345 results about "DNA polymerase" patented technology

The invention discloses a kit for detecting miRNAs of multiple extracellular vesicles based on a TtAgo-driven rolling circle amplification technology and application of the kit, a platform combines TtAgo protein and RCA reaction, cooperates with endonuclease activity and DNA polymerase activity of TtAgo, accurately controls reaction kinetic balance between temperature and enzyme activity, not only does not damage the cutting activity of TtAgo, but also can detect miRNAs of multiple extracellular vesicles. The method provided by the invention can be used for detecting multiple extracellular vesicles miRNAs, ensures strong polymerization amplification performance, creates a strong one-step single-tube experiment, greatly simplifies the experimental process, shortens the detection time, realizes ultra-sensitive and specific detection of nucleic acid markers, and can be used for detecting multiple extracellular vesicles miRNAs.

The invention relates to the technical field of biology, in particular to a cis-trans typing method for drug-resistant gene mutation EGFR T790M / C797S. The invention provides an EGFR (Epidermal Growth Factor Receptor) T790M / C797S cis-trans typing method based on a locked nucleic acid LNA (Low Nucleic Acid) probe, ultrahigh-specificity DNA (Deoxyribose Nucleic Acid) polymerase and a primer probe combination. The typing method can be used for accurately distinguishing EGFR T790M / C797S double-mutation cis-configuration and trans-configuration; meanwhile, the kit has the advantages of high sensitivity, high specificity, simple steps and low cost, is suitable for detecting low-abundance samples such as circulating tumor DNA (ctDNA) and can meet the clinical rapid detection requirement.

The invention relates to the technical field of food safety detection, in particular to a food crop pathogenic mycotoxin detection method based on double signal amplification. The core of the method is a section of linear lock-type probe containing a mycotoxin specific nucleic acid aptamer, under the condition that target mycotoxin exists in a sample, the aptamer is combined with the mycotoxin, the probe is induced to generate conformational change, and the probe is closed into annular DNA under the catalysis of DNA ligase; then, the circular DNA is used as a template, isothermal rolling circle amplification is carried out through Phi29 DNA polymerase, and a long-chain DNA product containing a large number of repetitive sequences is generated; subsequently, the long-chain product is used as a molecular scaffold, and two kinds of gold nanoparticles of which the surfaces are modified with different complementary probes are cross-linked at the same time, so that the nanoparticles are quickly gathered, the color of the solution is changed from wine red to blue or purple, and convenient visual detection is realized. The method has the outstanding advantages of ultrahigh sensitivity, rapid detection and the like, and is suitable for on-site rapid screening of mycotoxin pollution.

The invention relates to an on-site synchronous quantitative determination method for three pathogenic bacteria in marine sediments, and belongs to the technical field of pathogenic bacteria detection.The three pathogenic bacteria are vibrio parahaemolyticus, vibrio alginolyticus and escherichia coli O157, and the method comprises the steps that marine sediment samples are collected and put into a centrifugal tube filled with sterile seawater, and are evenly mixed and centrifuged; taking the supernate as a template for LAMP amplification, respectively adding the supernate into detection tubes of an LAMP reaction system preloaded with the three pathogenic bacteria, and sealing. Placing the detection tube into a detection channel of a portable electronic isothermal gene amplification instrument, and determining a delta C4-t curve, a dv / dt-t curve and Tp; and after the determination is finished, substituting the Tp value into a working curve formula to calculate the content / concentration of the three pathogenic bacteria of the corresponding marine sediment sample in the detection tube. According to the method disclosed by the invention, Bst DNA polymerase and betaine are not needed in the reaction, so that the cost of LAMP analysis is reduced by at least 50%, the operation is simple and convenient, and simultaneous quantitative determination of the three pathogenic bacteria can be completed on site within 1h.

The invention provides a kit for detecting human BRAF gene V600E and TERT gene promoter mutation, and belongs to the technical field of biology. The kit comprises a primer, a probe, a 5 * PCR (Polymerase Chain Reaction)-Enhancer, a 10 * PCR Buffer, dNTP (Deoxyribonucleoside Triphosphate) Mix, MalTaq DNAPlyase, magnesium ions, DEPC (Diethylpyrocarbonate) water, a positive control and a negative control. According to the present invention, the ARMS-PCR detection technology is adopted to detect the specific gene mutation, and the target mutation site is identified by designing the specific primer and the probe, such that the detection specificity and the detection sensitivity are improved; by combining with a Taqman probe technology, the fluorescent signal change in the PCR amplification process can be monitored in real time, so that whether mutation of a BRAF V600E site, a TERT C228T site and a TERT C250T site exists or not is accurately judged; according to the method, pre-amplification of 15 cycles is adopted, then quantitative amplification of 30 cycles is adopted, and when the initial amount of the target DNA is very low, the copy number of the target DNA can be increased, so that the detection accuracy and sensitivity are further improved.

The invention discloses a method for detecting accessibility of space chromatin and application of the method. The method comprises the following steps: (1) slicing a tissue sample to be detected on a chip with spatial information; (2) fixing, permeabilizing and dyeing a tissue sample to be detected; (3) preparing fragmented genome DNA (deoxyribonucleic acid); (4) performing DNA hybridization based on a transfer mode; (5) carrying out connection and terminal repair reaction on the fragmented genome DNA by using DNA polymerase and DNA ligase; (6) denaturation and melting; and (7) sequencing. According to the method, the transcriptional activity state of chromatin can be reflected through chromatin accessibility sequencing analysis, staining imaging and chromatin accessibility information can be obtained on the same tissue slice at the same time without complex micro-fluidic equipment, experimental operation is easy, repeatability is high, and the analysis result is more remarkable.

The present disclosure provides an aptamer capable of inhibiting the activity of a strand-displacing DNA polymerase, the aptamer including: an oligonucleotide region 1 comprising a sequence in which a sequence X1a is linked to the 3'-end of a first sequence or the sequence X1a is linked to the 3'-end of a mutant sequence of the first sequence; and an oligonucleotide region 2 comprising a sequence in which a sequence X1b is linked to the 5'-end of a second sequence or the sequence X1b is linked to the 5'-end of a mutant sequence of the second sequence. The present disclosure also provides: a composition and a kit each containing the aptamer; and a method for amplifying a nucleic acid using the composition or the kit.

The invention relates to the technical field of biological detection, and discloses a method for double-ring detection of lung cancer L858R mutation based on CRISPR / Cas9 and DNA, and the method comprises the following steps: enriching circulating tumor cells CTC from a blood sample; extracting genomic DNA (deoxyribonucleic acid) of the enriched CTC; carrying out amplification on the DNA fragment containing the L858R mutation by adopting recombinase polymerase amplification RPA (recombinase polymerase amplification); the amplified DNA fragment is hybridized with a recognition ring in a DNA double-ring structure, a DNA double ring is composed of the recognition ring and a report ring, and a part of region of the recognition ring is hybridized with a corresponding fragment of the report ring to form a staggered double-chain region; when L858R mutation exists, the mutated DNA and a recognition ring are hybridized to activate a CRISPR / Cas9 system, and under the guidance of sgRNA, Cas9 cuts hybrid double strands and releases a report ring; carrying out rolling circle amplification RCA under the action of DNA polymerase by taking the released report ring as a template; a fluorescent probe is used for detecting an RCA amplification product, and whether L858R mutation exists or not is judged according to a fluorescence signal. The CRISPR / Cas9 system is combined with a DNA double-ring structure, so that the ultra-sensitive and specific detection on the lung cancer L858R mutation is realized.

The application discloses a kind of compositions, reagents and its detection method for high-throughput gene sequencing, belong to gene sequencing technical field, the composition includes Tris-HCl buffer 80-120 parts, potassium chloride 40-60 parts, ammonium sulfate 10-20 parts, magnesium chloride 15-25 parts, dNTPs mixed solution 30-50 parts, heat-stable DNA polymerase mutant 8-15 parts, PCR promoter complex 5-12 parts, modified iridium quinoline ketone complex 1-5 parts, glycerol 150-250 parts, Tween-20 1-3 parts, EDTA disodium salt 0.5-2 parts and nuclease-free ultrapure water, by introducing the modified iridium quinoline ketone complex of innovation, effectively solve the technical problems of low amplification efficiency, poor multiplex PCR reaction uniformity and high non-specific amplification background for high GC content, complex secondary structure genomic template, significantly improve the specificity of amplification, uniformity and the quality and reliability of final sequencing data.

The present invention discloses phi29 DNA polymerase mutants with improved performance, their preparation methods and applications, which relate to the field of biotechnology. Specifically, the present invention discloses phi29 DNA polymerase mutants that contain mutation sites Y163K, F181K, Y224K, W277K / W277P, Y298K, Y369K, Y439K, F526R relative to wild-type phi29 DNA polymerase; the amino acid sequence of the wild-type phi29 DNA polymerase is as shown in SEQ ID NO:1. Compared with the wild-type phi29 DNA polymerase, it has higher specific enzyme activity, stability and higher amplification efficiency, and has good application prospects in the fields of nucleic acid amplification and sequencing, etc.

The invention discloses a method for synthesizing millions of unique DNA tags through primer combination and application of the method, and relates to the field of molecular biology. According to the method, partial complementary pairing characteristics of F, X and Y primers are utilized, and under the synergistic effect of T4 DNA polymerase and ligase, millions of unique DNA tags are generated through one-time reaction through annealing-filling-ligation three-step reaction. The label structure comprises 5'end functional modification sites (such as amino and biotin) and a customizable sequencing joint, and is suitable for high-throughput labeling scenes such as single-cell multiomics, space proteomics and antibody coupling (AOC). Compared with a traditional one-by-one synthesis method, the method has the advantages that the single-tag synthesis cost is reduced by 80% or above, a reaction system is compatible with automatic operation, the tag combination complexity can reach 5.6 * 10 (based on 384 * 384 * 384 primer combination), and an efficient solution is provided for large-scale molecular marking.

The invention discloses a method for targeted enrichment of polymorphic sites by introducing thio-modified nucleic acid into a single base. According to the invention, the selector contains a segment of primer extension binding region with more than four basic groups, when the selector is extended by taking a target DNA / RNA as a template, single thio-modified dNTP and another three terminated dNTP / ddNTP, denaturation and renaturation are carried out, a hairpin structure is formed by itself, the selector without thio-modification is digested under the action of T4DNA polymerase, and then the target DNA / RNA is converted into the target DNA / RNA, and the target DNA / RNA is converted into the target DNA / RNA, and then the target DNA / RNA is converted into the target DNA / RNA, and the target DNA / RNA is converted into the target DNA / RNA, and the target DNA / RNA is converted into the target DNA / RNA. And complementing the sequence at the incision to form an intermediate product with a hairpin structure, so as to fulfill the aim of enriching rare mutation sites. The method is suitable for DNA and RNA templates, and the obtained hairpin ring structure intermediate can be subjected to signal amplification in two ways: enzyme-mediated nucleic acid amplification or PCR amplification after linearization of a ring structure.

The present invention relates to cells comprising an orthogonal DNA replication machine, linear plasmids replicable by said machine, uses of said cells and said linear plasmids, methods of maintaining linear plasmids in cells, methods of evolving sequences of interest, and methods of preparing polypeptides or nucleic acids. The invention also relates to error-prone DNA polymerases, nucleic acids encoding said polymerases and uses thereof.

Provided are a method for constructing a library based on an RNA sample and uses thereof. The method includes: step 1 of subjecting the RNA sample to a reverse transcription reaction to obtain DNA-RNA hybrid strands; step 2 of performing reaction of the DNA-RNA hybrid strands with an endoribonuclease, a first DNA polymerase, a second DNA polymerase, and dATPs to obtain a double-stranded DNA added with dA-tail, where the first DNA polymerase has a 5′-3′ exonuclease activity and a 3′-5′ exonuclease activity, and the second DNA polymerase has no 3′-5′ exonuclease activity; step 3 of ligating the double-stranded DNA added with dA-tail and a sequencing adaptor to obtain a ligated product; and step 4 of subjecting the ligated product to PCR amplification to obtain a sequencing library.

The present invention provides a method of stabilizing a phi29 DNA polymerase by contacting the phi29 DNA polymerase with a stabilized oligonucleotide that is free from degradation by a 3'exonuclease. The phi29 polymerase exhibits improved temperature stability in the presence thereof compared to the absence of the stabilized oligonucleotide. The method involves preparing a composition comprising a phi29 DNA polymerase and a stabilized oligonucleotide comprising one or more modified nucleotides. The compositions can be used in methods for performing polymerase reactions, nucleic acid replication, and detection of a target nucleic acid or target analyte in a sample. The compositions are particularly useful in rolling circle amplification reactions in which the targets are produced by proximity ligation assay, in particular cyclized lock probes.

The present disclosure relates to engineered DNA polymerase polypeptides and compositions thereof, and polynucleotides encoding the engineered DNA polymerase polypeptides. The present disclosure also provides methods of using the engineered DNA polymerase polypeptides, or compositions thereof, for diagnostic and other purposes.

The invention provides a CPA-LFD method for detecting Rahnella aquatilis and a detection kit, and belongs to the technical field of microbiological detection. On the basis of a single cross primer isothermal amplification technology (CPA) and in combination with a transverse flow test strip (LFD) prepared by colloidal gold, a real-time detection method for Rahnella aquatilis under the condition of 63 DEG C isothermal amplification is developed. According to the method, a specific primer is designed, and a probe containing Biotin and an FAM label is used for identifying a DNA specific region, so that rahnella aquatica is effectively detected within 1 hour; the optimized Bst DNA polymerase can be directly applied to isothermal amplification reaction of DNA, so that the detection process is simplified, and the time is shortened; the method is simple to operate, does not need to depend on professional detection personnel, has low requirements on instruments, realizes visual interpretation of detection results, has relatively high sensitivity and specificity, can detect Rahnella aquatica with the lower limit of 48fg / mu L, is suitable for rapid detection of Rahnella aquatica in human clinical samples, animals, fishes and food pollution, and can be widely applied to detection of Rahnella aquatica. The method has important significance on monitoring, diagnosis and epidemiological prevention and control of diseases caused by rahnella aquatica.

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

In an aspect, provided is a DNA polymerase with an amino acid sequence of at least 80% sequence identity with SEQ ID NO: 1 and having one or more amino acid substitution, wherein the one or more amino acid substitution is selected from the group consisting of A83S, N91I, R96H, R96C, M97V, G108D, G111V, R113H, V118S, S122N, L126I, P127L, A134T, D145V, D145N, D147V, H149R, H149L, Q171L, Q171S, I173V, L178K, I179L, Q180M, F181L, K182D, D186T, G197S, D200K, S215P, K220N, V222I, W232Y, M336L, D341K, D341I, D341L, S349R, S349G, T368Y, D398I, V399R, Q560H, and any combination of two or more of the foregoing. Also provided are a kit including the polymerase, a polynucleotide encoding the polymerase, a method of synthesizing a polynucleotide using the polymerase, and a method of sequence a polynucleotide synthesized by the polynucleotide.

A thermostable DNA polymerase mutant with high amplification activity. Using protein directed evolution technology, a random mutation library was constructed for the polymerase active domain targeting Taq enzyme. By gradually adding screening pressure, unsuitable mutations were naturally eliminated, and mutations with advantageous traits gradually accumulated. Finally, a series of amino acid sites and their mutations that play a key role in the amplification performance and polymerization performance of Taq enzyme were screened out, and a Taq enzyme mutant with high amplification performance was obtained.

The invention provides a DNA polymerase mutant and application thereof. Compared with a wild type KOD DNA polymerase, the DNA polymerase mutant has amino acid mutation at the 408th site, the 409th site or a functional equivalent site; and an amino acid mutation of at least one site selected from the following 23 sites and functional equivalence sites: 141 site, 143 site, 147 site, 383 site, 384 site, 389 site, 485 site, 584 site, 589 site, 397 site, 424 site, 432 site, 445 site, 523 site, 553 site, 561 site, 564 site, 461 site, 481 site, 605 site, 663 site, 711 site, and 725 site; the amino acid sequence except the amino acid mutation site of the mutant has at least 90% identity with the corresponding amino acid sequence of the wild type KODDNA polymerase; the wild type KOD DNA polymerase has an amino acid sequence as shown in SEQ ID NO: 2.

The invention discloses a CRISPR (clustered regularly interspaced short palindromic repeats) detection system integrating target chain amplification and crRNA synthesis into one tube, and belongs to the technical field of biosensing and molecular diagnosis. The system comprises an annular probe; the annular probe is amplified into double strands by phi29 DNA polymerase after being combined with a target, T7 RNA polymerase transcription is started to generate pre-crRNA, then the pre-crRNA is processed into mature crRNA by Cas12a, an ssDNA amplification product is recognized, an FQ reporter probe is cut, and a fluorescence signal is generated; wherein the sequence of the annular probe comprises a sequence complementary to a target chain, a single-chain T7 promoter sequence and a DNA sequence corresponding to a crRNA repetitive sequence. The detection platform integrates nucleic acid amplification and crRNA synthesis, real one-tube and one-step detection is realized, gRNA does not need to be additionally added, and the detection platform has the advantages of high sensitivity, high specificity, portability in operation and the like.

Provided is a conditional multiplex QPCR method. A QPCR amplification system, for each DNA sample, comprises a set of conditional primers 1 and 2. Forward conditional primers 1 and 2 are paired with a template strand, and reverse conditional primers 1 and 2 are paired with a complementary strand of the template strand. A conditional primer 2 is located downstream of a conditional primer 1, the 5' end of the conditional primer 2 is connected to an amplification primer of a DNA fragment to be detected, and the amplification primer is not paired with an upstream sequence of a binding site between the conditional primer 2 and the template strand. In the method, only when both the conditional primers 1 and 2 are bound to the template strand and the conditional primer 1 extends to the 5' end of the conditional primer 2, the DNA polymerase cleaves the amplification primer of the DNA fragment to be detected, which is free at the 5' end of the conditional primer 2, into an amplification system. The method reduces the possibility of unnecessary pairing between the amplification primer of the DNA fragment to be detected and other different DNA samples, thereby improving the specificity of the amplification reaction.

Provided are: a DNA polymerase mutant having reverse transcriptase activity, the DNA polymerase mutant including a sequence consisting of twelve specific amino acids A1-A12, wherein the DNA polymerase mutant having reverse transcriptase activity is characterized in that the A3 and / or A10 amino acid is substituted by a basic amino acid residue different from that prior to the introduction of mutation; a kit and a composition including the DNA polymerase; a method for producing the DNA polymerase; and a method for modifying an existing DNA polymerase having reverse transcriptase activity.

The invention relates to a helper adenovirus genome wherein expression of one or more of the adenoviral early E1 genes, E2 genes including DNA-binding protein (DBP), pre-terminal protein (pTP) and DNA polymerase, or production of functional proteins are regulated. The invention also relates to a process for delivery of the helper-dependent or gutless adenovirus vector genome and modulating replication of the helper virus DNA in the manufacturing cells, in which to allow a sufficient length of time before excision, cutting, or recombination to removal of the viral packaging signal DNA sequence from the helper adenovirus genome prior to induction of viral DNA replication, and expression of helper proteins that are required for adenovirus capsid particle formation and packaging, or encapsidation, of the helper-dependent or gutless adenovirus vector genomes, while preventing the packaging, or encapsidation, of the helper adenoviral genome into preform adenoviral capsids.

Provided is a recombinant B7 polymerase. The recombinant B7 polymerase has a sequence having at least 85% identity to the sequence of a wild-type B7 polymerase. The recombinant B7 polymerase comprises mutations corresponding to one or more positions of the sequence of the wild-type B7 polymerase, selected from the following: positions 169, 171, 441, 442, and 443. The recombinant B7 polymerase has DNA polymerase activity. The sequence of the wild B7 polymerase is as shown in SEQ ID NO: 1.

This invention discloses direct amplification qPCR reagents, kits, and applications for whole blood samples. The amplification reagents include: a composite hot-start DNA polymerase system, a buffer system, a surfactant, an anti-contamination system, and an anti-inhibition enhancer system. The composite hot-start DNA polymerase system is obtained by mixing antibody-modified hot-start Taq enzyme and antibody-modified Taq1C2 mutant Taq enzyme in a predetermined ratio. The buffer system includes Tris-HCl, MgCl2, (NH4)2SO4, and KCl. The surfactants include Tween-20 and NP-40. The anti-contamination system includes UDG enzyme and dNTPs, wherein the dNTPs are composed of dATP, dGTP, dCTP, dTTP, and dUTP. The anti-inhibition enhancer system includes D-trehalose, L-carnitine, DMSO, BSA, and SSB single-chain binding protein.

The present disclosure relates, in general terms, to directed evolution, and more specifically to compositions and methods for phage-assisted directed evolution in microbes. In one embodiment, there is provided a method for directed molecular evolution, the method comprising: a) introducing a propagation-defective phage vector into a first host cell (mutagenic host) competent to propagate the phage vector, wherein the first host cell comprises a gene construct of interest (GOI) to be evolved; and wherein the phage vector allows for (i) expression of an error-prone DNA polymerase in the first host cell for mutagenesis, and (ii) replication and packaging of the GOI into infectious phage particles; b) incubating the first host cell under conditions for replication and mutagenesis of the GOI and release of phage particles comprising mutated GOIs; c) infecting a second host cell (selection host) with phage particles from step b); and d) selecting for a desirable function of the GOI in the second host cell.

The invention is applicable to the technical field of agricultural microbiological detection, and provides an RPA-CRISPR / Cas12a primer, a kit and a rapid detection method for detecting curvularia tritici, and the RPA-CRISPR / Cas12a primer comprises an upstream primer RPA-F of RPA, a downstream primer RPA-R of RPA, a crRNA primer, a universal primer Univ and a probe FB. The kit comprises the primer, Cas12a protein, T7 transcriptase, DNA polymerase, a buffer solution and a Cas12 / 13 special nucleic acid detection test strip. After sample DNA is extracted, isothermal amplification is performed for 20 min at 37 DEG C in an RPA reaction system; and adding the RPA product into a CRISPR / Cas12a reaction system containing crRNA to react for 20 minutes, and detecting the cut product through a Cas12 / 13 special nucleic acid detection test strip. The method has the advantages of strong detection specificity, high sensitivity, short time consumption and simple operation.