27 results about "Polymorphism Detection" patented technology

The invention belongs to the field of SNP (Single Nucleotide Polymorphism) detection, and particularly provides an SNP molecular marker related to a sheep body length character, application of the SNP molecular marker and a kit for detecting the SNP molecular marker. The kit provided by the invention is used for performing polymorphism detection on the SNP molecular genetic marker, namely the 92690768th site of the No.4 chromosome, screening and determining the sheep body length character, and selecting the body length character to breed or assist to breed a long sheep individual with the body length character, so that a Tibetan sheep variety germplasm resource with high-quality body length character can be collected, and the kit has a very good application prospect.

The application discloses a molecular marker, a primer, a detection method and application related to pig muscle fiber, rib number and back fat thickness, and relates to the technical field of molecular markers. The molecular marker is located in a MYLPF gene, and a sequence of the molecular marker is shown as SEQ ID NO: 4. The sequence is located at a first exon of a 202 transcript of the MYLPF gene, and is used for detecting SNP site mutation. The application determines a cause mutation affecting the circumference, area of pig muscle fiber, rib number and average back fat thickness by using a MYLPF gene promoter constructed to replace a double luciferase reporter vector. A specific primer is designed on the mutation site of the promoter and amplification is performed. The site is detected for polymorphism by using a restriction endonuclease NlaIII. According to the result of the polymorphism detection, differences in the circumference, area of muscle fiber, rib number and average back fat thickness among pig individuals are distinguished, and a large population scale sampling and determination is not needed.

The invention relates to an SSR primer for identifying bromegrass and application of the SSR primer. The primer composition for amplifying the SSR molecular marker of the bromegrass, provided by the invention, consists of primers as shown in SEQ ID NO: 23 to SEQ ID NO: 66. Experiments prove that the primer combination of the SSR marker provided by the invention has strong polymorphism detection capability, and the average polymorphism ratio (PIC) is 0.583. The invention provides a favorable tool for detecting the genetic diversity of the bromegrass, and has important significance for solving the problems of prevention and control of the bromegrass and the like.

The utility model relates to the field of kits, and discloses a polymorphic detection kit with an amplification function, which comprises a kit body, a cover plate is detachably mounted at the top end of the outer wall of the kit body through a buckle, a rotating door is arranged on the surface of the kit body, an insertion block is elastically connected to the inner wall of the cover plate through a reset spring, and the inner wall of the insertion block is provided with an amplification function. A moving plate is slidably connected to the inner wall of the inclined face of the triangular block, multiple sets of telescopic rods are fixedly connected to the surface of the rotating column, and positioning assemblies are arranged on the outer walls of the telescopic rods. According to the utility model, the pressing rod, the triangular block and the moving plate in the pushing mechanism interact with each other, when a reagent needs to be taken out, the pressing rod is pressed to push a kit in the placing barrel to be pushed outwards from the rotating door, the operation is simple and rapid, and the convenient reagent taking mode greatly shortens the detection preparation time, improves the detection efficiency and reduces the labor intensity of workers. The method is especially suitable for large-scale detection or emergency detection scenes.

The invention discloses a hypertensive drug gene polymorphism multi-joint detection primer group, a detection method and a kit, and relates to the technical field of molecular diagnosis, the hypertensive drug gene polymorphism multi-joint detection primer group comprises multiple pairs of primers corresponding to each target, and the multiple pairs of primers comprise a first type of primer group and a second type of primer group; the first type of primer group comprises a first upstream primer, a first downstream primer, a wild type fluorescent probe and a mutant type fluorescent probe, the 5'end of the fluorescent probe is marked with a fluorescent reporter group, and the 3 'end of the fluorescent probe is marked with a fluorescent quenching group; the second type of primer group comprises a second upstream primer and a second downstream primer, and the second upstream primer or the second downstream primer is marked with a fluorescence reporter group and a fluorescence quenching group. The application has the effects of improving the detection flux of the gene polymorphism of the hypertensive drug and reducing the interpretation complexity.

This invention relates to the field of medical testing technology, and particularly to primer-probe combinations and kits. This invention provides a method and kit for rapid detection of human CYP2C19 gene polymorphism, specifically involving specific primers, probes, and kits for gene polymorphism detection. The primers and probes include CYP2C19*2 primers and probes, CYP2C19*3 primers and probes, CYP2C19*17 primers and probes, and internal control primers and probes. The primers, probes, and kits of this invention are characterized by high specificity, high sensitivity, and simple operation, and can accurately detect genomic DNA at concentrations as low as 0.1 ng / μL. This invention also provides a detection kit containing specific primers, probes, dNTPs, rTth enzyme, and UDG enzyme for CYP2C19 gene polymorphism detection.

The invention relates to the technical field of molecular biology, and discloses a wheat SRAP fingerprint spectrum construction method which comprises the following steps: S1, collecting a leaf sample of a wheat variety to be detected, and extracting genome DNA; s2, carrying out PCR (Polymerase Chain Reaction) amplification on the extracted DNA by using an SRAP primer combination, wherein the SRAP primer combination comprises a primer pair m2e5, bm9e5, m8e5 and m1e2; and S3, carrying out electrophoretic separation on a PCR amplification product, and detecting and recording an amplification band. According to the construction method of the wheat SRAP fingerprint spectrum, four pairs of (m < 2 > e5, b < m > 9e5, m < 8 > e5 and m < 1 > e2) core SRAP primer combinations are systematically screened from 96 pairs of universal primers and finally determined; and S4, converting the existence of the strip into a binary data matrix. The combination has high detection efficiency on the polymorphism of 44 Hetao spring wheat materials, accumulatively generates 233 polymorphic bands, the average polymorphism percentage reaches 73.72%, the 44 materials can be completely distinguished by 100% only by using 4 pairs of primers, and the distinguishing effect of the combination is obviously superior to that of an SSR marker which generally needs more primers.

The invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker related to early maturing traits of upland cotton and application of the molecular marker, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO.2. According to the polymorphic detection of the invention, the InDel marker rsGhiA08116154578 located on the chromosome A08 shows obvious difference in four characters in the seven premature characters of the upland cotton, and a natural population material carrying HAP2 has stronger premature performance. Furthermore, the molecular marker is verified in 43 randomly selected samples, and the result shows that the molecular marker has high accuracy in natural groups and has the potential of being developed into a laboratory or an outdoor rapid detection tool.

The invention relates to the technical field of plant breeding, in particular to a molecular marker related to high temperature resistance of plants and application of the molecular marker. The molecular marker is selected from one of M92, M94 or M97. The application comprises the following steps: (1) predicting or detecting the high temperature resistance of the plant; (2) identifying or cultivating a high-temperature-resistant plant variety; (3) carrying out molecular marker-assisted breeding on plants; (4) improving plant varieties related to high temperature resistance; and (5) plant germplasm resource improvement. The molecular markers related to the high-temperature resistance of the plant are researched and screened, and the high-temperature resistance of the plant can be identified through polymorphism detection of the molecular markers. The molecular marker provided by the invention can be used for breeding high-temperature-resistant plant varieties, and has important application value in the field of plant breeding.

The invention relates to a capture probe group, a kit and a method for detecting hepatobiliary tumor genetic susceptibility gene polymorphism, and belongs to the technical field of biology. The nucleotide sequences of the capture probe group provided by the invention are as shown in SEQ ID NO. 1 to SEQ ID NO. 445; the hepatobiliary tumor genetic susceptibility gene comprises at least one of APC, ATM, ATR, BAP1, BRCA1, BRCA2, FANCA, MLH1, MSH2, MSH6, PALB2, PMS2 and RAD51D. The invention also provides a kit containing the capture probe group and a detection method. The method has the advantages that the coverage area is wide, the embryonic line variation of all exon areas can be detected, the designed capture probe covers the full coding area sequence of the related gene, the coverage degree of the target area reaches 100%, and the average sequencing depth reaches 100 *.

This invention relates to the field of agricultural technology, specifically providing a specific primer pair for identifying hybrid offspring of wild rice, cultivated rice, and cultivated rice and wild rice, and its application. Genomic DNA is extracted from rice leaves. Using this DNA as a template and the sequences corresponding to SEQ ID NO:3 and SEQ ID NO:4 as specific primers, PCR amplification is performed to obtain amplified fragments. After electrophoresis, fragments showing only a 146 bp major band are identified as wild rice, while those showing only a 155 bp major band are identified as cultivated rice. Fragments that simultaneously amplify both 155 bp and 146 bp fragments are identified as hybrid offspring of cultivated rice and wild rice. This invention can be applied to molecular marker detection and polymorphism detection in hybrid populations of wild rice and cultivated rice, facilitating rapid screening in distant hybridization breeding and improving breeding efficiency.

The invention relates to the technical field of agriculture, and particularly provides a primer pair for detecting oryza longistaminata, cultivated rice and filial generation of the cultivated rice and the oryza longistaminata and application of the primer pair. The primer pair is used for PCR amplification, and if a 196bp band is amplified from rice to be detected, the rice is identified as indica type cultivated rice; if a 181bp band is amplified from the to-be-detected rice, identifying the to-be-detected rice as japonica type cultivated rice; if a 176 bp band is amplified from the to-be-detected rice, identifying the to-be-detected rice as oryza longistaminata; if stripes of 196 bp and 176 bp fragments can be amplified at the same time, the hybrid rice is a filial generation of indica rice and oryza longistaminata; and if the bands of the 181 bp and 176 bp fragments can be amplified simultaneously, determining that the primers are filial generations of the japonica rice and the oryza longistaminata. The method can be applied to molecular marker detection analysis and polymorphism detection of hybrid population of oryza longistaminata and cultivated rice, assists rapid screening in distant hybridization breeding, and improves the breeding efficiency.

The application discloses an IRAP molecular marker developed based on a blueberry reverse transcription transposon sequence and application thereof, and an IRAP molecular marker primer library contains at least one pair of the following primers: primer pair LRT1-42 (CTTTA TGAAGCCGACATACCTGATT) and LRT1-26 (AAGACATAGGTTATCTTGGTTCTAA ACC); primer pair LRT1-38 (CATGGCTTTGAGAAACCTGTCAAA) and LTR1-53 (AT CTCCAAGATGAAGTATATATGGAGCAAC); and primer pair LTR1-59 (AAGATCAAAAAA CATTCAGATGGGTCTATAG) and LRT1-19 (TGTCAATCCCTGTAACGACAATATCA); wherein the proportion of polymorphic sites of the primer library is greater than or equal to 98.7 %, and the specific fingerprint of the blueberry germplasm can be generated through PCR amplification. The technology can significantly improve the efficiency of blueberry germplasm polymorphism detection (the proportion of polymorphic sites is greater than or equal to 98.7 %), fills the blank of the domestic blueberry IRAP molecular marker technology, and provides an efficient and accurate technical scheme for the genetic diversity evaluation, kinship identification and molecular marker assisted breeding of blueberry germplasm resources.

The invention provides a human venous thrombosis risk gene polymorphism detection primer probe composition as well as preparation and application thereof, and belongs to the technical field of nucleic acid detection methods. The primer probe composition comprises the following sequences: a primer pair PAI-1-F and PAI-1-R which are used for detecting the PAI-14G / 5G site and are respectively shown as SEQ ID NO: 1 and SEQ ID NO: 2, and a probe PAI-1-P of which the sequence is shown as SEQ ID NO: 3; the probe is used for detecting PROCc.565Cgt; the primer pair of the T site PROC (565 Cgt; t)-F and PROC (565 Cgt; the invention relates to a kit for detecting the content of procyanidine, in particular to a kit for detecting the content of procyanidine, which comprises a probe PROC (565Cgt, T)-R and a probe PROC (565Cgt; t)-P, the sequence of which is as shown in SEQ ID NO: 6; the detection kit is used for detecting MTHFRc.677Cgt; the sequences of the primer pair MTHFR-F and MTHFR-R of the T site are respectively shown as SEQIDNO: 7 and SEQIDNO: 8, and the sequence of the probe MTHFR-P is shown as SEQIDNO: 9; wherein the 5'end of the probe is marked with a fluorophore, the 3 'end of the probe is marked with a quenching group, and the first three basic groups are modified by phosphoric acid. The kit is high in detection sensitivity.

The invention relates to the technical field of agriculture, and particularly provides a specific primer pair for identifying oryza longistaminata, oryza sativa, and filial generation of oryza sativa and oryza longistaminata and application of the specific primer pair. Selecting leaves of rice, extracting genome DNA of the tissues, and performing PCR amplification by taking the DNA of the tissues as a template and taking corresponding sequences of SEQ ID NO: 3 and SEQ ID NO: 4 as specific primers to obtain amplified fragments; after the amplified fragments are subjected to electrophoresis, only one 146bp main band is the oryza longistaminata, only one 155bp main band is cultivated rice, bands of 155bp and 146bp fragments can be amplified at the same time, and the oryza longistaminata is a filial generation of the cultivated rice and the oryza longistaminata. The method can be applied to molecular marker detection analysis and polymorphism detection of hybrid population of oryza longistaminata and cultivated rice, assists rapid screening in distant hybridization breeding, and improves the breeding efficiency.

The embodiment of the invention provides a hereditary tumor nucleotide polymorphism detection method and device and a storage medium, and the method comprises the following steps: obtaining a read sequence and a reference sequence; the reading sequence and the reference sequence are input into a first detection tool and a second detection tool respectively, and a detection method of the first detection tool is based on a second-generation detection technology and comprises the step of reserving a soft shearing sequence and a repetitive sequence; the second detection tool is based on a third-generation detection technology; and combining the detection results of the first detection tool and the second detection tool to obtain a variation detection result. The problem that defects exist in a second-generation detection technology and a third-generation detection technology in the prior art is solved.

The application provides a composite amplification system, a kit and a detection method for anesthetic drug-related gene polymorphism detection, and relates to the technical field of drug gene detection.The application designs a series of specific primer compositions and a composite amplification system shown in sequences SEQ ID NO.1-133 for 44 SNP sites corresponding to 24 drugs in 7 categories;the kit obtained by using the primer composition or the composite amplification system has very high sensitivity for the 44 SNP sites related to anesthetic drugs, the detection result is accurate, and the kit can be consistent with the gold standard;at the same time, the kit and the detection method provided by the application support blood or blood card direct filling, do not need to pretreat the sample to be detected, can directly obtain the detection result, the operation steps are simple, the time consumption is short, can greatly reduce the cost, has the advantages of high sensitivity, high resolution, high throughput and the like.Using the application, the genotyping of the patient to the related anesthetic drug can be quickly and accurately obtained, the adverse reaction and toxicity warning, the efficacy evaluation and other evaluations of the patient to the anesthetic drug are realized, more gene reference information of the patient is provided for the clinician, and effective evaluation indexes are provided for the individual use of the anesthetic drug.

The application discloses a low-density SNP chip for dairy cattle based on targeted capture sequencing and application thereof. The application provides a chip for detecting the genotype of a dairy cattle, which comprises: reagents for specifically detecting SNP sites; the SNP sites are 44373 SNP sites in Table 2; the position information of the 44373 SNP sites in Table 2 is determined by alignment based on a dairy cattle genome reference sequence, and the dairy cattle genome reference sequence is Bos taurus UMD3.1 version. Compared with existing 30K, 126K and 150K chips, the 40K chip of the application has consistent detection performance in terms of SNP detection rate, polymorphism detection, individual genotype detection rate, genetic evaluation accuracy and the like. The chip of the application can be applied to whole genome selection of dairy cattle and genetic defect identification, and has important significance for early selection and breeding of reserve dairy cattle, establishment of a core group of dairy cows, selection and matching, and acceleration of genetic progress and improvement of feed management efficiency.

The application relates to the technical field of bee breeding, and particularly relates to a SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in identifying a honeybee tibia length character. The SNP molecular marker is located at the 8751308th position of a 14th chromosome of the honeybee, and the polymorphism is T / C. Based on the whole genome correlation analysis result of the honeybee sample data, the application screens a SNP molecular marker which is very relevant to the honeybee tibia length character. The polymorphism detection result of the SNP molecular marker can reflect the tibia length of the honeybee to be detected. The SNP molecular marker provided by the application can be applied to breeding honeybee species with different tibia lengths, is favorable to improving the pollen collection efficiency of the honeybee, and has important value.

The invention relates to the technical field of molecular biotechnology and gene detection, in particular to a convenient CYP2C19 gene polymorphism detection kit. The invention provides a kit comprising primers and probes as shown in SEQ ID NO: 1-17, the kit is presented in the form of a fully premixed freeze-dried strip, is suitable for detection of fingertip blood samples and oral cavity swab samples, and can detect genotypes including CYP2C19 * 2, CYP2C19 * 3 and CYP2C19 * 17. The reagent exists in a dry powder state, so that the stability of the reagent is enhanced, the reagent can be stored and transported at normal temperature, the operation process is simplified, the use difficulty of an operator is reduced, and pollution is effectively avoided.

Disclosed are a targeted capture sequencing-based 10K low-density SNP array for dairy cattle and a use thereof. Provided is a 10K low-density array for detecting genotypes of dairy cattle, comprising: single-stranded nucleotide probes for specifically detecting 11352 SNP sites and 6 INDEL sites on a dairy cattle genome (mainly comprising three types: sites related to important traits of dairy cattle, parentage testing and genetic defect sites, and sites selected from existing commercial dairy cattle genome arrays). Compared with existing high-density arrays, the provided 10K low-density genomic array has lower detection costs, and has detection performance such as SNP detection rate, polymorphism detection, individual genotype detection rate, and genetic evaluation accuracy consistent with that of the high-density arrays. The array can be applied to genomic selection and genetic defect identification of dairy cattle, and has important significance on early breeding of replacement heifers, establishment of cow nucleus herd, selection and matching, acceleration of genetic progress and improvement of feed management efficiency.

The present invention discloses a multivalent double lock and key system based on chain displacement reaction and its application in nucleotide polymorphism detection, which is used for highly specific and rapid nucleotide polymorphism determination. The system can only be defined as "On" state when the target is introduced as the only "key" and two matching operations are performed to activate the two fulcrum-mediated chain displacement reactions respectively, and the system remains in "Off" state in the absence of any step. Most importantly, this two-time matching strategy using two different target fragments as input provides an effective method for simultaneously distinguishing single nucleotide polymorphisms and double nucleotide polymorphisms. The mutant bases at different positions are even far apart from each other. This double lock design has stronger discrimination ability than the ordinary single lock system. The stable performance of the Multi-DLK system in serum and the final application of real sample determination in cancer cells show the potential of this platform in clinical diagnosis.

The invention discloses a fluorescent quantitative qPCR (quantitative polymerase chain reaction) method for detecting CAR (chimeric antigen receptor) copy number by using EF1 alpha gene promoter polymorphism, which comprises the following steps: S1, performing sequence alignment on an engineered EF1 alpha promoter fragment and a wild type EF1 alpha gene promoter fragment, and designing a fluorescent quantitative qPCR primer in a conserved region on two sides of a mutation site, a first fluorescent probe is designed in a conserved region of two DNA sequences wtEF1 alpha PF and enEF1 alpha PF, and is used for simultaneously detecting wild type and engineered EF1 alpha promoter fragments, namely a total EF1 alpha promoter fragment; a second fluorescent probe is designed on a mutation site of wtEF1 alpha FP and is used for independently detecting a wtEF1 alpha PF promoter fragment as an internal reference. The invention belongs to the technical field of fluorescent quantitative qPCR (quantitative polymerase chain reaction), and particularly relates to a fluorescent quantitative qPCR method for detecting the copy number of CAR (chimeric antigen receptor) by using EF1 alpha gene promoter polymorphism, which effectively simplifies the operation steps and fundamentally avoids the possibility of mutual interference of multiple fluorescent quantitative qPCR amplification on experimental results.

The application discloses a molecular marker related to intramuscular fat content and meat color traits of pigs and application thereof, and belongs to the technical field of molecular markers. It is found by the application that a 2279bp insertion structural variation exists in the 9th exon region of FMO3 gene, and three types of genotypes, homozygous insertion (AA), homozygous non-insertion (WW) and heterozygosity (AW), exist in the gene locus through polymorphism detection in a Beijing black pig population. Correlation analysis of the three genotypes and meat quality traits of the Beijing black pig shows that the intramuscular fat content of the WW genotype is significantly higher than that of the AA genotype and the AW genotype, and the meat color trait of the AA genotype is significantly higher than that of the AW genotype. The application provides a new train of thought for further research on the effect of the FMO3 gene on the meat quality traits of pigs, and provides a theoretical reference for pig meat quality related breeding work.

The invention relates to a KASP molecular marker associated with erigeron breviscapus erigoster B and application of the KASP molecular marker, and belongs to the technical field of genetic engineering. The primers of the KASP molecular marker associated with Erigeron breviscapus Erigeron ester B comprise a forward primer 1, a forward primer 2 and a common reverse primer; the nucleotide sequence of the forward primer 1 is as shown in SEQ ID NO. 1; the nucleotide sequence of the forward primer 2 is as shown in SEQ ID NO. 2; the nucleotide sequence of the common reverse primer is as shown in SEQ ID NO.3. The SNP site closely related to the content of the erigoster B in the plant is successfully identified through phenotypic difference analysis and re-sequencing technologies, and the medicinal component content of the erigoster B in the plant can be accurately and rapidly evaluated through polymorphic detection of the site.

The invention relates to the technical field of animal breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to a sheep brucellosis resistance character and application of the SNP molecular marker. The molecular marker comprises nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1, the 101st site of the molecular marker has polymorphism, and the polymorphism is T / C. The invention discloses a molecular marker. The molecular marker is related to the brucellosis resistance character of sheep. The polymorphism detection result of the molecular marker reflects the brucellosis resistant character of the sheep. Therefore, the sheep germplasm resources can be improved based on the correlation between the polymorphism of the molecular marker and the brucellosis resistance character of the sheep, and the molecular marker has important application value.

The invention belongs to the technical field of crop genetic breeding, and particularly relates to a broomcorn millet regulatory gene Hd1 development-based codominant molecular marking method, which comprises the following specific steps: acquiring an Hd1 gene sequence of a paddy rice related species from an NCBI database, comparing BLAST with a broomcorn millet reference genome, positioning a broomcorn millet Hd1 homologous region, and identifying the broomcorn millet regulatory gene Hd1 homologous region. By sequencing Hd1 genes of 20-30 parts of broom corn millet varieties, combining with generic genome data, identifying low-frequency PAVs and TE derivative variation, supplementing the defects of traditional SNP / InDel, preferentially developing markers of a coding region and a promoter region, and directly influencing gene functions by variation of the regions, the polymorphism detection efficiency is improved; cross-species verification is carried out by using Hd1 markers of related species such as rice and millet, a broom corn millet marker is rapidly developed by adjusting primers and amplification conditions, a differential expression region of Hd1 is identified through transcriptome sequencing, and an EST-SSR or InDel marker is designed.