2311results about "Library creation" patented technology

The present disclosure provides systems and methods for processing or analyzing a sample. Methods may include generating supports (e.g., beads) comprising barcode molecules coupled thereto. A support comprising barcode molecules may be useful for analyzing or processing one or more analytes such as nucleic acid molecules, proteins, and / or perturbation agents.

The disclosure provides systems and methods for droplet processing. For example, a method can include providing a first droplet and a second droplet. In some cases, the first droplet may have a first concentration of a reagent and the second droplet may have a second concentration of the reagent. The second droplet may comprise a bead or a biological particle. The method can also include subjecting the first droplet and the second droplet to conditions sufficient to transfer the reagent from the first droplet to the second droplet, thereby decreasing the first concentration in the first droplet and increasing the second concentration in the second droplet.

Provided is an HLA gene amplification primer, comprising primers of any one or more groups of the following nine primer groups: a first primer group: SEQ ID NO: 1 and SEQ ID NO: 2; a second primer group: SEQ ID NO: 3 and SEQ ID NO: 4; a third primer group: SEQ ID NO: 5 and SEQ ID NO: 6; a fourth primer group: SEQ ID NO: 7 and SEQ ID NO: 8; a fifth primer group: SEQ ID NO: 9 and SEQ ID NO: 10; a sixth primer group: SEQ ID NO: 11 and SEQ ID NO: 12; a seventh primer group: SEQ ID NO: 12 and SEQ ID NO: 13; an eighth primer group: SEQ ID NO: 14 and SEQ ID NO: 15; and a ninth primer group: SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18. Also provided is a kit for HLA gene sequencing, which comprises the described HLA gene amplification primer; provided is a gene sequencing library construction method based on the described HLA gene amplification primer and an HLA gene sequencing method based on the HLA gene sequencing library construction method.

The invention relates to the technical field of high-throughput sequencing, and discloses a kit and a library construction method and a target variation detection and analysis method thereof, the kit comprises a pre-library construction reagent and a target region liquid phase hybridization capture reagent; wherein the pre-library construction reagent comprises a repair reagent, a joint, a connection reagent, an amplification reagent and purified magnetic beads; the target area liquid phase hybridization capture reagent comprises a hybridization reagent, a cleaning reagent, an amplification reagent, a purification magnetic bead, a target gene probe and a CNV / LOH probe. The invention provides a rapid, accurate and low-cost construction method of a library containing a targeting gene probe and a CNV / LOH probe and application of the library, through one-time library construction and sequencing, the advantages of a high-throughput targeting sequencing technology and a CNV-Seq technology are integrated; multi-gene point mutation, insertion and deletion, gene copy number variation, large-fragment copy number variation and heterozygosity deletion can be detected at the same time.

The invention provides a kit for detecting breast cancer through plasma miRNA isomer next generation sequencing. The kit provided by the invention comprises the primer for amplifying the miRNA isomer related to breast cancer, has the advantages of high sensitivity, high relative sequencing depth and high specificity, can detect miRNA which cannot be detected by a conventional method, avoids high-expression miRNA due to significant amplification, and can be used for detecting the miRNA in the same sequencing depth. For the same low-expression miRNA, a relatively high relative sequencing depth is obtained, and according to the technical scheme, the detection efficiency of breast cancer is greatly improved through a specific amplification technology.

The invention provides a sample preparation method for microbiological detection, a sample, a detection method, a kit and application. The method comprises the following steps: a treatment step: taking an in-vitro host cell sample, and treating the in-vitro host cell sample with a host cell lysis reagent and nuclease to degrade host nucleic acid, the treatment being carried out in a liquid with a salt concentration of 10-600mM; a nuclease inactivation step: providing conditions to inactivate the nuclease; and obtaining microbial nucleic acid: extracting total nucleic acid to obtain the sample for detecting the microorganisms. According to the method disclosed by the invention, the interference of the host cell genome on the sample detection sensitivity can be effectively reduced in metagenome sequencing, and effective sequencing data of microorganisms in a detection result is improved, so that the positive detection rate of the microorganisms and the sensitivity of detecting the microorganisms are improved.

Disclosed in the present invention is a chip substrate preparation method based on a glass sheet. The chip substrate preparation method comprises the following steps: making the surface of a glass sheet carry an amino, and reacting a coupling reagent having an azide group with the amino on the surface of the glass sheet, so as to form an amide bond. Further disclosed in the present invention is a chip preparation method. On the basis of the chip substrate preparation method, the chip preparation method comprises the following steps: reacting a 5'-end-modified probe with the azide group of the coupling reagent, and combining the probe on the surface of the glass sheet. In the present invention, the glass sheet is used to replace a silicon wafer, thereby reducing the cost of the chip raw material, also ensuring the number and quality of the probes of the chip, and improving the use stability of the chip.

The invention relates to a method for carrying out pathogenic microorganism identification and gene variation state joint detection on a pulmonary alveolar lavage fluid sample based on high-throughput sequencing. The method comprises the following steps: extracting nucleic acid from the pulmonary alveolar lavage fluid sample; constructing a metagenome capture library, and constructing a lung cancer polygene library; carrying out final library pooling; performing high-throughput sequencing; and analyzing data. Compared with the prior art, the scheme provided by the invention is based on a technical path of'macro 'captured by metagenome and'target' of targeted high-throughput sequencing; after the constructed final library is subjected to high-throughput sequencing and data analysis, index output (pathogenic microorganism identification, host chromosome copy number variation, gene mutation, gene fusion, gene copy number variation and methylation state) of multiple biomarkers can be met in one-time detection.

The invention provides a phage group enrichment method as well as a kit and application thereof, and belongs to the technical field of gene sequencing. According to the method, the phage group in the sample is enriched based on lysozyme and DNA binding dye, and then antibiotic is combined to inactivate bacteria and degrade DNA and RNA, so that the interference of the extracted bacteria DNA in the phage group is reduced, the total enrichment fraction of the established phage library is obviously improved, the ViromeQC concentration fraction of the phage library is greater than 10, and the application prospect is wide. The research requirement of a bacteriophage group is met, and the application value is wide.

The present disclosure provides compositions and methods for accurately detecting mutations by uniquely tagging double stranded nucleic acid molecules with dual cyphers such that sequence data obtained from a sense strand can be linked to sequence data obtained from an anti-sense strand when sequenced, for example, by massively parallel sequencing methods.

Strategies, systems, methods, reagents, and kits for phage-assisted continuous evolution are provided herein. These include strategies, systems, methods, reagents, and kits allowing for stringency modulation to evolve weakly active or inactive biomolecule variants, negative selection of undesired properties, and / or positive selection of desired properties.

The invention discloses preparation of a human CD56 immune phage display antibody library, which comprises the following steps: S1, animal immunization: expressing recombinant hCD56 protein in escherichia coli, then immunizing a Balb / c mouse, and detecting immune titer; s2, splenocyte preparation: extracting RNA (Ribonucleic Acid) of immune mouse spleen cells, and performing reverse transcription to obtain cDNA (Complementary Deoxyribonucleic Acid); s3, preparation of an initial bacteriophage display library: amplifying a heavy chain variable region and a light chain variable region by using a PCR technology, and then assembling to form scFv; constructing scFv phagocytids, electrically transforming the scFv phagocytids into TG1 competent cells, and constructing a bacterial library; s4, constructing a phage single-chain library of the hCD56: infecting the bacterial library by using a helper phage M13K07, and constructing a phage single-chain antibody library; and S5, elutriation and screening of a phage library: specifically enriching a phage single-chain antibody library, screening positive clones from the phage single-chain antibody library, and determining a sequence. According to the invention, the human hCD56 antibody scFv sequence fragment can be screened out, and the research and development period is shortened.

The invention belongs to the field of preparation of medical intermediates, and particularly relates to a preparation method of an On-DNA sulfinic acid structure compound. The method for preparing the On-DNA sulfinic acid structure compound comprises a step of oxidizing On-DNA thiol (phenol) into the On-DNA sulfinic acid structure compound under alkaline and heating or illumination conditions, a solvent used in the reaction step is a mixed solution of water, dimethyl sulfoxide, N, N-dimethylformamide, acetonitrile, ethanol or tetrahydrofuran, the reaction temperature is not more than 80 DEG C, and the reaction time is not more than 2 hours. And the illumination wavelength ranges from 365 nanometers to 535 nanometers. The On-DNA sulfinic acid structure compound obtained in the invention can be directly used for constructing a structure compound with a sulfonyl group, the reaction condition is mild and convenient, a new method and a new idea are provided for construction of a DNA coding compound library, and the On-DNA sulfinic acid structure compound has a very good application prospect in lead drug development.

The invention relates to the technical field of polypeptide cyclization methods, in particular to a preparation method for constructing a phage display cyclopeptide library based on phthalic dicarboxaldehyde, which comprises the following steps: carrying out click chemical reaction on phthalic dicarboxaldehyde (OPA) and lysine and cysteine in an unprotected peptide sequence under a neutral or alkaline condition to form cyclopeptide; constructing a phage cyclic peptide library on the basis of the reaction property that the OPA molecule is efficiently biocompatible with sulfydryl and amino groups; a polypeptide library containing cysteine and lysine is displayed on a bacteriophage, the polypeptide library is cyclized by utilizing OPA (o-phthalaldehyde), and a cyclic peptide ligand with specific binding is screened out aiming at a target protein. In the strategy of performing polypeptide cyclization by using o-phthalaldehyde, it is found that o-phthalaldehyde has good reaction activity with sequence peptide containing cysteine and lysine, reaction conditions are simple and mild, and the o-phthalaldehyde has good biocompatibility. The reaction system does not need organic solvents or metal catalysts and is suitable for biological systems.

The invention relates to a primer group and a kit for detecting Fabry disease GLA gene mutation and application of the primer group and the kit. The primer group comprises one or more of a GLA-F1 / R1 primer pair, a GLA-F2 / R2 primer pair, a GLA-F3 / R3 primer pair, a GLA-F4 / R4 primer pair, a GLA-F5 / R5 primer pair, a GLA-F6 / R6 primer pair and a GLA-F7 / R7 primer pair. The kit further comprises a GLA-Gap primer. Based on a specific combination of long-fragment PCR amplification and third-generation high-throughput sequencing, the method can be used for simultaneously detecting various mutations related to the Fabry disease pathogenic gene GLA of a plurality of samples in a high-specificity, accurate and rapid manner.

The invention provides an HLA (human leukocyte antigen) gene amplification primer based on a third-generation sequencing platform and application of the HLA gene amplification primer. The HLA gene amplification primer comprises a composition of any one or more of nine groups of primers. The amplification primer designed aiming at the 11 target spot of the HLA not only realizes near full-length amplification of the HLA gene, but also improves the amplification specificity, and further improves the homogeneity of HLA gene sequencing data. Besides, the amplification primers aiming at 11 target spots of the HLA gene are in the same reaction system, so that one-tube detection is realized, and the operation is convenient.

The invention discloses a recombinant fusion protein of a human lambda light-chain single-chain antibody, a DNA (deoxyribonucleic acid) molecule, a library building method and application, and the recombinant fusion protein of the human lambda light-chain single-chain antibody is the recombinant fusion protein formed by connecting the human lambda light-chain single-chain antibody, phage Piii protein and luciferase, the amino acid sequence of the recombinant fusion protein of the human lambda light-chain single-chain antibody is shown as SEQ ID NO: 5, the recombinant fusion protein library of the human lambda light-chain single-chain antibody has large capacity, the established single-chain antibody TG1 library is more than 1 * 10 < 9 > cfu / mL, positive clones capable of being combined with ligands can be screened and enriched for multiple rounds, and the recombinant fusion protein library has the characteristics of high sensitivity, high signal-to-noise ratio and the like.

The present disclosure provides compositions and methods for accurately detecting mutations by uniquely tagging double stranded nucleic acid molecules with dual cyphers such that sequence data obtained from a sense strand can be linked to sequence data obtained from an anti-sense strand when sequenced, for example, by massively parallel sequencing methods.

Provided herein are polypeptides that bind to a transferrin receptor, methods of generating such polypeptides, and methods of using the polypeptides to target a composition to a transferrin receptor-expressing cell.

To provide a biochip and a manufacturing method in which the problem of overflow of a liquid specimen is avoided, and which can deal with a large amount of the liquid specimen.SOLUTION: A biochip comprises a substrate 110, an insulator layer IL, a semiconductor layer 120, a dielectric layer 130, a metal layer 140, and a protective layer 150. The semiconductor layer is disposed on the insulator layer, and has a reaction zone 121. The dielectric layer is disposed on the semiconductor layer, and has a first aperture O1. The metal layer is disposed on the dielectric layer, and has a source, a drain and a wall structure. The wall structure 141 surrounds the first aperture, the source and the drain. The protective layer is disposed on the metal layer, and has a flat part 151, a protruding part 152, a second aperture O2, and a third aperture O3. The flat part surrounds and defines the second aperture. The protruding part is disposed to correspond with the wall structure. The protruding part surrounds and defines the third aperture. The second aperture connects the third aperture and the first aperture, and allows the reaction zone to be exposed.SELECTED DRAWING: Figure 6

The invention discloses an animal-derived component identification primer based on a three-generation sequencing technology. The animal-derived component identification primer comprises a primer F as shown in SEQ ID No. 1, namely GTATGACCGCGGTGGCTGGCAC, and a primer R as shown in SEQ ID No. 2, namely CCAAACTGGGATTAGATACCC. The animal-derived component identification primer comprises a primer A, a primer B and a primer C, wherein the primer F is GTATGACCGCGGTGGCTGGCAC, and the primer C is CCAAACTGGGATTAGATACCC. Compared with a conventional DNA bar code method or a fluorescent quantitative PCR method, the primers designed by the invention can realize full-length mitochondrial amplification in different animal-derived DNAs, and the identification of animal-derived components is realized through a pair of primers, so that the detection efficiency of identification of fake animal-derived components in the field of public security food and medicine rings is improved. According to the primer pair designed by the invention, the amplification range covers all mitochondrial gene loci such as D-LOOP, COX1, COX2, COX3 and CYTB, and compared with a short fragment, the primer pair has higher species resolution.

Embodiments of systems, methods, and compositions provided herein relate to methods of simultaneously analyzing multiple analytes in a single sample using a single assay. Some embodiments relate to simultaneous analysis of DNA and RNA in a single sample, for example, to the simultaneous generation of DNA and RNA libraries.

The invention discloses a pig sperm specific antibody. The coding sequence of the antibody is shown as any one of SEQ ID No: 1-3. According to the method, the nano antibody library is prepared by immunizing alpaca with whole pig sperms, and then the antibody capable of being specifically combined with the X or Y sperms can be screened out through the library, so that sorting of the X and Y sperms is realized. The screened antibody is a nano antibody, the size of the nano antibody is only 10% of that of a traditional antibody, the structure is simpler, the advantages of high stability, strong specificity and low immunogenicity are achieved, large-scale expression of the antibody can be achieved, the production cost of the antibody is greatly reduced, and industrial application is facilitated.

The invention provides a high-throughput single-cell multi-omics three-dimensional genome detection method and system. The detection method comprises the following steps: enzyme digestion reaction of fixed cells; carrying out proximity ligation treatment on the cells subjected to the enzyme digestion reaction; carrying out analysis treatment including reverse transcription on the treated cells, and respectively constructing a DNA library and an RNA library; and sequencing to obtain three-dimensional genomics information in a single cell. A high-throughput single-cell multi-omics three-dimensional genomics detection technology is designed, chromatin in cells is subjected to opening treatment through different methods, chromatin opening sites are enriched, the throughput of generated data is greatly improved, and the detection accuracy is greatly improved while the chromatin openness is detected in a single cell. The capability of detecting interaction between chromatin open sites and the gene expression capability are improved.

The invention relates to a primer composition and a method for whole genome sequencing of American type porcine reproductive and respiratory syndrome virus and application of the primer composition and the method. The sequences of the primer composition are as shown in SEQ ID No. 1 to SEQ ID No. 35. According to the sequencing method, RNA (Ribonucleic Acid) of a sample to be detected is taken as a template to perform reverse transcription reaction, the primer combination is adopted to perform PCR (Polymerase Chain Reaction) amplification on the whole genome of the American type porcine reproductive and respiratory syndrome virus, and an amplification product is subjected to three-generation sequencing library building and sequencing to perform species identification and genetic typing. The full-length PCR detection method is high in specificity and sensitivity, the efficiency of detecting the whole genome of the virus is greatly improved, rapid and accurate detection of the American type porcine reproductive and respiratory syndrome virus is achieved, accurate typing and evolutionary analysis can be achieved by utilizing the assembled whole genome, and the method is suitable for large-scale popularization and application. Traceability of the reproductive and respiratory syndrome virus is realized, and the method is of great significance to early screening, prevention and control of the American porcine reproductive and respiratory syndrome virus.

The invention provides a method and a system for detecting the chimeric rate of human cells based on a micro haploid, and belongs to the technical field of chimera analysis. According to the invention, the micro haploid is innovatively adopted as a basic unit of the genetic marker, and different from the prior art in which DNA fragments containing the genetic marker are generally enriched through a multiplex PCR amplification technology, a probe targeted capture technology is introduced for enrichment; the limitation of the multiple PCR amplification technology on the number of markers and the potential influence of the PCR amplification efficiency difference on accurate quantification are effectively avoided; meanwhile, the invention further develops a special data analysis algorithm which is used for processing sequencing data and accurately calculating the chimeric rate. A verification result shows that the scheme of the invention has excellent reliability and accuracy, and the detection sensitivity reaches the highest level of similar products on the current market. Therefore, the method has a wide application prospect in the fields needing micro chimera detection, such as hematopoietic stem cell transplantation, organ transplantation and the like.

The invention discloses a barcode array repeatable chip and a preparation method and application thereof, and belongs to the technical field of gene sequencing and tissue cell sample analysis. The chip comprises a chip substrate, a universal primer probe and a bar code probe, the bar code probe comprises a Nick region, a capture region, a position bar code region and a molecular bar code region which respectively execute corresponding functions, and particularly, the Nick region is arranged, so that the chip can generate a repeatable bar code chip through SDA reaction, and the chip can be used for detecting the bar code of the chip. The bar code chip can be repeatedly used through DNA probe hybridization, polymerization extension and polymerization strand displacement. The chip has a simple structure, is easy to process, and can be used, so that the preparation of the bar code chip is realized at extremely low cost.

The invention provides a system and a method for screening Cas protein mutants capable of identifying different PAM sequences, and belongs to the technical field of bioengineering. The system comprises a Cas protein mutant screening vector and an sgRNA expression vector, the Cas protein mutant screening vector comprises the following expression elements: a Cas protein coding gene, a plasmid replicon and a first resistance screening tag expression cassette; the sgRNA expression vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third resistance screening tag expression cassette and an sgRNA expression cassette. According to the system and the method, aiming at the problem that the efficiency of identifying PAM sequences except NGG by wild type spCas9 protein is low, an active Cas9 mutant capable of identifying PAM sites except NGG is screened out, and the application field and the editing efficiency of a CRISPR gene editing system can be greatly expanded.

The invention discloses a method for screening by combining a space transcriptome and CRISPR (clustered regularly interspaced short palindromic repeats) in a same unbiased mode and application of the method in gene function verification, and belongs to the technical field of biology. The method comprises the following steps: infecting target cells with CRISPR screening library viruses; sorting out positively infected target cells, and culturing for a period of time after knockout; injecting the target cells obtained in the previous step into an experimental animal body, wherein the experimental animal is an animal with autoimmunity deficiency; taking out tissues infiltrated by the target cells, and preparing frozen sections; transferring the frozen section to a spatial transcriptome slide, and loading on a machine to prepare a spatial transcriptome cDNA library; constructing a common transcriptome library and a CRISPR sgRNA library by using the space transcriptome cDNA library; and respectively carrying out sequencing and gene sequence comparison on the common transcriptome library and the CRISPR sgRNA library to obtain common transcriptome sequencing data carrying space coordinates and CRISPR sgRNA library sequencing data carrying space coordinates.