56 results about "Melting curve analysis" patented technology

The invention discloses a hydrogel chip as well as a preparation method and application thereof. The hydrogel chip comprises a chip shell, a hydrogel array and a sample flow channel, wherein the hydrogel array and the sample flow channel are arranged in the chip shell. The hydrogel chip provided by the invention is simple in manufacturing process, convenient to use and low in preparation cost, can realize ultra-multiple pathogen detection, can perform PCR, melting curve analysis and real-time quantitative PCR, can flexibly set detection items according to actual requirements, is high in expandability, can realize multi-target rapid detection, is simple to operate, and is suitable for large-scale popularization and application. And the hydrogel chip is a totally closed reaction system, so that pollution can be effectively prevented.

The invention discloses a kit for detecting nucleic acid and drug-resistant genes of pertussis through a high-resolution melting curve and an application method of the kit, and the kit for detecting nucleic acid and drug-resistant gene loci of respiratory tract infection pertussis is developed by combining a PCR (Polymerase Chain Reaction) technology with a high-resolution melting curve analysis technology. The pertussis infection can be diagnosed in the early stage by only using one group of primer probes, and meanwhile, the drug resistance condition of the bordetella pertussis can be accurately judged. And a reliable experimental means is provided for clinical prevention and control of pertussis infection.

Disclosed herein are methods for detecting virulent Shiga toxin-producing E. coli (STEC) strains O26, O103, O121, and O111 in a biological sample comprising the steps of: (i) enriching the bacterial concentration of the biological sample to result in an enriched sample; (ii) isolating DNA from said enriched biological sample; and (iii) detecting virulent strain in said isolated DNA sample via real-time PCR and a melt curve assay. Also disclosed are primers for said assay, as well as kits comprising said primers.

The invention discloses a multiplex nucleic acid detection primer probe group, a kit and a detection method, and belongs to the technical field of gene detection. The invention provides a multiplex nucleic acid detection primer probe group, which comprises a target primer, a hairpin probe primer, a general fluorescent probe, a general crRNA, an auxiliary target and a reporter probe, and can be combined with qPCR, ddPCR, CRISPR / Cas12a and melting curve analysis (MCA) technologies to realize nucleic acid specificity and multiplex detection based on the general fluorescent probe or the crRNA. The invention also provides a kit containing the multiplex nucleic acid detection primer probe group, and a corresponding detection method. The problem that the number of single-tube detection targets is limited due to limitation of a fluorescent channel is solved.

The invention provides a method and a kit for detecting genotypes of SNP (single nucleotide polymorphism) sites in target genes by cascade amplification, and the method comprises the following steps: designing a first primer, a second primer and a medium probe aiming at the target genes containing to-be-detected SNP sites, and designing an amplification probe according to a medium sequence of the medium probe, and designing a detection probe according to the single-chain report sequence of the amplification probe, and carrying out PCR amplification and amplification product analysis in a reaction system containing the upstream first primer, the second primer, the medium probe, the amplification probe, the detection probe, a nucleic acid sample containing the target gene and DNA polymerase. The method is a non-target-dependent detection method, a melting peak with a melting point of a certain duplex body is detected in melting curve analysis, the target gene SNP typing corresponding to the duplex body can be judged, and by means of the advantages of PCR amplification and two times of PCR index amplification by combining the medium primer and the amplification probe, the SNP typing of the target gene corresponding to the duplex body can be judged. A large amount of target nucleic acid can be enriched, and the detection sensitivity is improved.

The present application provides a method and system for accurately distinguishing between micro-partitions configured with a target gene and micro-partitions configured with a pseudo gene, and counting the target gene with high precision in digital PCR using melting curve analysis. The method includes: a step of configuring DNA solution in multiple partitions; a step of performing nucleic acid amplification reaction; a step of changing the temperature of each partition and measuring the fluorescence intensity; a step of calculating the melting temperature of the double-stranded DNA for each partition; a step of counting the number of partitions for each type of DNA; a step of outputting the number of counted partitions for each type of DNA; and a step of distinguishing the first gene and the pseudo gene based on the melting temperature and the number of counted partitions.

The invention discloses a hereditary thrombophilia gene detection kit and application thereof, and relates to the technical field of gene detection. The kit comprises three tubes of PCR reaction liquid, and each tube of PCR reaction liquid contains a specific primer and a fluorescent probe and covers 11 SNP sites. According to the hereditary thrombophilia gene detection kit and the application thereof, high-throughput typing of 11 SNP loci is realized through a multi-channel fluorescent PCR and melting curve analysis technology. The kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, and is suitable for clinical early screening and precise intervention.

The invention discloses a detection method for detecting enteropathogenic bacteria, and relates to the field of molecular biology, specific genes are searched in genomes of salmonella, shigella, vibrio parahaemolyticus, campylobacter jejuni, diarrheagenic escherichia coli, vibrio cholerae and staphylococcus aureus, a beta-actin gene is adopted as a reference gene, and the enteropathogenic bacteria are detected. Primer and probe sequences are designed, a probe group consisting of the primer and probe sequences is used for carrying out real-time fluorescent PCR amplification reaction on nucleic acid in a detected sample, then melting curve analysis is carried out, and whether the pathogenic bacteria exist in the nucleic acid sequence to be detected or not can be judged according to a Tm value. The detection method provided by the invention has the advantages of rapidness, high throughput, accuracy and high sensitivity.

The present application discloses a primer set, a kit and a detection device for detecting hemophilia A, wherein the primer set comprises: a first primer, the sequence of which is shown in SEQ ID NO.1; a second primer, the sequence of which is shown in SEQ ID NO.2; a third primer, the sequence of which is shown in SEQ ID NO.3; a fourth primer, the sequence of which is shown in SEQ ID NO.4; a fifth primer, the sequence of which is shown in SEQ ID NO.5; a sixth primer, the sequence of which is shown in SEQ ID NO.6; and a seventh primer, the sequence of which is shown in SEQ ID NO.7; wherein the first primer, the second primer and the third primer are used for the first amplification, and the fourth primer, the fifth primer, the sixth primer and the seventh primer are used for the second amplification of the product of the first amplification, and the second amplification comprises a melting curve analysis. The primer set and the kit of the present application are simple and fast to operate, and the results are easy to interpret, and are suitable for large-scale detection or screening of hemophilia A.

The invention relates to an HPA genotyping detection reagent based on a melting curve analysis method, a detection method and application, in particular to a detection reagent for HPA genotyping detection of Chinese population, a detection method and application. According to the invention, a multiplex PCR technology based on a fluorescent probe melting curve is adopted, specific primers of different HPA systems and fluorescent labeled probes are arranged and combined, and finally, only three reaction tubes are used for simultaneously carrying out genotyping on 14 HPA antigen systems of Chinese population at a time. In addition, the detection system disclosed by the invention is simple, convenient, rapid, accurate and efficient, and has relatively high practical value and clinical transformation prospect.

The invention belongs to the field of molecular biology detection, particularly relates to detection of tuberculosis drug-resistant genes, and more particularly relates to detection of at least four genes in inhA, KatG, ahpC-2, rpoB-3, rpoB-4 and FabG1 genes. According to the combined detection composition provided by the invention, a multicolor melting curve analysis technology is mainly utilized, different target spots are detected, and drug resistance target spots of pathogens are detected, so that drug resistance detection of isoniazide and rifampicin is realized, and a targeted strategy is provided for subsequent treatment. The composition disclosed by the invention is higher in detection sensitivity (up to 800 bacteria / mL), good in specificity and more accurate in detection, provides more accurate and comprehensive tuberculosis drug-resistant medication guidance for clinicians, and accelerates the implementation of treatment measures on patients.

The invention discloses a universal molecular beacon kit for various animal-derived components, and belongs to the technical field of molecular biological detection. Aiming at gene segments with specific structural characteristics in 11 common livestock and poultry animal genomes, the invention designs a composition of a universal primer and a molecular beacon fluorescent probe. The combination can be used for carrying out real-time fluorescent PCR detection and melting curve analysis by using the kit and the method by taking genome DNA of a sample to be detected as a template. By comparing the shape of a melting peak of a detected sample and the characteristic melting temperature (Tm value) of the detected sample, 11 animal-derived components of livestock and poultry can be quickly and accurately identified under the condition of single-tube detection. Technical innovation is achieved in the field of molecular biological detection, an efficient and reliable solution is provided for animal-derived component detection, and the method has important practical value and popularization potential.

The application provides a molecular marker related to barley powdery mildew resistance and application thereof, and belongs to the technical field of molecular biology and plant molecular breeding. BPM2 The SNP marker is located on the 6th position of the gene BPM2 The polymorphic site is A / C. A specific amplification primer is designed according to the molecular marker, and genotype identification is carried out through PCR amplification and high-resolution melting curve analysis. The molecular marker and the amplification primer thereof can be used for predicting the barley powdery mildew resistance, breeding the barley germplasm resources resistant to the powdery mildew, and have the advantages of simple operation, high identification accuracy, cost saving and the like, and can obviously shorten the breeding period of the barley resistant to the powdery mildew and save the manpower and material resources.

The present invention relates to a DNA detection method and a DNA detection kit for analyzing a gene, and more specifically, to a DNA detection method and a DNA detection kit for detecting a gene using a fluorescent-labeled probe.

The invention provides a reaction system for detecting mycobacterium tuberculosis and rifampicin drug resistance genes thereof. The reaction system comprises DNA polymerase, dNTPs, a reaction buffer solution and a primer for amplifying a template, the reaction system comprises magnesium ions, disodium hydrogen phosphate and a double-strand displacement probe composition, the reaction system can be combined with the double-strand displacement probe composition through synergy of the magnesium ions and the disodium hydrogen phosphate, and the defects that according to a conventional melting curve method, the number of impure peaks is large, the peak heights of melting curves are inconsistent under the same condition, and the sensitivity of the melting curves is low can be overcome; the method has the advantages of low fluorescence background, high detection sensitivity, good specificity and good stability, the purpose of multiple analysis of rifampicin sensitivity and drug resistance in the same optical channel can be achieved by combining melting curve analysis, and when the reaction system is applied to detection, the obtained melting curve peak shape is more stable than that of a conventional asymmetric PCR system, and the method is suitable for large-scale popularization and application. And the experiment repeatability and consistency are good.

The invention discloses a rapid bacterial identification method based on thermally driven death-melting curve analysis, and belongs to the technical field of microbiological detection. According to the method, a death-melting curve of bacterium / strain specificity is constructed by utilizing membrane thermal stability difference of bacteria and genome dsDNA sequence difference, and Pearson correlation analysis is performed on the death-melting curves of different bacteria by using an SPSSPRO data analysis platform, so that bacteria variety differentiation and rapid identification of the bacteria are realized. The identification method provided by the invention has the characteristics of rapid and efficient detection, simple operation, low cost, high identification accuracy, high specificity and strong universality.

To provide means for specifically detecting a target nucleic acid.SOLUTION: There is disclosed a method for detecting a target nucleic acid comprising a step of amplifying a target nucleic acid using at least one set of primer pair and a step of detecting the target nucleic acid by melting curve analysis using a fluorolabeled probe that specifically binds to the target nucleic acid amplified in the amplification step, where the probe comprises a base sequence D defined as follows: a base sequence A is a sequence of the target nucleic acid; a base sequence B is a base sequence of a non-target nucleic acid corresponding to the base sequence A; base sequence C is a partial sequence of the base sequence A having one or more bases different from the base sequence B; the base sequence D is complementary to the sequence C and further has a mismatch base at a position corresponding to one to five bases common between the base sequence A and the base sequence B.SELECTED DRAWING: None

The invention discloses a primer and probe composition for detecting neurofibroma type I NF1 gene variation sites, belongs to the technical field of gene diagnosis, and provides a group of specific primers and probe compositions aiming at 12 specific high-frequency or pathogenicity-clear variation sites of an NF1 gene. The composition comprises a specific primer pair aiming at 12 specific high-frequency or specific pathogenicity variation sites of the neurofibroma I-type NF1 gene and a double-labeled oligonucleotide probe matched with the specific primer pair, and the probe is suitable for melting curve analysis; the sequences of the primer pair and the probe of the 12 variation sites are SEQ ID NO. 1 to SEQ ID NO. 36. The primer and probe composition is high in specificity and sensitivity, the kit is easy and convenient to operate and low in cost, the detection result is consistent with that of a gold standard Sanger sequencing method, and the primer and probe composition is suitable for rapid screening and auxiliary diagnosis of clinical samples and has wide clinical application prospects and market value.

The application discloses a SYBR Green I fluorescent quantitative RT-PCR primer and method for detecting goat parainfluenza virus 3, and belongs to the technical field of microorganism detection. The fluorescent quantitative RT-PCR primer is as follows: M-F: AAGTATGGTGGGAGCGACAAG, M-R: TTCTCAATCTACTGGCCCATGG, and the amplified target fragment is 148 bp. The detection method comprises the following steps: (1) extracting DNA of a sample to be detected; (2) taking the DNA of the sample to be detected as a template, and performing a fluorescent quantitative RT-PCR amplification reaction by using the fluorescent quantitative RT-PCR primer in claim 1 or 2; and (3) performing amplification curve and melting curve analysis on the fluorescent quantitative RT-PCR amplification product obtained in the step (2). The method has the advantages of high specificity, high sensitivity, high clinical detection accuracy and the like.

The invention provides an excision enzyme activity detection method and a kit. The method for detecting the activity of the excision enzyme comprises the following steps: a) mixing a substrate / primer complex with an enzyme to be detected, and carrying out enzyme digestion to obtain a substrate mixture; b) mixing the substrate mixture with a probe, heating, and annealing to obtain a substrate probe mixture; c) carrying out melting curve analysis on the substrate probe mixture to obtain melting curve data of the substrate probe mixture and calculating the excision enzyme activity of the enzyme to be detected; the substrate / primer complex comprises a substrate with a stem-loop structure and a single strand overhanging at two ends of a stem, and a primer complementarily paired and combined with the single strand overhanging at one end of the substrate, and the other end of the substrate keeps a partially overhanging single strand. The method can solve the problem that a method for detecting the excision enzyme activity is lacked in the prior art, and is suitable for the field of excision enzyme activity detection.

The invention relates to the technical field of nucleic acid molecule detection, in particular to a method for detecting existence of X target nucleic acid sequences in a sample, a probe tag group and application thereof, and a kit and application thereof. The method comprises the following preparation steps: aiming at each target nucleic acid sequence to be detected, providing an upstream oligonucleotide sequence, a downstream oligonucleotide sequence, an I nDex tag sequence, a tag primer oligonucleotide sequence and a probe which are specifically combined with the target nucleic acid sequence; carrying out PCR (Polymerase Chain Reaction) amplification on a sample through the provided oligonucleotide sequence to obtain a PCR amplification product; providing Y detection probes, and contacting the PCR amplification product with one of the detection probes to obtain a hybrid; wherein Y is an integer greater than 0; carrying out melting curve analysis on the hybrids; and determining whether the X target nucleic acid sequences exist in the sample or not according to a melting curve analysis result. The invention provides a simple, efficient and low-cost multiple detection method which can simply, efficiently and simultaneously detect the existence of multiple target nucleic acid sequences in a sample.

The application belongs to the technical field of gene detection, and particularly relates to a primer pair, a kit and a detection method for CHD7 mutation. The application can detect 10 potential CHD7 pathogenic mutation sites in a sample to be detected in one PCR reaction by aiming at 10 frequently-occurring CHD7 pathogenic mutation sites selected in a specific manner, and has the characteristic of wide coverage. In addition, the primer pair of the application can further combine with high-resolution melting curve analysis to omit steps such as product recovery after amplification, plasmid construction, sequencing detection and the like in traditional technology, greatly accelerating the detection process and reducing the detection cost, and improving the timeliness of subsequent medical intervention. On the other hand, the primer pair of the application can simultaneously detect 10 sites, and the single detection throughput is several times that of traditional technology, greatly reducing the sample requirement and the number of repeated experiments.

The invention discloses a primer probe set for noninvasive detection of individualized medication gene loci, a kit and application, and belongs to the field of biotechnology and molecular diagnosis. The sequences of the primer probe group are as shown in SEQ ID NO. 1 to SEQ ID NO. 51. The primer probe group is prepared into the kit, the kit comprises 7 tubes of independent premixed PCR reaction liquid, and high-throughput typing of 17 SNP loci of 12 drug genes is realized through a single-channel or multi-channel fluorescent PCR and melting curve analysis technology and a same PCR reaction program. An oral swab or a saliva sample is adopted and can be directly used as a template for gene detection after being treated by a nucleic acid lysis solution. Besides, the kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, is suitable for detecting drug metabolism gene related types on an assembly line platform, and can be used for clinical early-stage rapid screening and accurate intervention.

The invention relates to the technical field of gene detection, and discloses a melting curve analysis method and system for HPV (human papillomavirus) typing detection.The method comprises the steps that according to a contrast melting curve of each decontaminated positive sample and a melting curve of each decontaminated to-be-detected sample, the melting curve of each decontaminated to-be-detected sample is calculated; determining the noise pollution weight of the fluorescence degree of each data point position and the deviation correction fluorescence degree of each data point position; according to the noise pollution weight and the deviation correction fluorescence degree, combining an average value of the fluorescence degree of each data point position in the melting curve of all the decontaminated samples to be detected, and determining a fusion value of the fluorescence degree of each data point position and a fusion sample melting curve; and determining the HPV virus type of the to-be-detected sample according to the similarity between the fusion sample melting curve and each decontaminated positive control sample melting curve. According to the invention, the precision of sample data can be improved, the detection accuracy is improved, and the detection cost and hardware requirements are reduced.

The invention discloses a hereditary thrombophilia gene detection kit based on multiple PCR-melting curve analysis and application of the hereditary thrombophilia gene detection kit, and relates to the technical field of gene detection. The kit comprises three tubes of PCR reaction liquid, and each tube of PCR reaction liquid contains a specific primer and a fluorescent probe and covers 12 SNP sites. According to the hereditary thrombophiliosis gene detection kit based on multiple PCR-melting curve analysis and the application of the hereditary thrombophiliosis gene detection kit, high-throughput typing of 12 SNP loci is achieved through a multi-channel fluorescent PCR and melting curve analysis technology. The kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, and is suitable for clinical early screening and precise intervention.

The invention discloses hydrogel as well as a preparation method and application thereof. The hydrogel contains a primer group for detecting a to-be-detected target, according to the hydrogel prepared by the invention, primers or probes are embedded in a hydrogel material, and the primers or probes are dispersed in different reaction areas, so that the mutual interference between the primers or probes is reduced, the detection sensitivity and accuracy can be effectively improved, and the experiment difficulty is reduced; the curve base line obtained through melting curve analysis is clean, the background is low, and the melting peak pattern is clear.

The invention provides a method for detecting target nucleic acid through a melting curve and a kit thereof. The method comprises the following steps: designing a specific upstream primer, a downstream primer and a tag probe aiming at a target nucleic acid sequence; designing a detection probe aiming at the tag sequence, modifying a quenching group on the detection probe, performing amplification in an amplification system containing the upstream primer, the downstream primer, the tag probe, the detection probe and nucleic acid to be detected, and performing melting curve detection on a double-chain product to obtain whether the detected nucleic acid to be detected contains target nucleic acid or not. According to the present invention, with the newly designed label probe and the newly designed detection probe, the interference fluorescence signal fluctuation in the melting curve analysis process is reduced, the fluorescence signal fluctuation of the label and the detection probe is represented in the melting curve analysis process in the large proportion, the straight baseline is obtained, the non-specific peak occurrence is reduced, and the detection accuracy is improved; and the accuracy and accuracy of the detection method are improved.

The invention discloses a method for detecting sheep TPH2 gene mutation through HRM, and relates to the technical field of biotechnology. A high-resolution melting curve analysis (HRM) technology is adopted, and mutation is detected based on the difference of melting temperatures of double-stranded DNA in the heating denaturation process. The method comprises the following steps: designing an HRM (High Resolution Melting) primer, extracting genome DNA (Deoxyribose Nucleic Acid) in blood of to-be-detected sheep, performing amplification by using the HRM primer by taking the genome DNA as a template, heating an amplification product, obtaining a melting curve by detecting the change of a fluorescence signal, and screening out the TPH2 gene mutant in the to-be-detected sheep according to different melting curve shapes of different mutation types; the method is easy to operate, low in cost and suitable for rapid screening of known mutation sites.

The invention belongs to the technical field of molecular biology and in-vitro diagnosis, and particularly discloses an LAMP (loop-mediated isothermal amplification) primer probe composition for detecting folic acid MTHFR (methylenetetrahydrofolate reductase) gene polymorphism, a kit and application of the LAMP primer probe composition. A probe-mediated LAMP melting curve analysis system is constructed, efficient nucleic acid amplification is realized under a constant-temperature condition by utilizing LAMP reaction, and rapid and accurate typing of C677T mutation sites is realized by combining high-specificity discrimination characteristics of a double-labeled probe melting curve. Compared with a traditional method, the method has the advantages of being short in reaction time, high in sensitivity, high in specificity, free of complex instruments and follow-up operation and the like, and is suitable for clinical rapid typing detection and basic molecular diagnosis application.

The present invention provides a method and a kit for detecting the genotype of SNP sites in a target gene independent of a target. The method includes designing a first primer, a second primer, and a mediator probe for a target gene containing a SNP site to be detected, designing a detection probe according to the mediator sequence of the mediator probe, and performing PCR amplification and analysis of the amplification product in a reaction system containing the first primer, the second primer, the mediator probe, the detection probe, a nucleic acid sample containing the target gene, and a DNA polymerase. The method of the present invention is a detection method independent of a target. By detecting a melting peak having the melting point of a certain double-stranded body in melting curve analysis, the SNP typing of the target gene corresponding to the double-stranded body can be determined. The present invention can arbitrarily construct the Tm value of the double-stranded body, realizing the customization of the melting curve peak of the SNP site, thereby solving the problem that the Tm values of the wild type and mutant genotypes of the same SNP site cannot be distinguished, and reducing the design difficulty.