39 results about "Melting curve analysis" patented technology

The invention discloses a hydrogel chip as well as a preparation method and application thereof. The hydrogel chip comprises a chip shell, a hydrogel array and a sample flow channel, wherein the hydrogel array and the sample flow channel are arranged in the chip shell. The hydrogel chip provided by the invention is simple in manufacturing process, convenient to use and low in preparation cost, can realize ultra-multiple pathogen detection, can perform PCR, melting curve analysis and real-time quantitative PCR, can flexibly set detection items according to actual requirements, is high in expandability, can realize multi-target rapid detection, is simple to operate, and is suitable for large-scale popularization and application. And the hydrogel chip is a totally closed reaction system, so that pollution can be effectively prevented.

Disclosed herein are methods for detecting virulent Shiga toxin-producing E. coli (STEC) strains O26, O103, O121, and O111 in a biological sample comprising the steps of: (i) enriching the bacterial concentration of the biological sample to result in an enriched sample; (ii) isolating DNA from said enriched biological sample; and (iii) detecting virulent strain in said isolated DNA sample via real-time PCR and a melt curve assay. Also disclosed are primers for said assay, as well as kits comprising said primers.

The present application provides a method and system for accurately distinguishing between micro-partitions configured with a target gene and micro-partitions configured with a pseudo gene, and counting the target gene with high precision in digital PCR using melting curve analysis. The method includes: a step of configuring DNA solution in multiple partitions; a step of performing nucleic acid amplification reaction; a step of changing the temperature of each partition and measuring the fluorescence intensity; a step of calculating the melting temperature of the double-stranded DNA for each partition; a step of counting the number of partitions for each type of DNA; a step of outputting the number of counted partitions for each type of DNA; and a step of distinguishing the first gene and the pseudo gene based on the melting temperature and the number of counted partitions.

The invention discloses a hereditary thrombophilia gene detection kit and application thereof, and relates to the technical field of gene detection. The kit comprises three tubes of PCR reaction liquid, and each tube of PCR reaction liquid contains a specific primer and a fluorescent probe and covers 11 SNP sites. According to the hereditary thrombophilia gene detection kit and the application thereof, high-throughput typing of 11 SNP loci is realized through a multi-channel fluorescent PCR and melting curve analysis technology. The kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, and is suitable for clinical early screening and precise intervention.

The invention relates to an HPA genotyping detection reagent based on a melting curve analysis method, a detection method and application, in particular to a detection reagent for HPA genotyping detection of Chinese population, a detection method and application. According to the invention, a multiplex PCR technology based on a fluorescent probe melting curve is adopted, specific primers of different HPA systems and fluorescent labeled probes are arranged and combined, and finally, only three reaction tubes are used for simultaneously carrying out genotyping on 14 HPA antigen systems of Chinese population at a time. In addition, the detection system disclosed by the invention is simple, convenient, rapid, accurate and efficient, and has relatively high practical value and clinical transformation prospect.

The invention discloses a universal molecular beacon kit for various animal-derived components, and belongs to the technical field of molecular biological detection. Aiming at gene segments with specific structural characteristics in 11 common livestock and poultry animal genomes, the invention designs a composition of a universal primer and a molecular beacon fluorescent probe. The combination can be used for carrying out real-time fluorescent PCR detection and melting curve analysis by using the kit and the method by taking genome DNA of a sample to be detected as a template. By comparing the shape of a melting peak of a detected sample and the characteristic melting temperature (Tm value) of the detected sample, 11 animal-derived components of livestock and poultry can be quickly and accurately identified under the condition of single-tube detection. Technical innovation is achieved in the field of molecular biological detection, an efficient and reliable solution is provided for animal-derived component detection, and the method has important practical value and popularization potential.

The application provides a molecular marker related to barley powdery mildew resistance and application thereof, and belongs to the technical field of molecular biology and plant molecular breeding. BPM2 The SNP marker is located on the 6th position of the gene BPM2 The polymorphic site is A / C. A specific amplification primer is designed according to the molecular marker, and genotype identification is carried out through PCR amplification and high-resolution melting curve analysis. The molecular marker and the amplification primer thereof can be used for predicting the barley powdery mildew resistance, breeding the barley germplasm resources resistant to the powdery mildew, and have the advantages of simple operation, high identification accuracy, cost saving and the like, and can obviously shorten the breeding period of the barley resistant to the powdery mildew and save the manpower and material resources.

The invention provides a reaction system for detecting mycobacterium tuberculosis and rifampicin drug resistance genes thereof. The reaction system comprises DNA polymerase, dNTPs, a reaction buffer solution and a primer for amplifying a template, the reaction system comprises magnesium ions, disodium hydrogen phosphate and a double-strand displacement probe composition, the reaction system can be combined with the double-strand displacement probe composition through synergy of the magnesium ions and the disodium hydrogen phosphate, and the defects that according to a conventional melting curve method, the number of impure peaks is large, the peak heights of melting curves are inconsistent under the same condition, and the sensitivity of the melting curves is low can be overcome; the method has the advantages of low fluorescence background, high detection sensitivity, good specificity and good stability, the purpose of multiple analysis of rifampicin sensitivity and drug resistance in the same optical channel can be achieved by combining melting curve analysis, and when the reaction system is applied to detection, the obtained melting curve peak shape is more stable than that of a conventional asymmetric PCR system, and the method is suitable for large-scale popularization and application. And the experiment repeatability and consistency are good.

The invention discloses a rapid bacterial identification method based on thermally driven death-melting curve analysis, and belongs to the technical field of microbiological detection. According to the method, a death-melting curve of bacterium / strain specificity is constructed by utilizing membrane thermal stability difference of bacteria and genome dsDNA sequence difference, and Pearson correlation analysis is performed on the death-melting curves of different bacteria by using an SPSSPRO data analysis platform, so that bacteria variety differentiation and rapid identification of the bacteria are realized. The identification method provided by the invention has the characteristics of rapid and efficient detection, simple operation, low cost, high identification accuracy, high specificity and strong universality.

The invention discloses a primer and probe composition for detecting neurofibroma type I NF1 gene variation sites, belongs to the technical field of gene diagnosis, and provides a group of specific primers and probe compositions aiming at 12 specific high-frequency or pathogenicity-clear variation sites of an NF1 gene. The composition comprises a specific primer pair aiming at 12 specific high-frequency or specific pathogenicity variation sites of the neurofibroma I-type NF1 gene and a double-labeled oligonucleotide probe matched with the specific primer pair, and the probe is suitable for melting curve analysis; the sequences of the primer pair and the probe of the 12 variation sites are SEQ ID NO. 1 to SEQ ID NO. 36. The primer and probe composition is high in specificity and sensitivity, the kit is easy and convenient to operate and low in cost, the detection result is consistent with that of a gold standard Sanger sequencing method, and the primer and probe composition is suitable for rapid screening and auxiliary diagnosis of clinical samples and has wide clinical application prospects and market value.

The application discloses a SYBR Green I fluorescent quantitative RT-PCR primer and method for detecting goat parainfluenza virus 3, and belongs to the technical field of microorganism detection. The fluorescent quantitative RT-PCR primer is as follows: M-F: AAGTATGGTGGGAGCGACAAG, M-R: TTCTCAATCTACTGGCCCATGG, and the amplified target fragment is 148 bp. The detection method comprises the following steps: (1) extracting DNA of a sample to be detected; (2) taking the DNA of the sample to be detected as a template, and performing a fluorescent quantitative RT-PCR amplification reaction by using the fluorescent quantitative RT-PCR primer in claim 1 or 2; and (3) performing amplification curve and melting curve analysis on the fluorescent quantitative RT-PCR amplification product obtained in the step (2). The method has the advantages of high specificity, high sensitivity, high clinical detection accuracy and the like.

The invention provides an excision enzyme activity detection method and a kit. The method for detecting the activity of the excision enzyme comprises the following steps: a) mixing a substrate / primer complex with an enzyme to be detected, and carrying out enzyme digestion to obtain a substrate mixture; b) mixing the substrate mixture with a probe, heating, and annealing to obtain a substrate probe mixture; c) carrying out melting curve analysis on the substrate probe mixture to obtain melting curve data of the substrate probe mixture and calculating the excision enzyme activity of the enzyme to be detected; the substrate / primer complex comprises a substrate with a stem-loop structure and a single strand overhanging at two ends of a stem, and a primer complementarily paired and combined with the single strand overhanging at one end of the substrate, and the other end of the substrate keeps a partially overhanging single strand. The method can solve the problem that a method for detecting the excision enzyme activity is lacked in the prior art, and is suitable for the field of excision enzyme activity detection.

The application belongs to the technical field of gene detection, and particularly relates to a primer pair, a kit and a detection method for CHD7 mutation. The application can detect 10 potential CHD7 pathogenic mutation sites in a sample to be detected in one PCR reaction by aiming at 10 frequently-occurring CHD7 pathogenic mutation sites selected in a specific manner, and has the characteristic of wide coverage. In addition, the primer pair of the application can further combine with high-resolution melting curve analysis to omit steps such as product recovery after amplification, plasmid construction, sequencing detection and the like in traditional technology, greatly accelerating the detection process and reducing the detection cost, and improving the timeliness of subsequent medical intervention. On the other hand, the primer pair of the application can simultaneously detect 10 sites, and the single detection throughput is several times that of traditional technology, greatly reducing the sample requirement and the number of repeated experiments.

The invention discloses a primer probe set for noninvasive detection of individualized medication gene loci, a kit and application, and belongs to the field of biotechnology and molecular diagnosis. The sequences of the primer probe group are as shown in SEQ ID NO. 1 to SEQ ID NO. 51. The primer probe group is prepared into the kit, the kit comprises 7 tubes of independent premixed PCR reaction liquid, and high-throughput typing of 17 SNP loci of 12 drug genes is realized through a single-channel or multi-channel fluorescent PCR and melting curve analysis technology and a same PCR reaction program. An oral swab or a saliva sample is adopted and can be directly used as a template for gene detection after being treated by a nucleic acid lysis solution. Besides, the kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, is suitable for detecting drug metabolism gene related types on an assembly line platform, and can be used for clinical early-stage rapid screening and accurate intervention.

The invention discloses a hereditary thrombophilia gene detection kit based on multiple PCR-melting curve analysis and application of the hereditary thrombophilia gene detection kit, and relates to the technical field of gene detection. The kit comprises three tubes of PCR reaction liquid, and each tube of PCR reaction liquid contains a specific primer and a fluorescent probe and covers 12 SNP sites. According to the hereditary thrombophiliosis gene detection kit based on multiple PCR-melting curve analysis and the application of the hereditary thrombophiliosis gene detection kit, high-throughput typing of 12 SNP loci is achieved through a multi-channel fluorescent PCR and melting curve analysis technology. The kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, and is suitable for clinical early screening and precise intervention.

The invention discloses hydrogel as well as a preparation method and application thereof. The hydrogel contains a primer group for detecting a to-be-detected target, according to the hydrogel prepared by the invention, primers or probes are embedded in a hydrogel material, and the primers or probes are dispersed in different reaction areas, so that the mutual interference between the primers or probes is reduced, the detection sensitivity and accuracy can be effectively improved, and the experiment difficulty is reduced; the curve base line obtained through melting curve analysis is clean, the background is low, and the melting peak pattern is clear.

The invention provides a method for detecting target nucleic acid through a melting curve and a kit thereof. The method comprises the following steps: designing a specific upstream primer, a downstream primer and a tag probe aiming at a target nucleic acid sequence; designing a detection probe aiming at the tag sequence, modifying a quenching group on the detection probe, performing amplification in an amplification system containing the upstream primer, the downstream primer, the tag probe, the detection probe and nucleic acid to be detected, and performing melting curve detection on a double-chain product to obtain whether the detected nucleic acid to be detected contains target nucleic acid or not. According to the present invention, with the newly designed label probe and the newly designed detection probe, the interference fluorescence signal fluctuation in the melting curve analysis process is reduced, the fluorescence signal fluctuation of the label and the detection probe is represented in the melting curve analysis process in the large proportion, the straight baseline is obtained, the non-specific peak occurrence is reduced, and the detection accuracy is improved; and the accuracy and accuracy of the detection method are improved.

The invention belongs to the technical field of molecular biology and in-vitro diagnosis, and particularly discloses an LAMP (loop-mediated isothermal amplification) primer probe composition for detecting folic acid MTHFR (methylenetetrahydrofolate reductase) gene polymorphism, a kit and application of the LAMP primer probe composition. A probe-mediated LAMP melting curve analysis system is constructed, efficient nucleic acid amplification is realized under a constant-temperature condition by utilizing LAMP reaction, and rapid and accurate typing of C677T mutation sites is realized by combining high-specificity discrimination characteristics of a double-labeled probe melting curve. Compared with a traditional method, the method has the advantages of being short in reaction time, high in sensitivity, high in specificity, free of complex instruments and follow-up operation and the like, and is suitable for clinical rapid typing detection and basic molecular diagnosis application.

The present invention provides a method and a kit for detecting the genotype of SNP sites in a target gene independent of a target. The method includes designing a first primer, a second primer, and a mediator probe for a target gene containing a SNP site to be detected, designing a detection probe according to the mediator sequence of the mediator probe, and performing PCR amplification and analysis of the amplification product in a reaction system containing the first primer, the second primer, the mediator probe, the detection probe, a nucleic acid sample containing the target gene, and a DNA polymerase. The method of the present invention is a detection method independent of a target. By detecting a melting peak having the melting point of a certain double-stranded body in melting curve analysis, the SNP typing of the target gene corresponding to the double-stranded body can be determined. The present invention can arbitrarily construct the Tm value of the double-stranded body, realizing the customization of the melting curve peak of the SNP site, thereby solving the problem that the Tm values of the wild type and mutant genotypes of the same SNP site cannot be distinguished, and reducing the design difficulty.

The application provides a molecular marker for identifying barley powdery mildew susceptibility and application, and belongs to the technical field of molecular biology and plant molecular breeding, wherein a SNP marker is present on a BPM1 gene, the SNP marker is located at the 1688th position of the BPM1 gene, and the polymorphic site is C / T. Specific amplification primers are designed according to the molecular marker, and genotypes are identified through PCR amplification and high-resolution melting curve analysis. The molecular marker and the amplification primers thereof can be used for predicting barley powdery mildew resistance, breeding barley germplasm resources resistant to powdery mildew, and have the advantages of simple operation, high identification accuracy, cost saving and the like, and can significantly shorten the breeding period of the barley resistant to powdery mildew and save manpower and material resources.

The invention discloses a human MTHFR (methylenetetrahydrofolate reductase), MTRR (methylenetetrahydrofolate reductase) and SLC19A1 gene detection kit. The kit is based on a high-resolution melting curve analysis technology, and comprises four groups of primer pairs aiming at C677T and A1298C sites of MTHFR genes, A66G sites of MTRR genes and A80G sites of SLC19A1 genes. The kit can be used for rapidly, sensitively and accurately identifying the genotypes of the four key sites under the same reaction procedure by detecting the melting temperature of PCR products and the difference of curve shapes. The kit is suitable for risk assessment of cardiovascular diseases and birth defects, is more innovatively applied to donor screening and receptor assessment of coprophilous fungus transplantation, fills the blank of genetic background detection tools in the field, and has the advantages of low cost, high sensitivity, high specificity, simplicity and convenience in operation, high repeatability, quick and objective detection result and the like.

The present invention provides a method and a kit for detecting the genotype of SNP sites in a target gene by cascade amplification. The method includes designing a first primer, a second primer and a mediator probe for a target gene containing a SNP site to be detected, designing an amplification probe according to the mediator sequence of the mediator probe, designing a detection probe according to the single-stranded reporter sequence of the amplification probe, and performing PCR amplification and analysis of the amplification products in a reaction system containing the upstream first primer, the second primer, the mediator probe, the amplification probe, the detection probe, a nucleic acid sample containing the target gene and a DNA polymerase. The method of the present invention is a non-target-dependent detection method. By detecting a melting peak having the melting point of a certain double-stranded body in melting curve analysis, the SNP typing of the target gene corresponding to the double-stranded body can be determined. With the advantages of PCR amplification and two rounds of PCR exponential amplification of the combination of the mediator primer and the amplification probe in the present invention, a large amount of target nucleic acid can be enriched, and the detection sensitivity can be improved.

The invention discloses a primer group, a kit and a method for detecting a waxy gene of corn. Belongs to the technical field of molecular biological detection. According to the invention, aiming at waxy corn mutation wx-D7, a detection primer group WaxyD7-F and WaxyD7-R is designed by taking a segment of 30 base sequence deletion functional sites in a border region of a seventh exon and an eighth intron of a waxy corn waxy gene as a target. The primer designed by the invention clings to variation sites, the amplified fragment is small, the Tm value difference is large enough, melting curves of different genotypes are displayed as obviously distinguishable peaks, the waxy corn Waxy gene can be accurately distinguished by utilizing a melting temperature analysis function of a conventional quantitative PCR instrument, the technical bottleneck that professional equipment must be adopted in high-resolution melting curve analysis (HRM) is broken through, and the method has the advantages of high specificity, high sensitivity and high accuracy. In addition, different waxy genotypes can also be distinguished by adopting agarose gel electrophoresis, and a typing result is consistent with a melting curve analysis result, so that a technical support is provided for detecting the waxy genotype of the corn.

The present invention relates to a method which prevents undesirable binding of ddNTPs to double stranded polynucleotides when in the presence of a polymerase. Such methods may be used to prevent the appearance of false positives in methods employing ddNTPs, e.g. in sequence detection methods. The present invention also provides a method of avoiding a false Tm reading or false FRET effects (such as false positive quenching), for example in a melting curve analysis method. In particular a method is provided in which a target nucleotide sequence in a test polynucleotide is detected using a method in which a double stranded molecule is generated which may or may not comprise two labels depending on whether the target sequence is present in which the presence of the two labels is determined, preferably by performing a melting curve analysis.

The present invention relates to a melting curve analysis method, and provides a melting curve analysis method whereby a high-resolution melting curve result for a plurality of targets can be acquired on the basis of a real-time digital PCR device.

To provide a method capable of avoiding a problem that a measured temperature of a device is separated from an actual reaction liquid temperature and a Tm value of a target nucleic acid is deviated from the actual temperature when a temperature change speed is increased in performing nucleic acid analysis such as melting curve analysis.SOLUTION: Melting curve data on a data plane are collected based on a high temperature change speed, and X coordinates of peak points of a plurality of kinds of markers are obtained. The plurality of types of markers include a target gene detection marker having a calculated target Tm0 value, a first standard marker having a calculated first Tm1 value that is different from the calculated target Tm0 value, and a second standard marker having a calculated second Tm2 value that is different from the calculated target Tm0 value and the calculated first Tm1 value, and the method includes using an X1 coordinate of a first peak point related to the first standard marker and an X2 coordinate of a second peak point related to the second standard marker on the data plane to calculate the following formula: An X coordinate obtained by normalizing the X0 coordinate of the target peak point is obtained.SELECTED DRAWING: Figure 4

The present invention relates to a method for detecting and identifying a microorganism in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: providing a biological sample suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising an aliquot of said biological sample or nucleic acids isolated therefrom, at least one pair of broad-taxonomic-range amplification primers for amplifying a microbial ribosomal DNA (rDNA) internal transcribed spacer (ITS) region from the, optionally isolated, nucleic acids in said sample and for generating an rDNA ITS amplicon, at least one taxon-specific detection probe for detecting a taxon-specific sequence in said rDNA ITS region, a DNA intercalating dye for recording a high resolution melting curve for said rDNA ITS amplicon; performing a nucleic acid amplification reaction on the mixture to generate said rDNA ITS amplicon; recording an hrMC for said rDNA ITS amplicon; comparing the high resolution melting curve recorded with a database comprising hrMCs of reference amplicons generated from reference microbial species of known taxonomic identity using the same set of broad-taxonomic-range amplification primers, to thereby obtain a first taxonomic identity indicator of a microorganism present in said sample; detecting hybridization between said at least one taxon-specific detection probe and said rDNA ITS amplicon to thereby obtain a second taxonomic identity indicator of a microorganism present in said sample, and identifying the microorganism present in said sample at species level based on said first and second taxonomic identity indicator, wherein steps c), d), and f) are carried out in a closed reaction container.

The invention belongs to the technical field of gene detection, and particularly relates to a multiple fluorescent PCR reaction system, a kit and a detection method for detecting mutation of multiple gene loci in a single tube. The invention provides a multiple fluorescent PCR reaction system for detecting mutation of a plurality of gene loci (especially 10 common mutation loci of G6PD genes in Chinese population, and the loci cover 98.5% or more of the mutation frequency of the G6PD genes in the Chinese population) by a one-tube method, and a kit comprising the reaction system. The reaction system and the kit can distinguish homozygous mutation, heterozygous mutation and wild type, and have the characteristics of high sensitivity (10 copies / reaction), simplicity in operation, low cost, high flux and the like. The genotypes of a plurality of gene loci of a sample can be detected only through one-time PCR amplification reaction and one-time melting curve analysis in the single-tube PCR reaction. Uncovering is not needed in the whole process, and the possibility of aerosol pollution is reduced.

The invention provides a fine-wool sheep wool quality character related gene detection kit and method, and belongs to the technical field of animal molecular breeding. The kit is based on 15 genetic variation sites of eight key functional genes such as KRTAPs, FGF5 and BMP2, target fragments are amplified through multiple PCR, genetic typing is achieved by combining high-resolution melting curve analysis, Sanger sequencing or CRISPR / Cas12a lateral flow detection, and wool quality genetic indexes are constructed for comprehensive evaluation. The kit adopts preloaded freeze-dried microspheres and partitioned sealing, so that the transportation stability and the operation convenience are ensured. The method can complete detection in the early stage of lambs, significantly shortens the breeding cycle, and improves the accuracy of seed selection. The method has the advantages of multi-gene joint detection, flow standardization, result visualization, wide application range and the like, and is suitable for genetic improvement and efficient breeding popularization of fine-wool sheep.

Disclosed herein are methods for detecting virulent Shiga toxin-producing E. coli (STEC) strains O26, O103, O121, and O111 in a biological sample comprising the steps of: (i) enriching the bacterial concentration of the biological sample to result in an enriched sample; (ii) isolating DNA from said enriched biological sample; and (iii) detecting virulent strain in said isolated DNA sample via real-time PCR and a melt curve assay. Also disclosed are primers for said assay, as well as kits comprising said primers.