1772results about "Library creation" patented technology

The disclosure provides systems and methods for droplet processing. For example, a method can include providing a first droplet and a second droplet. In some cases, the first droplet may have a first concentration of a reagent and the second droplet may have a second concentration of the reagent. The second droplet may comprise a bead or a biological particle. The method can also include subjecting the first droplet and the second droplet to conditions sufficient to transfer the reagent from the first droplet to the second droplet, thereby decreasing the first concentration in the first droplet and increasing the second concentration in the second droplet.

The invention relates to the technical field of high-throughput sequencing, and discloses a kit and a library construction method and a target variation detection and analysis method thereof, the kit comprises a pre-library construction reagent and a target region liquid phase hybridization capture reagent; wherein the pre-library construction reagent comprises a repair reagent, a joint, a connection reagent, an amplification reagent and purified magnetic beads; the target area liquid phase hybridization capture reagent comprises a hybridization reagent, a cleaning reagent, an amplification reagent, a purification magnetic bead, a target gene probe and a CNV / LOH probe. The invention provides a rapid, accurate and low-cost construction method of a library containing a targeting gene probe and a CNV / LOH probe and application of the library, through one-time library construction and sequencing, the advantages of a high-throughput targeting sequencing technology and a CNV-Seq technology are integrated; multi-gene point mutation, insertion and deletion, gene copy number variation, large-fragment copy number variation and heterozygosity deletion can be detected at the same time.

The invention provides a kit for detecting breast cancer through plasma miRNA isomer next generation sequencing. The kit provided by the invention comprises the primer for amplifying the miRNA isomer related to breast cancer, has the advantages of high sensitivity, high relative sequencing depth and high specificity, can detect miRNA which cannot be detected by a conventional method, avoids high-expression miRNA due to significant amplification, and can be used for detecting the miRNA in the same sequencing depth. For the same low-expression miRNA, a relatively high relative sequencing depth is obtained, and according to the technical scheme, the detection efficiency of breast cancer is greatly improved through a specific amplification technology.

The invention relates to a method for carrying out pathogenic microorganism identification and gene variation state joint detection on a pulmonary alveolar lavage fluid sample based on high-throughput sequencing. The method comprises the following steps: extracting nucleic acid from the pulmonary alveolar lavage fluid sample; constructing a metagenome capture library, and constructing a lung cancer polygene library; carrying out final library pooling; performing high-throughput sequencing; and analyzing data. Compared with the prior art, the scheme provided by the invention is based on a technical path of'macro 'captured by metagenome and'target' of targeted high-throughput sequencing; after the constructed final library is subjected to high-throughput sequencing and data analysis, index output (pathogenic microorganism identification, host chromosome copy number variation, gene mutation, gene fusion, gene copy number variation and methylation state) of multiple biomarkers can be met in one-time detection.

Strategies, systems, methods, reagents, and kits for phage-assisted continuous evolution are provided herein. These include strategies, systems, methods, reagents, and kits allowing for stringency modulation to evolve weakly active or inactive biomolecule variants, negative selection of undesired properties, and / or positive selection of desired properties.

The invention discloses preparation of a human CD56 immune phage display antibody library, which comprises the following steps: S1, animal immunization: expressing recombinant hCD56 protein in escherichia coli, then immunizing a Balb / c mouse, and detecting immune titer; s2, splenocyte preparation: extracting RNA (Ribonucleic Acid) of immune mouse spleen cells, and performing reverse transcription to obtain cDNA (Complementary Deoxyribonucleic Acid); s3, preparation of an initial bacteriophage display library: amplifying a heavy chain variable region and a light chain variable region by using a PCR technology, and then assembling to form scFv; constructing scFv phagocytids, electrically transforming the scFv phagocytids into TG1 competent cells, and constructing a bacterial library; s4, constructing a phage single-chain library of the hCD56: infecting the bacterial library by using a helper phage M13K07, and constructing a phage single-chain antibody library; and S5, elutriation and screening of a phage library: specifically enriching a phage single-chain antibody library, screening positive clones from the phage single-chain antibody library, and determining a sequence. According to the invention, the human hCD56 antibody scFv sequence fragment can be screened out, and the research and development period is shortened.

The invention belongs to the field of preparation of medical intermediates, and particularly relates to a preparation method of an On-DNA sulfinic acid structure compound. The method for preparing the On-DNA sulfinic acid structure compound comprises a step of oxidizing On-DNA thiol (phenol) into the On-DNA sulfinic acid structure compound under alkaline and heating or illumination conditions, a solvent used in the reaction step is a mixed solution of water, dimethyl sulfoxide, N, N-dimethylformamide, acetonitrile, ethanol or tetrahydrofuran, the reaction temperature is not more than 80 DEG C, and the reaction time is not more than 2 hours. And the illumination wavelength ranges from 365 nanometers to 535 nanometers. The On-DNA sulfinic acid structure compound obtained in the invention can be directly used for constructing a structure compound with a sulfonyl group, the reaction condition is mild and convenient, a new method and a new idea are provided for construction of a DNA coding compound library, and the On-DNA sulfinic acid structure compound has a very good application prospect in lead drug development.

The invention provides an HLA (human leukocyte antigen) gene amplification primer based on a third-generation sequencing platform and application of the HLA gene amplification primer. The HLA gene amplification primer comprises a composition of any one or more of nine groups of primers. The amplification primer designed aiming at the 11 target spot of the HLA not only realizes near full-length amplification of the HLA gene, but also improves the amplification specificity, and further improves the homogeneity of HLA gene sequencing data. Besides, the amplification primers aiming at 11 target spots of the HLA gene are in the same reaction system, so that one-tube detection is realized, and the operation is convenient.

The invention discloses a recombinant fusion protein of a human lambda light-chain single-chain antibody, a DNA (deoxyribonucleic acid) molecule, a library building method and application, and the recombinant fusion protein of the human lambda light-chain single-chain antibody is the recombinant fusion protein formed by connecting the human lambda light-chain single-chain antibody, phage Piii protein and luciferase, the amino acid sequence of the recombinant fusion protein of the human lambda light-chain single-chain antibody is shown as SEQ ID NO: 5, the recombinant fusion protein library of the human lambda light-chain single-chain antibody has large capacity, the established single-chain antibody TG1 library is more than 1 * 10 < 9 > cfu / mL, positive clones capable of being combined with ligands can be screened and enriched for multiple rounds, and the recombinant fusion protein library has the characteristics of high sensitivity, high signal-to-noise ratio and the like.

To provide a biochip and a manufacturing method in which the problem of overflow of a liquid specimen is avoided, and which can deal with a large amount of the liquid specimen.SOLUTION: A biochip comprises a substrate 110, an insulator layer IL, a semiconductor layer 120, a dielectric layer 130, a metal layer 140, and a protective layer 150. The semiconductor layer is disposed on the insulator layer, and has a reaction zone 121. The dielectric layer is disposed on the semiconductor layer, and has a first aperture O1. The metal layer is disposed on the dielectric layer, and has a source, a drain and a wall structure. The wall structure 141 surrounds the first aperture, the source and the drain. The protective layer is disposed on the metal layer, and has a flat part 151, a protruding part 152, a second aperture O2, and a third aperture O3. The flat part surrounds and defines the second aperture. The protruding part is disposed to correspond with the wall structure. The protruding part surrounds and defines the third aperture. The second aperture connects the third aperture and the first aperture, and allows the reaction zone to be exposed.SELECTED DRAWING: Figure 6

The invention discloses an animal-derived component identification primer based on a three-generation sequencing technology. The animal-derived component identification primer comprises a primer F as shown in SEQ ID No. 1, namely GTATGACCGCGGTGGCTGGCAC, and a primer R as shown in SEQ ID No. 2, namely CCAAACTGGGATTAGATACCC. The animal-derived component identification primer comprises a primer A, a primer B and a primer C, wherein the primer F is GTATGACCGCGGTGGCTGGCAC, and the primer C is CCAAACTGGGATTAGATACCC. Compared with a conventional DNA bar code method or a fluorescent quantitative PCR method, the primers designed by the invention can realize full-length mitochondrial amplification in different animal-derived DNAs, and the identification of animal-derived components is realized through a pair of primers, so that the detection efficiency of identification of fake animal-derived components in the field of public security food and medicine rings is improved. According to the primer pair designed by the invention, the amplification range covers all mitochondrial gene loci such as D-LOOP, COX1, COX2, COX3 and CYTB, and compared with a short fragment, the primer pair has higher species resolution.

The invention discloses a pig sperm specific antibody. The coding sequence of the antibody is shown as any one of SEQ ID No: 1-3. According to the method, the nano antibody library is prepared by immunizing alpaca with whole pig sperms, and then the antibody capable of being specifically combined with the X or Y sperms can be screened out through the library, so that sorting of the X and Y sperms is realized. The screened antibody is a nano antibody, the size of the nano antibody is only 10% of that of a traditional antibody, the structure is simpler, the advantages of high stability, strong specificity and low immunogenicity are achieved, large-scale expression of the antibody can be achieved, the production cost of the antibody is greatly reduced, and industrial application is facilitated.

The invention provides a method and a system for detecting the chimeric rate of human cells based on a micro haploid, and belongs to the technical field of chimera analysis. According to the invention, the micro haploid is innovatively adopted as a basic unit of the genetic marker, and different from the prior art in which DNA fragments containing the genetic marker are generally enriched through a multiplex PCR amplification technology, a probe targeted capture technology is introduced for enrichment; the limitation of the multiple PCR amplification technology on the number of markers and the potential influence of the PCR amplification efficiency difference on accurate quantification are effectively avoided; meanwhile, the invention further develops a special data analysis algorithm which is used for processing sequencing data and accurately calculating the chimeric rate. A verification result shows that the scheme of the invention has excellent reliability and accuracy, and the detection sensitivity reaches the highest level of similar products on the current market. Therefore, the method has a wide application prospect in the fields needing micro chimera detection, such as hematopoietic stem cell transplantation, organ transplantation and the like.

The invention discloses a barcode array repeatable chip and a preparation method and application thereof, and belongs to the technical field of gene sequencing and tissue cell sample analysis. The chip comprises a chip substrate, a universal primer probe and a bar code probe, the bar code probe comprises a Nick region, a capture region, a position bar code region and a molecular bar code region which respectively execute corresponding functions, and particularly, the Nick region is arranged, so that the chip can generate a repeatable bar code chip through SDA reaction, and the chip can be used for detecting the bar code of the chip. The bar code chip can be repeatedly used through DNA probe hybridization, polymerization extension and polymerization strand displacement. The chip has a simple structure, is easy to process, and can be used, so that the preparation of the bar code chip is realized at extremely low cost.

The invention provides a system and a method for screening Cas protein mutants capable of identifying different PAM sequences, and belongs to the technical field of bioengineering. The system comprises a Cas protein mutant screening vector and an sgRNA expression vector, the Cas protein mutant screening vector comprises the following expression elements: a Cas protein coding gene, a plasmid replicon and a first resistance screening tag expression cassette; the sgRNA expression vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third resistance screening tag expression cassette and an sgRNA expression cassette. According to the system and the method, aiming at the problem that the efficiency of identifying PAM sequences except NGG by wild type spCas9 protein is low, an active Cas9 mutant capable of identifying PAM sites except NGG is screened out, and the application field and the editing efficiency of a CRISPR gene editing system can be greatly expanded.

The invention provides a primer group for detecting a porcine epidemic diarrhea virus based on a whole genome, a library building method and application. The primer group comprises 27 pairs of primers, and sequences of upstream primers and downstream primers of the 27 pairs of primers are shown as SEQ ID NO.1-SEQ ID NO.54. The invention further provides a kit for detecting the porcine epidemic diarrhea virus based on the whole genome. The primer group disclosed by the invention has good specificity, sensitivity and repeatability, and has a good application prospect in amplification of the whole genome of the porcine epidemic diarrhea virus and preparation of reagents or kits required by amplification. The library building method provided by the invention comprises the following steps: carrying out multiple PCR amplification by using the primer group provided by the invention; the library building method is suitable for a next-generation sequencing platform and a nanopore sequencing platform, the automation degree is high, 95% or above of porcine epidemic diarrhea virus sequences can be obtained even in a sample with the virus content as low as 1 copies / microliter, and the sequencing depth can reach 1000 X or above.

The invention provides systems, methods, reagents, apparatuses, vectors, and host cells for the continuous evolution of nucleic acids. For example, a lagoon is provided in which a population of viral vectors comprising a gene of interest replicates in a stream of host cells, wherein the viral vectors lack a gene encoding a protein required for the generation of infectious viral particles, and wherein that gene is expressed in the host cells under the control of a conditional promoter, the activity of which depends on a function of the gene of interest to be evolved. Some aspects of this invention provide evolved products obtained from continuous evolution procedures described herein. Kits containing materials for continuous evolution are also provided.

The invention relates to a primer composition, kit and method for detecting benign and malignant thyroid nodule related gene mutation, and the primer composition comprises a primer pair for detecting benign and malignant thyroid nodule related gene DNA mutation and RNA fusion variation. The primer pair can be independently amplified, and can be used for performing efficient, high-sensitivity and high-specificity multiple amplification on DNA and cDNA templates to be detected under the same PCR reaction system and reaction program, and then the gene mutation condition of a related region can be obtained by constructing a library and sequencing, so as to assist clinical diagnosis of benign and malignant thyroid nodules. Moreover, specific nucleotide sequences are respectively connected to the 5'end of the upstream primer and the 3 'end of the corresponding downstream primer in a proper proportion in the primer composition, so that the homogeneity and specificity of multiple PCR amplification can be further improved, and the detected nucleic acid input amount and the lowest detection limit of mutation frequency (as low as 0.5%) are effectively reduced.

The invention discloses a liquid-phase hybridization probe pool for joint detection of multiple pathogens and drug-resistant genes. The liquid-phase hybridization probe pool is designed according to target areas of target pathogens and drug-resistant genes; the probe is a probe with unequal length of 30 to 100 nt; comprising a target specific sequence complementarily paired with a target region and a conjugate sequence complementarily paired between adjacent probes; the 5'terminal and the 3 'terminal of the probe are respectively modified with a conjugate sequence A and a conjugate sequence B, so that the adjacent probes can be specifically combined through terminal pairing; the conjugate sequence A is as shown in SEQ ID No. 601, and the conjugate sequence B is as shown in SEQ ID No. 602. According to the method, the constructed library and the specific probe pool are hybridized, so that the capture time is shortened to 30 minutes, and the method is obviously superior to a traditional method. Through optimization, the operation time and complexity are reduced, personal errors are reduced, meanwhile, high sensitivity and specificity are kept, target nucleic acid in a complex sample can be efficiently captured, a high-quality template is provided for subsequent sequencing, and combined detection of multiple respiratory pathogens and drug-resistant genes is supported.

The invention relates to a high-throughput cis-acting element screening carrier and a screening method. Specifically, the invention provides a plasmid vector system containing bar codes, each bar code in the system is in one-to-one correspondence with a candidate cis-acting element, and the activation multiple of the candidate cis-acting element can be obtained by measuring the abundance of the bar codes; in order to eliminate the influence of a bar code on the vector on a detection result, an exogenous intron which can be cut off during transcription is inserted into a coding region in the vector and is used for distinguishing vector DNA and RNA obtained by transcription. The screening method of the biological cis-acting element has high efficiency, wide applicability and high throughput, and has outstanding application value in biological research and breeding.

The invention relates to the technical field of polymerase, and provides a high-fidelity Pfu DNA polymerase mutant and a preparation method and application thereof.The mutant at least comprises one mutation of the following sites on the basis of wild-type Pfu DNA polymerase with the amino acid sequence shown as SEQ ID NO: 1: V82A, G211R, E383K, R594K and W616V. A plurality of mutant Pfu DNA polymerases with good enzyme activity and high fidelity are obtained by performing mutation modification on amino acids at multiple sites (V82A, G211R, E383K, R594K and W616V) of wild Pfu DNA, and mutants with five sites protruding all have the best enzyme activity and the highest fidelity and are suitable for a DNA sequencing technology, an NGS library building technology and the like.

The invention relates to a method for screening a human-mouse cross MR1 restriction high-affinity TCR (T cell receptor) by using a phage display technology, and relates to the technical field of T cell receptors. According to the invention, a phage display technology is utilized to prepare an MAIT cell single-chain T cell receptor (scTCR) phage library, the scTCR phage library is subjected to biological elutriation through an MR1 / 5-OP-RU tetramer, and Phage-ELISA identifies that TCR6 clone (TCR6) has specific binding with human and mouse MR1 / 5-OP-RU and has higher affinity compared with other clone.

The present invention provides engineered transposase polypeptides useful in preparation of next generation sequencing libraries, as well as compositions, methods of utilizing these engineered polypeptides, and polynucleotides encoding the engineered transposases. The present application further relates to methods for using engineered transposases, e.g., in the preparation of nucleic acid libraries for nucleic acid sequencing. More specifically, the invention pertains to methods that use engineered transposases having improved performance to improve the transposition reactions during the preparation of nucleic acid libraries.

The invention discloses a novel single-cell CRISPR screening library. The invention provides a double-gRNA expression cassette, a double-gRNA expression cassette vector for single-cell CRISPR (clustered regularly interspaced short palindromic repeats) screening and a construction method of a single-cell CRISPR screening library. According to the CRISPR screening library constructed by the method, the single-cell CRISPR screening range can be expanded from a protein coding gene to ncRNA, and the ncRNA can be knocked out.

The invention provides a nucleic acid sequencing pretreatment workstation and a sequencing pretreatment method, the nucleic acid sequencing pretreatment workstation comprises: a nucleic acid extraction system configured to controllably extract nucleic acid molecules from a biological sample; the library construction system is configured to controllably prepare the nucleic acid molecules into a library capable of being used for on-machine sequencing; the quality control system is configured to controllably detect the concentration of the nucleic acid extraction product and add a homogenization reagent into the nucleic acid extraction product according to a detection result and library construction sample loading parameters; and / or, controllably performing concentration detection on the library construction product, adding a homogenization reagent into the library construction product according to a detection result, and diluting the library construction product to the concentration required by nucleic acid sequencing. According to the technical scheme, through the cooperation of the nucleic acid extraction system, the quality control system and the library construction system, the operations of nucleic acid extraction, nucleic acid extraction product substance control, library construction, library file product substance control and the like are realized, the automation degree of nucleic acid sequencing pretreatment is improved, and the consistency of nucleic acid sequencing is improved.

The invention belongs to the technical field of biological detection, and relates to a capture probe, a kit comprising the same and application of the capture probe in detection of T cell and B cell immune repertoire under spatial resolution. The capture probe comprises a transcript specific sequence; the transcript specific sequence is derived from the front 40 bp of a reverse complementary sequence of a J region transcript sequence, and the length of the transcript specific sequence is 20-35 bp. The advantages of using the capture probe to detect T cell and B cell immune repertoire under spatial resolution include that not all RNA with poly A tail is reversely transcribed, but only targeted RNA is reversely transcribed, so that the sequencing cost is remarkably reduced, and the detection is not limited by the poly A degradation degree of RNA in a sample.

The invention belongs to the technical field of molecular markers, and particularly relates to a rubber tree chloroplast SNP marker-based rubber tree B-type cultivated variety identification method, 19 SNP loci are involved in total, an SNP marker combination provided by the invention can be used for identifying rubber tree varieties with higher yield, and by utilizing the SNP marker combination provided by the invention, the yield of the rubber tree varieties is increased. And variety improvement and new variety breeding can be more accurately carried out, so that good varieties with higher yield are selected, and the planting benefits of the rubber trees are improved.

The invention relates to a method for producing nano-arrays and micro-arrays. The method described herein provides a method of generating an array of spatially separated proteins. The method relies on covalently attaching each of a plurality of proteins to a structured nucleic acid particle (SNAP) and attaching the SNAP to a solid support.

The invention provides a macro virus group sequencing library construction method for removing host ribosome RNA through an enzyme method and a kit, and belongs to the technical field of biology. The method comprises the following steps: hybridizing total RNA (Ribonucleic Acid) of a sample with a DNA (Deoxyribose Nucleic Acid) probe aiming at host ribosome RNA to form a DNA / RNA hybrid chain; rNase H is used for digesting RNA in the hybrid chain, and DNase I is used for digesting the remaining DNA probe in the system; purifying to obtain virus RNA (Ribonucleic Acid); carrying out fragmentation treatment on the virus RNA; carrying out reverse transcription on the fragmented RNA to synthesize a first chain cDNA, then synthesizing a second chain cDNA, and carrying out terminal repair and dA tail addition to obtain double-chain cDNA; connecting the linker with the dT tail with the double-chain cDNA; and carrying out PCR amplification and purification on the connection product to obtain the macro virus group sequencing library. According to the construction method and the kit, the problem that the full-length sequence of the virus cannot be obtained from a low-load sample can be solved.

The invention provides a space transcriptome high-throughput sequencing method based on a laser microdissection system and DNA bar code marking and application of the space transcriptome high-throughput sequencing method, and particularly belongs to the technical field of gene sequencing. The high-throughput sequencing method for the space transcriptome comprises the following steps: synthesizing a DNA space bar code by a two-step method; mixing the DNA space bar code and a cell lysis solution with a single cell, and carrying out lysis, mRNA capture, reverse transcription and PCR amplification to obtain cDNA; cDNA library construction and sequencing are carried out, sequencing results are processed, and spatial transcriptome data analysis is carried out. The space transcriptome high-throughput sequencing method disclosed by the invention has relatively high cell throughput and can obtain single cell spatial resolution.