12 results about "Sanger sequencing" patented technology

This invention relates to a primer set and method for high-throughput assessment of drug resistance levels in rodent populations. The invention provides a set of universal degenerate primers for amplifying the Vkorc1 gene in multiple rodent species. The primer set includes primers for amplifying exon 1, exon 2, and exon 3 of the Vkorc1 gene, respectively. By designing universal degenerate primers and coupling them with next-generation sequencing technology, this invention can simultaneously amplify the Vkorc1 gene coding region of at least 15 rodent species across genera and families. This significantly improves the species universality and detection throughput of rodent drug resistance monitoring, reduces the cost of large-scale screening, overcomes the limitation of Sanger sequencing in accurately analyzing heterozygotes with insertions and deletions, and enhances the ability to discover new resistance mutations. It provides a standardized and low-cost technical solution for efficient assessment of rodent drug resistance.

The application discloses a molecular marker, a kit and a genotype detection method for predicting high content of highly unsaturated fatty acids in mirror carp muscle, relates to the technical field of biomolecular detection, and specifically relates to a molecular marker, a kit and a genotype detection method for predicting high content of highly unsaturated fatty acids in mirror carp muscle. The molecular marker for predicting high content of highly unsaturated fatty acids in mirror carp muscle is shown as SEQ ID NO. 1. The primer pair for predicting high content of highly unsaturated fatty acids in mirror carp muscle is hufaf1 and hufar1. The genotype detection method comprises the following steps: one, extracting DNA; two, PCR amplification; and three, Sanger sequencing, and the mirror carp with a C single peak at the 75th bp is selected. The application can identify individuals with potential high content of highly unsaturated fatty acids in muscle based on living body non-damage and rapidness through the above-mentioned molecular marker, the kit and the genotype detection method, so that precise and efficient breeding of the high content of highly unsaturated fatty acids in mirror carp is realized.

This invention relates to a 3'RACE library construction and sequencing method and its application based on third-generation sequencing technology. The method includes: S1, using primers containing anchor sequences and Oligo d(T) to reverse transcribe sample RNA to obtain cDNA, which is then used as a template for specific amplification to obtain the target gene; S2, designing specific primers containing third-generation sequencing adapters and barcodes, using the target gene as a template for amplification, and constructing a high-throughput third-generation sequencing library; S3, performing third-generation sequencing and analysis on the library to obtain the complete 3' end sequence information of the target transcript. This invention abandons traditional vector construction and Sanger sequencing methods, leveraging the high throughput and long read length characteristics of third-generation sequencing to ensure that Race experiments obtain a large amount of long 3' end sequence information in a short period, improving the overall efficiency and data accuracy of the experiment, and laying the foundation for refined mRNA research.

The application discloses specific primers for detecting Acinetobacter baylyi and application of the specific primers, and the specific primers comprise baylyi-F and baylyi-R. The primers are used for PCR amplification, and 370 bp, clear and single DNA bands are obtained through 1.2% agarose gel electrophoresis and Sanger sequencing. The accuracy rate of bacterial liquid PCR detection of the Acinetobacter baylyi is 100%, the time consumption is only 3 hours, and the method is successfully applied to conjugation transfer experiment of the Acinetobacter baylyi ADP1. The method for detecting the Acinetobacter baylyi by using the specific primers for detecting the Acinetobacter baylyi provided by the application is simple, efficient and high in accuracy.

This invention discloses gene mutations for diagnosing multiple epiphyseal dysplasia. Through Sanger sequencing, this invention identifies mutation sites in the SLC26A2 gene: c.1262T>C: p.Ile421Thr and / or c.1020_1022delTGT: p.Val341del. The mutants provided by this invention can be used to diagnose multiple epiphyseal dysplasia, enabling early diagnosis and providing a new direction for its diagnosis.

The present disclosure relates to a sequencing platform and workflow that utilizes machine learning algorithms to dispense with confirmatory Sanger sequencing for high confidence variants in genetic assays. Various aspects relate to performing next generation sequencing (NGS) on nucleic acids obtained from a biological sample of a subject to generate sequencing data; extracting variant information from the sequencing data, wherein the information comprises variant type and quality features; clustering variants into variant subsets based on variant type; using a first machine learning model, generating a predicted state for each variant in the variant subsets based on one or more quality features; using a second machine learning model, generating a confirmation state for each variant for which the predicted state is an unknown state; and performing Sanger sequencing on nucleic acid molecules containing variants for which the state is not present.

This invention discloses a specific DNA fragment, primers, identification method, and application for sex identification in yellowfin tuna. The specific DNA fragment has the following gene sequence: male as shown in SEQ ID NO.1 and female as shown in SEQ ID NO.2. Primers were designed based on the specific DNA fragment sequence for PCR amplification and Sanger sequencing analysis. The genotype at position 219 of the male yellowfin tuna DNA fragment is T / G heterozygous, and at position 292 it is A / G heterozygous. The genotype at position 219 of the female yellowfin tuna DNA fragment is T / T homozygous, and at position 292 it is A / A homozygous. This invention successfully achieves non-lethal sex identification during the fry or juvenile stage, which is beneficial for the implementation of asexual reproduction and seedling selection in yellowfin tuna, and has significant practical value and application potential.

This invention discloses an editing site that specifically identifies the porcine ACADL gene and its application, relating to the field of biotechnology. The editing site includes two editing sites, T1 and T2. The sequence of the T1 editing site is: CGTGGATCTCTGCGCTTGTG, and the sequence of the T2 editing site is: CGTGCTCCGCGCCTACCGA. Both T1 and T2 editing sites are located in the first exon region of the coding region of the ACADL gene on porcine chromosome 15. The chromosome coordinates of the T1 editing site are 75441814–75441833, and the coding region coordinates are 246–265; the chromosome coordinates of the T2 editing site are 75442009–75442028, and the coding region coordinates are 441–460. This invention is based on CRISPR / Cas9 gene editing technology. A targeting vector with a porcine ACADL gene editing site inserted was constructed using the PX459 vector as a backbone. Combined with electroporation and puromycin screening, and PCR amplification and Sanger sequencing, ACADL-deficient cell lines were obtained. Cell proliferation was observed using CCK-8, cloning experiments and EDU555 assays. This invention provides insights into the role of the ACADL gene in pork breed improvement.

This invention relates to the fields of bioinformatics and immunogenetics, and discloses an HLA typing tool selection system, method, device, and medium based on a typing tool invocation agent. The method includes: acquiring second-generation sequencing data and Sanger sequencing data from patients with autoimmune diseases; having a typing tool invocation agent invoke several HLA typing tools to perform HLA typing analysis on the second-generation sequencing data, obtaining several HLA typing results; combining these with reference sequencing data to determine the performance evaluation results of each HLA typing tool; screening and optimizing HLA typing tools; and finally, obtaining the final HLA typing result. This invention, through data-driven tool optimization and gold standard validation, significantly improves the accuracy, reliability, and ability to discover new risk alleles in HLA typing in complex disease contexts, effectively reducing the cost of large-scale research, and has significant value for the study of the genetic mechanisms of autoimmune diseases and precision medicine.

The present application relates to a method for constructing a pig endogenous retrovirus inactivated xenotransplant donor pig, and belongs to the technical field of xenogenic organ transplantation. The copy number and PERV-pol genotype of PERVs are determined by ddPCR, Sanger sequencing and second-generation sequencing. Based on the RNP system of CRISPR / Cas9, the pig PERV-pol gene targeting sequence is designed and synthesized, and is co-transfected into a pig fetal fibroblast cell line with spCas9 protein, positive cells are screened, somatic cell cloning and embryo transfer are carried out, and the PERV-pol knockout condition of the fetus is identified when pregnancy occurs. If not completely knocked out, the sgRNA targeting sequence needs to be designed and synthesized again, and the cell line with completely knocked out PERV-pol gene is screened. If completely knocked out, somatic cell cloning and embryo transfer are directly carried out; and the xenotransplant donor pig with inactivated PERVs is obtained.