Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

28 results about "Melting curve analysis" patented technology

Melting curve analysis is an assessment of the dissociation characteristics of double-stranded DNA during heating. As the temperature is raised, the double strand begins to dissociate leading to a rise in the absorbance intensity, hyperchromicity. The temperature at which 50% of DNA is denatured is known as the melting temperature.

Hydrogel chip as well as preparation method and application thereof

The invention discloses a hydrogel chip as well as a preparation method and application thereof. The hydrogel chip comprises a chip shell, a hydrogel array and a sample flow channel, wherein the hydrogel array and the sample flow channel are arranged in the chip shell. The hydrogel chip provided by the invention is simple in manufacturing process, convenient to use and low in preparation cost, can realize ultra-multiple pathogen detection, can perform PCR, melting curve analysis and real-time quantitative PCR, can flexibly set detection items according to actual requirements, is high in expandability, can realize multi-target rapid detection, is simple to operate, and is suitable for large-scale popularization and application. And the hydrogel chip is a totally closed reaction system, so that pollution can be effectively prevented.
Owner:SHENZHEN SHINEWAY HI TECH CO LTD

DNA detection method and DNA detection system

ActiveCN114929894BMicrobiological testing/measurementDNA SolutionsPseudogene
The present application provides a method and system for accurately distinguishing between micro-partitions configured with a target gene and micro-partitions configured with a pseudo gene, and counting the target gene with high precision in digital PCR using melting curve analysis. The method includes: a step of configuring DNA solution in multiple partitions; a step of performing nucleic acid amplification reaction; a step of changing the temperature of each partition and measuring the fluorescence intensity; a step of calculating the melting temperature of the double-stranded DNA for each partition; a step of counting the number of partitions for each type of DNA; a step of outputting the number of counted partitions for each type of DNA; and a step of distinguishing the first gene and the pseudo gene based on the melting temperature and the number of counted partitions.
Owner:HITACHI HIGH TECH CORP

HPA genotyping detection reagent based on melting curve analysis method, detection method and application

The invention relates to an HPA genotyping detection reagent based on a melting curve analysis method, a detection method and application, in particular to a detection reagent for HPA genotyping detection of Chinese population, a detection method and application. According to the invention, a multiplex PCR technology based on a fluorescent probe melting curve is adopted, specific primers of different HPA systems and fluorescent labeled probes are arranged and combined, and finally, only three reaction tubes are used for simultaneously carrying out genotyping on 14 HPA antigen systems of Chinese population at a time. In addition, the detection system disclosed by the invention is simple, convenient, rapid, accurate and efficient, and has relatively high practical value and clinical transformation prospect.
Owner:BEIJING HOSPITAL

Universal molecular beacon kit for various animal-derived components

The invention discloses a universal molecular beacon kit for various animal-derived components, and belongs to the technical field of molecular biological detection. Aiming at gene segments with specific structural characteristics in 11 common livestock and poultry animal genomes, the invention designs a composition of a universal primer and a molecular beacon fluorescent probe. The combination can be used for carrying out real-time fluorescent PCR detection and melting curve analysis by using the kit and the method by taking genome DNA of a sample to be detected as a template. By comparing the shape of a melting peak of a detected sample and the characteristic melting temperature (Tm value) of the detected sample, 11 animal-derived components of livestock and poultry can be quickly and accurately identified under the condition of single-tube detection. Technical innovation is achieved in the field of molecular biological detection, an efficient and reliable solution is provided for animal-derived component detection, and the method has important practical value and popularization potential.
Owner:NINGBO PROD & FOOD QUALITY INSPECTION INST (NINGBO FIBER INSPECTION INST) +1

A molecular marker associated with barley powdery mildew resistance and use thereof

The application provides a molecular marker related to barley powdery mildew resistance and application thereof, and belongs to the technical field of molecular biology and plant molecular breeding. BPM2 The SNP marker is located on the 6th position of the gene BPM2 The polymorphic site is A / C. A specific amplification primer is designed according to the molecular marker, and genotype identification is carried out through PCR amplification and high-resolution melting curve analysis. The molecular marker and the amplification primer thereof can be used for predicting the barley powdery mildew resistance, breeding the barley germplasm resources resistant to the powdery mildew, and have the advantages of simple operation, high identification accuracy, cost saving and the like, and can obviously shorten the breeding period of the barley resistant to the powdery mildew and save the manpower and material resources.
Owner:SHANGHAI ACAD OF AGRI SCI

Reaction system for detecting drug resistance genes of mycobacterium tuberculosis and rifampicin thereof

The invention provides a reaction system for detecting mycobacterium tuberculosis and rifampicin drug resistance genes thereof. The reaction system comprises DNA polymerase, dNTPs, a reaction buffer solution and a primer for amplifying a template, the reaction system comprises magnesium ions, disodium hydrogen phosphate and a double-strand displacement probe composition, the reaction system can be combined with the double-strand displacement probe composition through synergy of the magnesium ions and the disodium hydrogen phosphate, and the defects that according to a conventional melting curve method, the number of impure peaks is large, the peak heights of melting curves are inconsistent under the same condition, and the sensitivity of the melting curves is low can be overcome; the method has the advantages of low fluorescence background, high detection sensitivity, good specificity and good stability, the purpose of multiple analysis of rifampicin sensitivity and drug resistance in the same optical channel can be achieved by combining melting curve analysis, and when the reaction system is applied to detection, the obtained melting curve peak shape is more stable than that of a conventional asymmetric PCR system, and the method is suitable for large-scale popularization and application. And the experiment repeatability and consistency are good.
Owner:NINGBO CENTER FOR DISEASE CONTROL & PREVENTION (NINGBO HEALTH SUPERVISION INSTITUTE NINGBO HEALTH EDUCATION & PROMOTION CENTER)

Rapid bacterial identification method based on thermally driven death-melting curve analysis

The invention discloses a rapid bacterial identification method based on thermally driven death-melting curve analysis, and belongs to the technical field of microbiological detection. According to the method, a death-melting curve of bacterium / strain specificity is constructed by utilizing membrane thermal stability difference of bacteria and genome dsDNA sequence difference, and Pearson correlation analysis is performed on the death-melting curves of different bacteria by using an SPSSPRO data analysis platform, so that bacteria variety differentiation and rapid identification of the bacteria are realized. The identification method provided by the invention has the characteristics of rapid and efficient detection, simple operation, low cost, high identification accuracy, high specificity and strong universality.
Owner:GUANGXI MEDICAL UNIVERSITY

Primer and probe composition for detecting neurofibroma I-type NF1 gene variation site

The invention discloses a primer and probe composition for detecting neurofibroma type I NF1 gene variation sites, belongs to the technical field of gene diagnosis, and provides a group of specific primers and probe compositions aiming at 12 specific high-frequency or pathogenicity-clear variation sites of an NF1 gene. The composition comprises a specific primer pair aiming at 12 specific high-frequency or specific pathogenicity variation sites of the neurofibroma I-type NF1 gene and a double-labeled oligonucleotide probe matched with the specific primer pair, and the probe is suitable for melting curve analysis; the sequences of the primer pair and the probe of the 12 variation sites are SEQ ID NO. 1 to SEQ ID NO. 36. The primer and probe composition is high in specificity and sensitivity, the kit is easy and convenient to operate and low in cost, the detection result is consistent with that of a gold standard Sanger sequencing method, and the primer and probe composition is suitable for rapid screening and auxiliary diagnosis of clinical samples and has wide clinical application prospects and market value.
Owner:JINHUA MUNICIPAL CENT HOSPITAL

A goat parainfluenza virus 3 type SYBR Green Ⅰ fluorescence quantitative RT-PCR detection method

PendingCN122428062AMicroorganismParainfluenza virus
The application discloses a SYBR Green I fluorescent quantitative RT-PCR primer and method for detecting goat parainfluenza virus 3, and belongs to the technical field of microorganism detection. The fluorescent quantitative RT-PCR primer is as follows: M-F: AAGTATGGTGGGAGCGACAAG, M-R: TTCTCAATCTACTGGCCCATGG, and the amplified target fragment is 148 bp. The detection method comprises the following steps: (1) extracting DNA of a sample to be detected; (2) taking the DNA of the sample to be detected as a template, and performing a fluorescent quantitative RT-PCR amplification reaction by using the fluorescent quantitative RT-PCR primer in claim 1 or 2; and (3) performing amplification curve and melting curve analysis on the fluorescent quantitative RT-PCR amplification product obtained in the step (2). The method has the advantages of high specificity, high sensitivity, high clinical detection accuracy and the like.
Owner:广西农业职业技术大学

Detection primer pair, kit and detection method for chd7 mutation

The application belongs to the technical field of gene detection, and particularly relates to a primer pair, a kit and a detection method for CHD7 mutation. The application can detect 10 potential CHD7 pathogenic mutation sites in a sample to be detected in one PCR reaction by aiming at 10 frequently-occurring CHD7 pathogenic mutation sites selected in a specific manner, and has the characteristic of wide coverage. In addition, the primer pair of the application can further combine with high-resolution melting curve analysis to omit steps such as product recovery after amplification, plasmid construction, sequencing detection and the like in traditional technology, greatly accelerating the detection process and reducing the detection cost, and improving the timeliness of subsequent medical intervention. On the other hand, the primer pair of the application can simultaneously detect 10 sites, and the single detection throughput is several times that of traditional technology, greatly reducing the sample requirement and the number of repeated experiments.
Owner:SANSURE BIOTECH INC

Primer group for detecting individualized medication gene locus, kit and application

The invention discloses a primer probe set for noninvasive detection of individualized medication gene loci, a kit and application, and belongs to the field of biotechnology and molecular diagnosis. The sequences of the primer probe group are as shown in SEQ ID NO. 1 to SEQ ID NO. 51. The primer probe group is prepared into the kit, the kit comprises 7 tubes of independent premixed PCR reaction liquid, and high-throughput typing of 17 SNP loci of 12 drug genes is realized through a single-channel or multi-channel fluorescent PCR and melting curve analysis technology and a same PCR reaction program. An oral swab or a saliva sample is adopted and can be directly used as a template for gene detection after being treated by a nucleic acid lysis solution. Besides, the kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, is suitable for detecting drug metabolism gene related types on an assembly line platform, and can be used for clinical early-stage rapid screening and accurate intervention.
Owner:SHENZHEN NEW INDS BIOMEDICAL ENG CO LTD

LAMP (loop-mediated isothermal amplification) primer probe composition for detecting folic acid MTHFR (methylenetetrahydrofolate reductase) gene polymorphism, kit and application of LAMP primer probe composition

PendingCN121992087AQuick typingAccurate typingMicrobiological testing/measurementDNA/RNA fragmentationVitro diagnosticsC677t mutation
The invention belongs to the technical field of molecular biology and in-vitro diagnosis, and particularly discloses an LAMP (loop-mediated isothermal amplification) primer probe composition for detecting folic acid MTHFR (methylenetetrahydrofolate reductase) gene polymorphism, a kit and application of the LAMP primer probe composition. A probe-mediated LAMP melting curve analysis system is constructed, efficient nucleic acid amplification is realized under a constant-temperature condition by utilizing LAMP reaction, and rapid and accurate typing of C677T mutation sites is realized by combining high-specificity discrimination characteristics of a double-labeled probe melting curve. Compared with a traditional method, the method has the advantages of being short in reaction time, high in sensitivity, high in specificity, free of complex instruments and follow-up operation and the like, and is suitable for clinical rapid typing detection and basic molecular diagnosis application.
Owner:THE AFFILIATED HOSPITAL OF TRADITIONAL CHINESE MEDICAL TO SOUTHWEST MEDICAL UNIV

A molecular marker for identifying barley powdery mildew susceptibility and use thereof

The application provides a molecular marker for identifying barley powdery mildew susceptibility and application, and belongs to the technical field of molecular biology and plant molecular breeding, wherein a SNP marker is present on a BPM1 gene, the SNP marker is located at the 1688th position of the BPM1 gene, and the polymorphic site is C / T. Specific amplification primers are designed according to the molecular marker, and genotypes are identified through PCR amplification and high-resolution melting curve analysis. The molecular marker and the amplification primers thereof can be used for predicting barley powdery mildew resistance, breeding barley germplasm resources resistant to powdery mildew, and have the advantages of simple operation, high identification accuracy, cost saving and the like, and can significantly shorten the breeding period of the barley resistant to powdery mildew and save manpower and material resources.
Owner:SHANGHAI ACAD OF AGRI SCI

Human MTHFR, MTRR and SLC19A1 gene detection kit, detection method and application of human MTHFR, MTRR and SLC19A1 gene detection kit

The invention discloses a human MTHFR (methylenetetrahydrofolate reductase), MTRR (methylenetetrahydrofolate reductase) and SLC19A1 gene detection kit. The kit is based on a high-resolution melting curve analysis technology, and comprises four groups of primer pairs aiming at C677T and A1298C sites of MTHFR genes, A66G sites of MTRR genes and A80G sites of SLC19A1 genes. The kit can be used for rapidly, sensitively and accurately identifying the genotypes of the four key sites under the same reaction procedure by detecting the melting temperature of PCR products and the difference of curve shapes. The kit is suitable for risk assessment of cardiovascular diseases and birth defects, is more innovatively applied to donor screening and receptor assessment of coprophilous fungus transplantation, fills the blank of genetic background detection tools in the field, and has the advantages of low cost, high sensitivity, high specificity, simplicity and convenience in operation, high repeatability, quick and objective detection result and the like.
Owner:SHANGHAI FENGDAO BIOMEDICAL TECHNOLOGY CO LTD

Primer group, kit and method for detecting waxy gene of corn

The invention discloses a primer group, a kit and a method for detecting a waxy gene of corn. Belongs to the technical field of molecular biological detection. According to the invention, aiming at waxy corn mutation wx-D7, a detection primer group WaxyD7-F and WaxyD7-R is designed by taking a segment of 30 base sequence deletion functional sites in a border region of a seventh exon and an eighth intron of a waxy corn waxy gene as a target. The primer designed by the invention clings to variation sites, the amplified fragment is small, the Tm value difference is large enough, melting curves of different genotypes are displayed as obviously distinguishable peaks, the waxy corn Waxy gene can be accurately distinguished by utilizing a melting temperature analysis function of a conventional quantitative PCR instrument, the technical bottleneck that professional equipment must be adopted in high-resolution melting curve analysis (HRM) is broken through, and the method has the advantages of high specificity, high sensitivity and high accuracy. In addition, different waxy genotypes can also be distinguished by adopting agarose gel electrophoresis, and a typing result is consistent with a melting curve analysis result, so that a technical support is provided for detecting the waxy genotype of the corn.
Owner:BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI

Method for preventing false positives in methods employing ddNTP's

The present invention relates to a method which prevents undesirable binding of ddNTPs to double stranded polynucleotides when in the presence of a polymerase. Such methods may be used to prevent the appearance of false positives in methods employing ddNTPs, e.g. in sequence detection methods. The present invention also provides a method of avoiding a false Tm reading or false FRET effects (such as false positive quenching), for example in a melting curve analysis method. In particular a method is provided in which a target nucleotide sequence in a test polynucleotide is detected using a method in which a double stranded molecule is generated which may or may not comprise two labels depending on whether the target sequence is present in which the presence of the two labels is determined, preferably by performing a melting curve analysis.
Owner:NORWEGIAN UNIVERSITY OF LIFE SCIENCES

Temperature analysis method

To provide a method capable of avoiding a problem that a measured temperature of a device is separated from an actual reaction liquid temperature and a Tm value of a target nucleic acid is deviated from the actual temperature when a temperature change speed is increased in performing nucleic acid analysis such as melting curve analysis.SOLUTION: Melting curve data on a data plane are collected based on a high temperature change speed, and X coordinates of peak points of a plurality of kinds of markers are obtained. The plurality of types of markers include a target gene detection marker having a calculated target Tm0 value, a first standard marker having a calculated first Tm1 value that is different from the calculated target Tm0 value, and a second standard marker having a calculated second Tm2 value that is different from the calculated target Tm0 value and the calculated first Tm1 value, and the method includes using an X1 coordinate of a first peak point related to the first standard marker and an X2 coordinate of a second peak point related to the second standard marker on the data plane to calculate the following formula: An X coordinate obtained by normalizing the X0 coordinate of the target peak point is obtained.SELECTED DRAWING: Figure 4
Owner:MIZUHO MEDY

Probe-resolved melting curve analysis for identifying microorganisms in clinical samples

PCT designated stageWO2026019326A1Microbiological testing/measurementRibosomal DNAA-DNA
The present invention relates to a method for detecting and identifying a microorganism in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: providing a biological sample suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising an aliquot of said biological sample or nucleic acids isolated therefrom, at least one pair of broad-taxonomic-range amplification primers for amplifying a microbial ribosomal DNA (rDNA) internal transcribed spacer (ITS) region from the, optionally isolated, nucleic acids in said sample and for generating an rDNA ITS amplicon, at least one taxon-specific detection probe for detecting a taxon-specific sequence in said rDNA ITS region, a DNA intercalating dye for recording a high resolution melting curve for said rDNA ITS amplicon; performing a nucleic acid amplification reaction on the mixture to generate said rDNA ITS amplicon; recording an hrMC for said rDNA ITS amplicon; comparing the high resolution melting curve recorded with a database comprising hrMCs of reference amplicons generated from reference microbial species of known taxonomic identity using the same set of broad-taxonomic-range amplification primers, to thereby obtain a first taxonomic identity indicator of a microorganism present in said sample; detecting hybridization between said at least one taxon-specific detection probe and said rDNA ITS amplicon to thereby obtain a second taxonomic identity indicator of a microorganism present in said sample, and identifying the microorganism present in said sample at species level based on said first and second taxonomic identity indicator, wherein steps c), d), and f) are carried out in a closed reaction container.
Owner:BIOMIRIS CAPITAL GRP BV

Multiplex fluorescent PCR reaction system, kit and detection method for single-tube detection of mutations of multiple gene loci

The invention belongs to the technical field of gene detection, and particularly relates to a multiple fluorescent PCR reaction system, a kit and a detection method for detecting mutation of multiple gene loci in a single tube. The invention provides a multiple fluorescent PCR reaction system for detecting mutation of a plurality of gene loci (especially 10 common mutation loci of G6PD genes in Chinese population, and the loci cover 98.5% or more of the mutation frequency of the G6PD genes in the Chinese population) by a one-tube method, and a kit comprising the reaction system. The reaction system and the kit can distinguish homozygous mutation, heterozygous mutation and wild type, and have the characteristics of high sensitivity (10 copies / reaction), simplicity in operation, low cost, high flux and the like. The genotypes of a plurality of gene loci of a sample can be detected only through one-time PCR amplification reaction and one-time melting curve analysis in the single-tube PCR reaction. Uncovering is not needed in the whole process, and the possibility of aerosol pollution is reduced.
Owner:FUDAN UNIVERSITY

Kit and method for detecting genes related to wool quality traits of fine-wool sheep

The invention provides a fine-wool sheep wool quality character related gene detection kit and method, and belongs to the technical field of animal molecular breeding. The kit is based on 15 genetic variation sites of eight key functional genes such as KRTAPs, FGF5 and BMP2, target fragments are amplified through multiple PCR, genetic typing is achieved by combining high-resolution melting curve analysis, Sanger sequencing or CRISPR / Cas12a lateral flow detection, and wool quality genetic indexes are constructed for comprehensive evaluation. The kit adopts preloaded freeze-dried microspheres and partitioned sealing, so that the transportation stability and the operation convenience are ensured. The method can complete detection in the early stage of lambs, significantly shortens the breeding cycle, and improves the accuracy of seed selection. The method has the advantages of multi-gene joint detection, flow standardization, result visualization, wide application range and the like, and is suitable for genetic improvement and efficient breeding popularization of fine-wool sheep.
Owner:XINJIANG ACAD OF ANIMAL SCI

Methods and compositions for detecting virulent and avirulent escherichia coli strains

Disclosed herein are methods for detecting virulent Shiga toxin-producing E. coli (STEC) strains O26, O103, O121, and O111 in a biological sample comprising the steps of: (i) enriching the bacterial concentration of the biological sample to result in an enriched sample; (ii) isolating DNA from said enriched biological sample; and (iii) detecting virulent strain in said isolated DNA sample via real-time PCR and a melt curve assay. Also disclosed are primers for said assay, as well as kits comprising said primers.
Owner:FLORIDA STATE UNIV RES FOUND INC

PCR melting curve analysis method and system based on multiple verification

The invention discloses a PCR melting curve analysis method and system based on multiple verification, and the analysis method comprises the steps: S1, obtaining data information of each hole site of each channel of a PCR reaction plate, and generating an initial melting curve of each hole site of each channel; s2, smoothing the initial melting curve, and calculating a first-order derivative to generate a negative derivative curve; s3, calculating a second derivative, and identifying the initial candidate peak set by detecting a zero crossing point of the second derivative; s4, performing quadruple judgment verification on each candidate peak, and calculating a melting temperature Tm value of the candidate peak values passing verification to obtain a first effective Tm value set; s5, recognizing a continuous peak group, and screening peak values in the continuous peak group to obtain a second effective Tm value set; s6, comparing peak values in the second effective Tm value set with a global maximum peak value, and if a Tm value corresponding to the global maximum peak value exists, determining that the sample is a true positive sample; and S7, normalizing and displaying the melting curve and the negative derivative curve of the sample judged to be true positive.
Owner:TAIZHOU FOOD & DRUG INSPECTION INSTITUTE +1

Method and kit for isothermal cascade amplification melting curve analysis to detect RNA.

This invention discloses a method and kit for isothermal cascade amplification melting curve analysis to detect RNA. The method includes designing a first primer, a second primer, a circular amplification probe, and a detection probe based on the sequence of the circular amplification probe. Isothermal amplification is performed in an amplification system containing the first primer, the second primer, the circular amplification probe, the detection probe, the sample, a nicking enzyme, RNA-dependent DNA polymerase, ribonuclease H, RNA polymerase, and strand displacement polymerase. This invention ingeniously combines an isothermal detection system, RNA polymerase-mediated transcription amplification technology, and a melting curve analysis system, avoiding the heating delay caused by the large heat capacity of the metal module in traditional thermal cyclers, thus significantly reducing the required time and enabling rapid detection.
Owner:BIOLIGO BIOTECHNOLOGY (SHANGHAI) CO LTD

Method for directly detecting melting curve of RNA to be tested by isothermal amplification method and kit thereof

The application provides a method for directly detecting melting curve of a to-be-detected RNA by an isothermal amplification method and a kit thereof, and the method comprises the following steps: designing a first primer, a second primer and a circular amplification probe according to the sequence of the to-be-detected RNA; designing a detection probe according to the sequence of the circular amplification probe; and performing constant temperature amplification in an amplification system containing the first primer, the second primer, the circular amplification probe and the detection probe, a to-be-detected sample, a nicking enzyme, an RNA-dependent DNA polymerase, a ribonuclease and a strand displacement polymerase. The application solves the bottleneck of limited single-channel detection flux of traditional constant temperature amplification technology, realizes synchronous amplification and detection of multiple targets in a single reaction channel through the linkage system of constant temperature amplification amplification and RCA technology secondary amplification system and multi-color melting curve analysis technology, greatly improves the detection flux, greatly reduces the time and waiting time of manual operation, and effectively reduces the reagent cost.
Owner:BIOLIGO BIOTECHNOLOGY (SHANGHAI) CO LTD

Kit for multi-flux detection of malignant tumor characteristic gene variation

The invention discloses a kit for multi-flux detection of malignant tumor characteristic gene variation, a primer composition for multi-flux detection of malignant tumor characteristic gene variation comprises a primer combination required for mRNA level detection and a primer combination required for DNA level detection, RNA and DNA of a sample are extracted, cDNA obtained by RNA reverse transcription is used as a template, and the malignant tumor characteristic gene variation is detected by the kit. Carrying out PCR (Polymerase Chain Reaction) by using a primer combination required by mRNA level detection, analyzing a high-resolution melting curve by using an obtained product, and judging whether a fusion gene exists or not according to a peak shape of the high-resolution melting curve and a peak dissolution temperature difference of a relative internal reference product; dNA is used as a template, a primer sequence required by DNA level detection is used for PCR, the obtained product is used for high-resolution melting curve analysis, and whether point mutation or insertion / deletion mutation exists or not is judged according to the peak shape of a high-resolution melting curve. The method has the advantages that the sensitivity of a single-site detection method is maintained, the detection time is short, the required sample size is small, the requirement on the sample quality is not high, the detection flux can be customized according to requirements, the result interpretation is simple, and the like, and has a very good application prospect.
Owner:THE SECOND HOSPITAL OF DALIAN MEDICAL UNIV

Methods and related aspects for digital multi-temperature fluorometric detection

Provided herein are methods of performing a high-level of multiplexed analyte detection, including analytes such as nucleic acids and proteins. The methods include performing a melting curve analysis using multiple probe sets under conditions sufficient to generate a melting temperature (Tm) detection barcode data set from partitioned sample aliquots. Related systems and computer program products are also provided.
Owner:JOHNS HOPKINS UNIVERSITY