while preventing the packaging, or encapsidation, of the helper adenoviral genome into preform adenoviral capsids.

Provided is a recombinant B7 polymerase. The recombinant B7 polymerase has a sequence having at least 85% identity to the sequence of a wild-type B7 polymerase. The recombinant B7 polymerase comprises mutations corresponding to one or more positions of the sequence of the wild-type B7 polymerase, selected from the following: positions 169, 171, 441, 442, and 443. The recombinant B7 polymerase has DNA polymerase activity. The sequence of the wild B7 polymerase is as shown in SEQ ID NO: 1.

This invention discloses direct amplification qPCR reagents, kits, and applications for whole blood samples. The amplification reagents include: a composite hot-start DNA polymerase system, a buffer system, a surfactant, an anti-contamination system, and an anti-inhibition enhancer system. The composite hot-start DNA polymerase system is obtained by mixing antibody-modified hot-start Taq enzyme and antibody-modified Taq1C2 mutant Taq enzyme in a predetermined ratio. The buffer system includes Tris-HCl, MgCl2, (NH4)2SO4, and KCl. The surfactants include Tween-20 and NP-40. The anti-contamination system includes UDG enzyme and dNTPs, wherein the dNTPs are composed of dATP, dGTP, dCTP, dTTP, and dUTP. The anti-inhibition enhancer system includes D-trehalose, L-carnitine, DMSO, BSA, and SSB single-chain binding protein.

The present disclosure relates, in general terms, to directed evolution, and more specifically to compositions and methods for phage-assisted directed evolution in microbes. In one embodiment, there is provided a method for directed molecular evolution, the method comprising: a) introducing a propagation-defective phage vector into a first host cell (mutagenic host) competent to propagate the phage vector, wherein the first host cell comprises a gene construct of interest (GOI) to be evolved; and wherein the phage vector allows for (i) expression of an error-prone DNA polymerase in the first host cell for mutagenesis, and (ii) replication and packaging of the GOI into infectious phage particles; b) incubating the first host cell under conditions for replication and mutagenesis of the GOI and release of phage particles comprising mutated GOIs; c) infecting a second host cell (selection host) with phage particles from step b); and d) selecting for a desirable function of the GOI in the second host cell.

The invention is applicable to the technical field of agricultural microbiological detection, and provides an RPA-CRISPR / Cas12a primer, a kit and a rapid detection method for detecting curvularia tritici, and the RPA-CRISPR / Cas12a primer comprises an upstream primer RPA-F of RPA, a downstream primer RPA-R of RPA, a crRNA primer, a universal primer Univ and a probe FB. The kit comprises the primer, Cas12a protein, T7 transcriptase, DNA polymerase, a buffer solution and a Cas12 / 13 special nucleic acid detection test strip. After sample DNA is extracted, isothermal amplification is performed for 20 min at 37 DEG C in an RPA reaction system; and adding the RPA product into a CRISPR / Cas12a reaction system containing crRNA to react for 20 minutes, and detecting the cut product through a Cas12 / 13 special nucleic acid detection test strip. The method has the advantages of strong detection specificity, high sensitivity, short time consumption and simple operation.

The invention relates to the field of bioengineering, in particular to a Taq enzyme mutant, a nucleic acid molecule and application of the Taq enzyme mutant and the nucleic acid molecule. The invention provides a mutant of Taq DNA (deoxyribonucleic acid) polymerase, which has one or more amino acid site mutations on the basis of wild Taq DNA polymerase: the 507th site, the 543th site, the 551th site, the 742th site and the 664th site, and the amino acid sequence of the wild Taq DNA polymerase is as shown in SEQ ID NO: 75. The invention provides a novel mutant DNA (deoxyribonucleic acid) polymerase. Compared with a wild type DNA polymerase, the novel mutant DNA polymerase has higher inhibition resistance or higher dUTP (deoxyuridine triphosphate) doping capacity.

Provided is a kit for detecting multiple target nucleic acids capable of simultaneously amplifying and detecting multiple genes by means of one reaction vessel containing one kind of reaction solution and one kind of labels. Solution may contain first target nucleic acid (10) and second target nucleic acid (20) each of which dissociates at denaturation temperature T0. The solution further contains: DNA polymerase (30); a first target's primer (13) at annealing temperature T1 bonding with first single strands derived from the first target nucleic acid; a second target's primer (23) at annealing temperature T1 bonding with second single strands derived from the second target nucleic acid; a first target's probe (15) at annealing temperature T1 bonding with the first single strands derived from the first target nucleic acid; and a second target's probe (25) at second target detection temperature T3 which is lower than the annealing temperature T1 and elongation temperature T2 bonding with the second single strands derived from the second target nucleic acid. A condition that: T0 is higher than T2; T2 is not lower than T1; and T1 is higher than T3 is satisfied.

The invention discloses a hairpin template for detecting Bst DNA polymerase activity and application, a kit and a method thereof, and relates to the technical field of enzyme activity detection, and the nucleotide sequence of the hairpin template is as shown in SEQ ID No.1. The invention provides a specific hairpin template. The hairpin template has a stem-loop structure, is in a single-chain closed state when not amplified, is less combined with an embedded fluorescent nucleic acid dye, and has a lower background signal; when the Bst DNA polymerase is added, the enzyme has 5 '-> 3' DNA polymerase activity and strong strand displacement activity, the hairpin template can be self-triggered to amplify under the condition of no primer, the hairpin template is expanded and copied to form double-stranded DNA under the action of the Bst DNA polymerase, and the embedded fluorescent nucleic acid dye can be specifically combined with the double-stranded DNA to enhance a fluorescent signal of a system. The activity of the Bst DNA polymerase can be calculated according to the relationship between the double-stranded DNA and the fluorescence signal intensity.

This invention discloses a reaction tube for recombinase polymerase amplification (RPA), belonging to the field of nucleic acid detection. The reaction tube of this invention includes a tube body and a cap separate from the tube body. The tube body contains lyophilized bulbs or lyophilized powder containing premixed nucleic acid detection reagents, and the cap contains lyophilized powder containing an activator. The tube body and cap are sealed with a thin film. The lyophilized bulbs or lyophilized powder containing the premixed nucleic acid detection reagents include: recombinase, single-stranded DNA-binding protein, strand displacement DNA polymerase, buffer components, ATP, ATP regeneration components, and dNTPs. The lyophilized powder containing the activator includes: potassium ions, magnesium ions, and polyethylene glycol. This invention enables magnesium acetate to stably adhere to the cap, solving the problem of easy spillage of the lyophilized activator in the cap. In use, only the nucleic acid of the sample to be tested needs to be added; the operation is simple, easy to promote and apply, and suitable for batch detection.

The present disclosure relates to compounds of Formula (I):and to their prodrugs, pharmaceutically acceptable salts, pharmaceutical compositions, methods of use, and methods for their preparation. The compounds disclosed herein are useful for modulating DNA polymerase Θ activity and may be used in the treatment of disorders in which DNA polymerase Θ activity is implicated, such as cancer.

The invention discloses a reagent combination and a kit for detecting four respiratory tract pathogens based on qPCR, and belongs to the technical field of microbiological detection. Wherein the four respiratory tract pathogens are respectively human adenovirus, human bocavirus, bordetella pertussis and mycoplasma pneumoniae; the kit also comprises an optimized PCR (Polymerase Chain Reaction) buffer solution, DNA (Deoxyribose Nucleic Acid) polymerase and UDG enzyme. Through screening processes such as specific primer probe design, reagent formula and reaction system optimization, high sensitivity and high specificity are maintained while rapid detection is performed, and missing detection and misjudgment are effectively avoided.

The application discloses a single-cell mitochondrial whole-genome efficient and specific amplification method. The application provides a single-cell or multi-cell mitochondrial genome DNA high-fidelity amplification method, which comprises the following steps: taking total DNA obtained by lysing a test single cell as a template, using a chimeric primer composed of a 5' end non-template matching common sequence and a 3' end mitochondrial DNA (mtDNA) specific matching sequence, and a primer corresponding to the 5' end non-template matching common sequence of the chimeric primer, and using a high-fidelity DNA polymerase with strand displacement activity to simultaneously amplify several overlapping amplicons which completely cover the single-cell or multi-cell mitochondrial genome DNA. The application avoids various problems in the current single-cell mtDNA in-vitro amplification approach, and is a very reliable mtDNA whole-genome amplification method.

The invention discloses a Phi29 DNA polymerase mutant with improved thermal stability, a construction method of the Phi29 DNA polymerase mutant and a genetically engineered bacterium. The mutant is obtained by performing single-point mutation on serine at the 527th site on an amino acid sequence shown as SEQ ID NO.2. The invention further discloses a construction method of the Phi29 DNA polymerase mutant. The mutant is realized through a single-point mutation design, and compared with a wild type Phi29 DNA polymerase, the mutant shows better thermal stability in a temperature interval of 40-70 DEG C. The Phi29 DNA polymerase mutant obtained by means of the construction method provided by the invention has better thermal stability. When being used for DNA amplification operation at a relatively high temperature, the fluorescent probe can present relatively high thermal stability, so that the fluorescent probe has relatively high application value and development potential in multiple fields of molecular biology research, clinical diagnosis and the like.

The application discloses a hairpin probe for detecting DNA polymerase exonuclease activity and a preparation method and application thereof. The hairpin probe comprises a region a, a region b, a region c, a region d, a region e, a region f and a region g from the 5' end in sequence, wherein the region a and the region c are reversely complementary to each other, the 5' end of the region a is marked with a first fluorescent group, and the 3' end of the region a is marked with a first quenching group; the region e and the region g are reversely complementary to each other, the 5' end of the region g is marked with a second quenching group, and the 3' end of the region g is marked with a second fluorescent group; the first fluorescent group and the second fluorescent group are different from each other. The hairpin probe can be used for detecting the 3'-5' and 5'-3' exonuclease activity of the DNA polymerase separately or simultaneously in a single system, and has the advantages of simple operation steps, high throughput, good specificity, avoidance of radioactive pollution and excellent application prospect.