13 results about "Polymorphism Detection" patented technology

This invention relates to the field of medical testing technology, and particularly to primer-probe combinations and kits. This invention provides a method and kit for rapid detection of human CYP2C19 gene polymorphism, specifically involving specific primers, probes, and kits for gene polymorphism detection. The primers and probes include CYP2C19*2 primers and probes, CYP2C19*3 primers and probes, CYP2C19*17 primers and probes, and internal control primers and probes. The primers, probes, and kits of this invention are characterized by high specificity, high sensitivity, and simple operation, and can accurately detect genomic DNA at concentrations as low as 0.1 ng / μL. This invention also provides a detection kit containing specific primers, probes, dNTPs, rTth enzyme, and UDG enzyme for CYP2C19 gene polymorphism detection.

The invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker related to early maturing traits of upland cotton and application of the molecular marker, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO.2. According to the polymorphic detection of the invention, the InDel marker rsGhiA08116154578 located on the chromosome A08 shows obvious difference in four characters in the seven premature characters of the upland cotton, and a natural population material carrying HAP2 has stronger premature performance. Furthermore, the molecular marker is verified in 43 randomly selected samples, and the result shows that the molecular marker has high accuracy in natural groups and has the potential of being developed into a laboratory or an outdoor rapid detection tool.

The invention relates to the technical field of plant breeding, in particular to a molecular marker related to high temperature resistance of plants and application of the molecular marker. The molecular marker is selected from one of M92, M94 or M97. The application comprises the following steps: (1) predicting or detecting the high temperature resistance of the plant; (2) identifying or cultivating a high-temperature-resistant plant variety; (3) carrying out molecular marker-assisted breeding on plants; (4) improving plant varieties related to high temperature resistance; and (5) plant germplasm resource improvement. The molecular markers related to the high-temperature resistance of the plant are researched and screened, and the high-temperature resistance of the plant can be identified through polymorphism detection of the molecular markers. The molecular marker provided by the invention can be used for breeding high-temperature-resistant plant varieties, and has important application value in the field of plant breeding.

The invention relates to a capture probe group, a kit and a method for detecting hepatobiliary tumor genetic susceptibility gene polymorphism, and belongs to the technical field of biology. The nucleotide sequences of the capture probe group provided by the invention are as shown in SEQ ID NO. 1 to SEQ ID NO. 445; the hepatobiliary tumor genetic susceptibility gene comprises at least one of APC, ATM, ATR, BAP1, BRCA1, BRCA2, FANCA, MLH1, MSH2, MSH6, PALB2, PMS2 and RAD51D. The invention also provides a kit containing the capture probe group and a detection method. The method has the advantages that the coverage area is wide, the embryonic line variation of all exon areas can be detected, the designed capture probe covers the full coding area sequence of the related gene, the coverage degree of the target area reaches 100%, and the average sequencing depth reaches 100 *.

This invention relates to the field of agricultural technology, specifically providing a specific primer pair for identifying hybrid offspring of wild rice, cultivated rice, and cultivated rice and wild rice, and its application. Genomic DNA is extracted from rice leaves. Using this DNA as a template and the sequences corresponding to SEQ ID NO:3 and SEQ ID NO:4 as specific primers, PCR amplification is performed to obtain amplified fragments. After electrophoresis, fragments showing only a 146 bp major band are identified as wild rice, while those showing only a 155 bp major band are identified as cultivated rice. Fragments that simultaneously amplify both 155 bp and 146 bp fragments are identified as hybrid offspring of cultivated rice and wild rice. This invention can be applied to molecular marker detection and polymorphism detection in hybrid populations of wild rice and cultivated rice, facilitating rapid screening in distant hybridization breeding and improving breeding efficiency.

The invention relates to the technical field of agriculture, and particularly provides a primer pair for detecting oryza longistaminata, cultivated rice and filial generation of the cultivated rice and the oryza longistaminata and application of the primer pair. The primer pair is used for PCR amplification, and if a 196bp band is amplified from rice to be detected, the rice is identified as indica type cultivated rice; if a 181bp band is amplified from the to-be-detected rice, identifying the to-be-detected rice as japonica type cultivated rice; if a 176 bp band is amplified from the to-be-detected rice, identifying the to-be-detected rice as oryza longistaminata; if stripes of 196 bp and 176 bp fragments can be amplified at the same time, the hybrid rice is a filial generation of indica rice and oryza longistaminata; and if the bands of the 181 bp and 176 bp fragments can be amplified simultaneously, determining that the primers are filial generations of the japonica rice and the oryza longistaminata. The method can be applied to molecular marker detection analysis and polymorphism detection of hybrid population of oryza longistaminata and cultivated rice, assists rapid screening in distant hybridization breeding, and improves the breeding efficiency.

The application discloses an IRAP molecular marker developed based on a blueberry reverse transcription transposon sequence and application thereof, and an IRAP molecular marker primer library contains at least one pair of the following primers: primer pair LRT1-42 (CTTTA TGAAGCCGACATACCTGATT) and LRT1-26 (AAGACATAGGTTATCTTGGTTCTAA ACC); primer pair LRT1-38 (CATGGCTTTGAGAAACCTGTCAAA) and LTR1-53 (AT CTCCAAGATGAAGTATATATGGAGCAAC); and primer pair LTR1-59 (AAGATCAAAAAA CATTCAGATGGGTCTATAG) and LRT1-19 (TGTCAATCCCTGTAACGACAATATCA); wherein the proportion of polymorphic sites of the primer library is greater than or equal to 98.7 %, and the specific fingerprint of the blueberry germplasm can be generated through PCR amplification. The technology can significantly improve the efficiency of blueberry germplasm polymorphism detection (the proportion of polymorphic sites is greater than or equal to 98.7 %), fills the blank of the domestic blueberry IRAP molecular marker technology, and provides an efficient and accurate technical scheme for the genetic diversity evaluation, kinship identification and molecular marker assisted breeding of blueberry germplasm resources.

The invention provides a human venous thrombosis risk gene polymorphism detection primer probe composition as well as preparation and application thereof, and belongs to the technical field of nucleic acid detection methods. The primer probe composition comprises the following sequences: a primer pair PAI-1-F and PAI-1-R which are used for detecting the PAI-14G / 5G site and are respectively shown as SEQ ID NO: 1 and SEQ ID NO: 2, and a probe PAI-1-P of which the sequence is shown as SEQ ID NO: 3; the probe is used for detecting PROCc.565Cgt; the primer pair of the T site PROC (565 Cgt; t)-F and PROC (565 Cgt; the invention relates to a kit for detecting the content of procyanidine, in particular to a kit for detecting the content of procyanidine, which comprises a probe PROC (565Cgt, T)-R and a probe PROC (565Cgt; t)-P, the sequence of which is as shown in SEQ ID NO: 6; the detection kit is used for detecting MTHFRc.677Cgt; the sequences of the primer pair MTHFR-F and MTHFR-R of the T site are respectively shown as SEQIDNO: 7 and SEQIDNO: 8, and the sequence of the probe MTHFR-P is shown as SEQIDNO: 9; wherein the 5'end of the probe is marked with a fluorophore, the 3 'end of the probe is marked with a quenching group, and the first three basic groups are modified by phosphoric acid. The kit is high in detection sensitivity.

The invention relates to the technical field of agriculture, and particularly provides a specific primer pair for identifying oryza longistaminata, oryza sativa, and filial generation of oryza sativa and oryza longistaminata and application of the specific primer pair. Selecting leaves of rice, extracting genome DNA of the tissues, and performing PCR amplification by taking the DNA of the tissues as a template and taking corresponding sequences of SEQ ID NO: 3 and SEQ ID NO: 4 as specific primers to obtain amplified fragments; after the amplified fragments are subjected to electrophoresis, only one 146bp main band is the oryza longistaminata, only one 155bp main band is cultivated rice, bands of 155bp and 146bp fragments can be amplified at the same time, and the oryza longistaminata is a filial generation of the cultivated rice and the oryza longistaminata. The method can be applied to molecular marker detection analysis and polymorphism detection of hybrid population of oryza longistaminata and cultivated rice, assists rapid screening in distant hybridization breeding, and improves the breeding efficiency.

The application provides a composite amplification system, a kit and a detection method for anesthetic drug-related gene polymorphism detection, and relates to the technical field of drug gene detection.The application designs a series of specific primer compositions and a composite amplification system shown in sequences SEQ ID NO.1-133 for 44 SNP sites corresponding to 24 drugs in 7 categories;the kit obtained by using the primer composition or the composite amplification system has very high sensitivity for the 44 SNP sites related to anesthetic drugs, the detection result is accurate, and the kit can be consistent with the gold standard;at the same time, the kit and the detection method provided by the application support blood or blood card direct filling, do not need to pretreat the sample to be detected, can directly obtain the detection result, the operation steps are simple, the time consumption is short, can greatly reduce the cost, has the advantages of high sensitivity, high resolution, high throughput and the like.Using the application, the genotyping of the patient to the related anesthetic drug can be quickly and accurately obtained, the adverse reaction and toxicity warning, the efficacy evaluation and other evaluations of the patient to the anesthetic drug are realized, more gene reference information of the patient is provided for the clinician, and effective evaluation indexes are provided for the individual use of the anesthetic drug.

The invention relates to the technical field of molecular biotechnology and gene detection, in particular to a convenient CYP2C19 gene polymorphism detection kit. The invention provides a kit comprising primers and probes as shown in SEQ ID NO: 1-17, the kit is presented in the form of a fully premixed freeze-dried strip, is suitable for detection of fingertip blood samples and oral cavity swab samples, and can detect genotypes including CYP2C19 * 2, CYP2C19 * 3 and CYP2C19 * 17. The reagent exists in a dry powder state, so that the stability of the reagent is enhanced, the reagent can be stored and transported at normal temperature, the operation process is simplified, the use difficulty of an operator is reduced, and pollution is effectively avoided.

Disclosed are a targeted capture sequencing-based 10K low-density SNP array for dairy cattle and a use thereof. Provided is a 10K low-density array for detecting genotypes of dairy cattle, comprising: single-stranded nucleotide probes for specifically detecting 11352 SNP sites and 6 INDEL sites on a dairy cattle genome (mainly comprising three types: sites related to important traits of dairy cattle, parentage testing and genetic defect sites, and sites selected from existing commercial dairy cattle genome arrays). Compared with existing high-density arrays, the provided 10K low-density genomic array has lower detection costs, and has detection performance such as SNP detection rate, polymorphism detection, individual genotype detection rate, and genetic evaluation accuracy consistent with that of the high-density arrays. The array can be applied to genomic selection and genetic defect identification of dairy cattle, and has important significance on early breeding of replacement heifers, establishment of cow nucleus herd, selection and matching, acceleration of genetic progress and improvement of feed management efficiency.

The invention relates to a KASP molecular marker associated with erigeron breviscapus erigoster B and application of the KASP molecular marker, and belongs to the technical field of genetic engineering. The primers of the KASP molecular marker associated with Erigeron breviscapus Erigeron ester B comprise a forward primer 1, a forward primer 2 and a common reverse primer; the nucleotide sequence of the forward primer 1 is as shown in SEQ ID NO. 1; the nucleotide sequence of the forward primer 2 is as shown in SEQ ID NO. 2; the nucleotide sequence of the common reverse primer is as shown in SEQ ID NO.3. The SNP site closely related to the content of the erigoster B in the plant is successfully identified through phenotypic difference analysis and re-sequencing technologies, and the medicinal component content of the erigoster B in the plant can be accurately and rapidly evaluated through polymorphic detection of the site.