16 results about "Single species" patented technology

The invention discloses a carbapenemase OXA-58-like positive plasmid and a host bacterium propagation risk assessment method thereof, which are used for carrying out integrated assessment on the plasmid and the host bacterium in three dimensions of drug resistance, pathogenic potential and propagation potential, and carrying out comprehensive risk grading and classification by taking the OXA-58-like positive plasmid and the host bacterium thereof as a plasmid-host complex. The invention develops a set of OXA-58-like gene screening and systematic analysis process based on a public plasmid database aiming at the defects that the existing research of the OXA-58-like gene is mostly limited to a single species or a local sample and a standardized automatic analysis method is lacked. According to the method, all OXA-58-like gene positive plasmids in a database can be subjected to unified and efficient drug-resistant gene mining, the association rule between the drug-resistant genes and plasmid pedigree, host strains and geographical distribution is systematically disclosed, and important technical support is provided for drug resistance propagation monitoring and risk assessment.

The invention discloses dsRNA / fused dsRNA and application of the dsRNA / fused dsRNA in prevention and treatment of spider mites, the dsRNA is dsRpt3, and the fused dsRNA is obtained by fusing dsRNA of a plurality of genes of the same gene family of targeted spider mites; the gene family is selected from a proteasome ATP enzyme family and an apolipoprotein family; the nucleotide sequence of one chain of the fused dsRNA is as shown in any one of SEQ ID NO.1-4. The invention also discloses a preparation method of the fused dsRNA. Compared with the existing dsRNA for preventing and treating a single variety of spider mites, the dsRNA / fused dsRNA can prevent and treat various spider mites at the same time, is expected to be applied to preparation of biopesticides for preventing and treating spider mites, reduces the use of chemical pesticides, protects the environment, and reduces the damage of the chemical pesticides.

The invention belongs to the technical field of ecological restoration, and particularly relates to a method for restoring vegetation of a transformer substation in a high-altitude cold and arid region. The method comprises the following steps: 1) soil preparation and fertilization, and growing point planning; 2, holes are formed in the growing points, and seedlings are planted after a growth promoter is put in the holes; and 3) growing point management. According to the method, within 60-90 days, the vegetation coverage of the exposed ground surface of the transformer substation in the cold and arid region can reach the coverage degree larger than or equal to 95%, the height smaller than or equal to 15 cm, the landscape is uniform, and the overwintering survival rate is larger than or equal to 92%; reseeding is not needed in the planting period; single species, low plants and few vertical wilt objects meet the fireproof requirement of the transformer substation; the total cost is reduced by more than 40% compared with the traditional turf laying method; the whole process is less in irrigation, only 2-3 times of water replenishing are needed, water is saved by more than 80%, the defects of slow lawn building, difficulty in overwintering and high maintenance cost in the prior art are overcome, and the method has practical popularization and application value.

Provided is an array including a solid support having a surface, the surface having a plurality of wells, the wells containing a gel material, the wells being separated from each other by interstitial regions on the surface, the interstitial regions segregating the gel material in each of the wells from the gel material in other wells of the plurality; and a library of target nucleic acids in the gel material, wherein the gel material in each of the wells comprises a single species of the target nucleic acids of the library. Methods for making and using the array are also provided.

The invention relates to the technical field of nucleic acid detection, and discloses a method and a device for detecting and distinguishing ginseng and American ginseng and terminal equipment, and the method comprises the following steps: enriching specific DNA fragments of ginseng and American ginseng by using a multi-enzyme isothermal amplification technology, and screening high-specificity crRNA by combining with a PAM sequence of Cas protein. During detection, a two-channel detection system is constructed by using crRNA, Cas protein and a test probe; after the crRNA accurately recognizes a target sequence in a to-be-tested sample according to a base complementation principle, the trans-cleavage function of the Cas protein is activated, and the test probe is cleaved to form a visual signal. Through two-channel logic, not only can single species be identified, but also a mixed adulteration sample can be identified, the method has the advantages of high sensitivity, strong specificity, constant temperature in the whole process, no need of a precise variable temperature instrument and the like, the problem of interference of near-source species is effectively solved, and simple, convenient and rapid detection of ginseng and American ginseng is realized.

The invention discloses a community level grassland plant competition intensity calculation method, and belongs to the technical field of botany. According to the method, the problem that the existing method is lack of calculating the competitive strength of the plants on the community level is solved, the relative coverage and the relative height of the species in each investigation quadrat are calculated by acquiring the coverage and height data of each plant species in the grassland plant community in the target area, and then the potential growth coverage and the potential growth height are calculated, so that the competitive strength of the plants is calculated. And finally obtaining the plant competitive strength. Therefore, the limitation that a traditional method only pays attention to the competition relation of a single species or a few species is broken through, and the actual influence of competition on species growth can be accurately reflected; by introducing the historical data and the preset threshold value, the community can be more accurately divided into the high-competition area and the low-competition area, and the competition driving factors of different areas are identified, so that a more targeted strategy is provided for grassland management, and the stability and biodiversity of a grassland ecosystem can be effectively improved.

The present application relates to the field of ecological restoration of coastal salt marsh wetlands, and specifically discloses a recovery mode for high-tide beach areas based on a variety of salt marsh vegetation communities, comprising: selecting or artificially constructing a high-tide beach habitat suitable for salt marsh vegetation recovery; determining the planting location and distribution of the salt marsh vegetation combination according to the habitat conditions; laying out a device for preventing damage by pigs before transplanting; tracking, monitoring and maintaining the growth of the salt marsh vegetation combination after planting to evaluate its survival rate; the present application combines native plants such as reeds, and plants reed canary grass and tamarisk together to enrich the shore plant in a way to form multi-level plant buffer zones such as "grass-grass" and "grass-shrub" to enhance the stability and resilience of the coastline, and at the same time achieve the purpose of improving the carbon sink effect. This configuration and combination recovery mode breaks the previous recovery mode mainly based on a single species, and provides new strategies and modes for native plant replacement after the removal of spartina alterniflora and the development of coastal wetland ecological restoration technology.

The invention relates to the field of coastal salt marsh wetland ecological restoration, and particularly discloses a high tidal flat area restoration mode constructed based on multiple salt marsh vegetation communities, which comprises the following steps: selecting or artificially constructing a high tidal flat habitat suitable for salt marsh vegetation restoration; according to habitat conditions, determining planting positions and distribution of salt marsh vegetation combinations; arranging an anti-alternanthera philoxeroides device before transplanting and planting; after planting, the growth condition of the salt marsh vegetation combination is tracked, monitored and maintained to evaluate the survival rate of the salt marsh vegetation combination; according to the method, the local plant reed is combined, the arundo donax and the tamarix chinensis are planted in a matched mode, multi-layer plant buffer areas such as grass-grass and grass-shrub are formed in the mode of enriching the coast zone plants, so that the stability and toughness of the coast line are enhanced, and meanwhile the purpose of improving the carbon sink effect is achieved; the configuration combined recovery mode breaks through the previous recovery mode taking a single species as a main body, and provides a new strategy and mode for replacing local plants after the spartina alterniflora is removed, developing a coastal wetland ecological recovery technology and the like.

The present invention relates to an intelligent fish community stability evaluation method and system based on a network model, the method comprising optimizing species distribution data based on the impact of a single species on community biodiversity and the impact of interspecific interactions on community structure, obtaining species distribution optimization data and constructing a community association network model; using a PCoA method to quantify the functional diversity overlap of species and construct a functional niche network model; constructing a comprehensive network model based on the community association network model and the functional niche network model; constructing a radar chart based on the community association network model, the functional niche network model and the comprehensive network model, and evaluating network stability based on the radar chart area method. The present invention can better reflect the lack of species interaction relationships caused by incomplete sampling, make the network structure more complex and closer to the actual situation, can deeply explore the interaction relationships between species, and improve the accuracy of evaluation results and the comparability between different biological community networks.

Provided is an array including a solid support having a surface, the surface having a plurality of wells, the wells containing a gel material, the wells being separated from each other by interstitial regions on the surface, the interstitial regions segregating the gel material in each of the wells from the gel material in other wells of the plurality; and a library of target nucleic acids in the gel material, wherein the gel material in each of the wells comprises a single species of the target nucleic acids of the library. Methods for making and using the array are also provided.

The invention discloses an evaluation method for food web stability. The evaluation method comprises the following steps: firstly, carrying out sample collection, pretreatment and stable isotope analysis; secondly, the nutrition level is calculated, and different food web models like food webs in different periods in the same region are constructed; thirdly, introducing a network global efficiency index, calibrating the global efficiency of the stable food web, carrying out a node removal experiment, accurately calculating the network global efficiency change after a single species is removed, and repeating the steps until each species is removed once, thereby obtaining network global efficiency data sets corresponding to different food webs; and finally, through Spearman correlation analysis, scientifically exploring the stability of the food web similar to the stable food web species composition. According to the method, a brand new method for evaluating the stability of the food web is created, the limitation that the stability of the food web is evaluated only depending on a single index in previous research is broken through, and multi-dimensional quantitative analysis on the stability of the food web is achieved.

The invention relates to the technical field of molecular biology, and particularly discloses a minisize bar code primer for identifying environmental DNA species of black neck and associated birds thereof and a design method and an identification method thereof, the primer comprises an upstream primer SEQ ID NO.1 and a downstream primer SEQ ID NO.2, the upstream primer SEQ ID NO.1 is 12S-3UF1: ACCGCGGTCATACAAGAGAC, the downstream primer SEQ ID NO.2 is 12S-3UF1: ACCGCGGTCATACAAGAGAC, and the downstream primer SEQ ID NO.2 is 12S-3UF1: ACCGCGGTCATACAAGAGAC; 1, and the SEQ ID NO. 2 is as follows: 12S-3UR1: GCGTTTGTGCTCGTAGTTCTC, and the SEQ ID NO. The miniature barcode primer pair for species identification of the environmental DNA of the black neck crane and the associated birds of the black neck crane can be used for respectively detecting a single species or a combination of various species in the black neck crane and the associated birds of the black neck crane, and the primer pair provided by the invention is accurate and effective in laboratory detection and has a good reference value for identification of environmental DNA samples of the black neck crane and the associated birds of the black neck crane.

The present invention discloses a method for evaluating the biological enrichment effect of marine pollutants based on consecutive trophic levels, belonging to the technical field of marine pollution monitoring. The method of the present invention is to collect marine biological samples from the target sea area to be measured, and detect the nitrogen stable isotope ratio δ<supgt;15< / supgt;N and the concentration of pollutants in the samples; calculate the trophic level characteristic value, the trophic magnification factor and the target risk coefficient, which are used to evaluate the distribution trend of marine pollutants on consecutive trophic levels of the food chain, whether the pollutants are enriched and amplified or gradually diluted on consecutive trophic levels of the food chain, and the health risk of the pollutant content to humans. Compared with the traditional species-based pollutant concentration and risk assessment, the method of the present invention can avoid the underestimation of the risk after the higher trophic level individuals with higher pollutant concentrations in a single species are averaged, and can more accurately reflect the enrichment and accumulation effects of pollutants on the food chain.

The present application belongs to the technical field of ecological risk assessment, and specifically relates to an antibiotic ecological risk assessment method and system based on coupling of blue-green algae and green algae. The concentration of antibiotics in a water environment to be detected is monitored; growth inhibition experiments of green algae and blue-green algae are respectively carried out under a set antibiotic concentration gradient; a half effect concentration of the blue-green algae and the green algae is respectively obtained according to a relationship curve between algal density and antibiotic concentration; a relationship formula between an exposure concentration and a growth rate of the green algae or the blue-green algae is derived according to a Hill function; and the antibiotic exposure concentration is calculated in combination with a mixed growth rate formula; and finally, the ecological risk grade of the antibiotic in the water environment is evaluated according to a risk entropy value method. Compared with a single species evaluation method, the present application can more truly reflect the response characteristics of algal communities in natural water bodies to antibiotics, and provides a scientific basis for antibiotic ecological risk judgment and environmental threshold setting.

This invention provides an online enrichment and automatic sorting device and method for deep-sea microorganisms under high pressure. It simulates the high pressure and unique temperature environment of the deep sea for multi-stage enrichment. Simultaneously, based on changes in environmental indicators observed online within the enrichment device, it automatically determines the optimal time point for microbial passage and transfers the culture to the next stage of the enrichment device. This effectively solves the problems of difficulty in transferring microorganisms at the optimal time point and complex manual operation in high-pressure environments, thus improving the initial enrichment efficiency for obtaining single species of deep-sea microorganisms. Furthermore, this invention solves the problems of overlapping single colonies and low separation, complex manual operation, and difficulty in automatic secondary sorting under high pressure by automatically streaking the enriched material in the culture medium under high pressure, as well as automatically transferring specific single colonies to a pure culture vessel. This significantly improves the efficiency of deep-sea microorganism sorting under high pressure.

The invention discloses an environmental DNA detection method based on benthonic animal primer optimization, and belongs to the technical field of environmental damage investigation and identification, and the environmental DNA detection method comprises the following steps: determining a species directory of benthonic animals in a target area through literature retrieval and arrangement, searching and downloading corresponding species sequence information, collecting benthonic animal universal primers, and determining the species directory of the benthonic animals in the target area. The universal primers are compared with all species sequence information one by one, the matching rate of each primer to all known sequences of each species is calculated, and the two primers with the highest matching rate are designed and optimized to form a pair of optimized primers, namely COIAF: 5 '-CCTAYGGGRBGCASCAG-3'; mlCOIintR: 5 '-GGACTACNNGGGTATCTAAT-3', and mlCOIintR: 5 '- The method comprises the following steps: collecting a benthonic animal sample in a target area, respectively selecting two layers of test samples of a single species and a natural sample, extracting sample DNA, amplifying a target fragment DNA sequence by adopting a preferred primer, and carrying out quality verification on the preferred primer from two layers, and the preferred primer is applied to the amplification of benthonic animal environment DNA. The sensitivity of the environment DNA technology on the detection of the rare species of the benthonic animals can be improved.