190 results about "Mutation type" patented technology

The invention relates to the field of medicinal chemistry, relates to a general KRAS inhibitor and medical application thereof, and particularly relates to a compound targeting KRAS and mutants KRASG12C and KRASG12D thereof and medical application of the compound. The pharmacological test result of the affinity of KRAS and mutants thereof shows that the affinity of the compound to a KRAS wild type and a KRASG12C mutant type thereof and a KRASG12D mutant type thereof is superior to that of a lead compound, and the compound has a potential inhibition effect on target spots of the KRAS wild type and the KRASG12C mutant type thereof and the KRASG12D mutant type thereof.

The invention belongs to the technical field of gene editing, and particularly relates to a poa pratensis gene editing method. The invention provides a bluegrass CRISPR / Cas9 gene editing system, which comprises a pCAMBIA1300-Cas9 vector, a bluegrass gene PpTCP4 target sequence and a primer pair for amplifying the bluegrass gene PpTCP4 target sequence, the gene PpTCP4 of the bluegrass is directionally edited by utilizing a CRISPR / Cas9 gene editing technology, gene editing of a base mutation type is realized, a gene editing plant is successfully obtained, and the gene editing effect is good. The gene editing efficiency is 0.67%, and new research basis and technical reference are provided for developing the directional improvement of the poa pratensis to create high-quality germplasm resources.

The invention discloses a method for constructing a Ddx58-R109C point mutation mouse model by using a CRISPR / Cas9 gene editing technology and an application of the Ddx58-R109C point mutation mouse model. The method comprises the following steps: (1) target construction: searching a CDS region of a Ddx58 gene, determining an exon part, and determining a gene mutation site; (2) obtaining a fertilized egg, and injecting Cas9mRNA, gRNA and donor oligo into the fertilized egg of the C57BL / 6J mouse together in vitro through a microinjection technology to obtain an F0-generation hybrid mouse; (3) mating the F0-generation hybrid mouse with the wild type mouse to obtain an F1-generation mouse; (4) the F1-generation heterozygous mice which are identified to be positive are subjected to mating, and homozygous Ddx58-R109C mutant type and wild type mice can be obtained by breeding obtained offspring; (5) phenotypic analysis shows that Ddx58-R109C point mutation mice can have pathological changes of systemic lupus erythematosus and lupus nephritis; the invention can provide an effective research approach and method for researchers to deeply explore the action mechanism of Ddx58-R109C mutation in diseases, and has important significance for explaining the pathogenesis of systemic lupus erythematosus and researching and developing targeted therapeutic drugs.

The invention discloses a sorghum dwarf gene PCR (Polymerase Chain Reaction) detection primer and application thereof, and belongs to the technical field of biology. The specific PCR primer is designed and compared with a wild sorghum sequence after being subjected to PCR amplification, so that whether a germplasm resource contains the dwarf gene or not can be determined, the mutation site and the mutation type of the dwarf gene can be determined, and a foundation is laid for quickly screening dwarf sorghum varieties, performing cross breeding in the next step and the like.

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of fir and tiger hybrid spots and application, and relates to the technical field of SNP molecular markers. The SNP molecular marker comprises any one of SNP1, SNP2 and SNP3, the SNP1 is located at the 169th site of a sequence as shown in SEQ ID NO: 1, and the mutation type of the SNP1 is T / C; sNP2 is located at the 226 site of the sequence as shown in SEQ ID NO: 1, and the mutation type of SNP2 is C / A; the SNP3 is located at the 177th site of a sequence as shown in SEQ ID NO: 2, and the mutation type of the SNP3 is A / G. The SNPs sites screened by the invention are obviously related to the growth traits of the fir-tiger hybrid spots, and a molecular marker is provided for breeding individuals with excellent growth of the fir-tiger hybrid spots.

The invention discloses a protein mutation stability prediction method based on generative adversarial network data generation, and belongs to the technical field of biological information, and the method comprises the following steps: constructing a protein mutation data set; extracting protein features from the Megascall data set and the protein mutation data set; performing five-fold cross validation on the generative adversarial network, and storing a generator G; generating a mutation sample through a generator G; constructing a downstream task network model; optimizing downstream task network model parameters through an adaptive gradient method; calculating evaluation index verification model performance through the verification set; and realizing prediction through a downstream task network model. A protein mutation sample is generated by applying the generative adversarial network, so that the problem of data scarcity in protein stability research is effectively solved; the generative adversarial mechanism is combined with the cyclic consistency loss, so that the high quality of the generated data is ensured, the data set is successfully expanded, and the adaptability of the model to different mutation types is improved.

The invention relates to the field of biotechnology and enzyme engineering, and discloses a PET hydrolase variant and application thereof. Compared with a sequence 2, the amino acid sequence of the PET hydrolase mutant has more than 96% of identity, mutations of W104L, D238K, A251C and A281C exist at the 104th site, the 238th site, the 251th site and the 281th site of the sequence 2 at the same time, and compared with PET hydrolase shown in the sequence 2, the PET hydrolase mutant has improved PET degradation catalysis activity. Compared with a wild type PET hydrolase, the mutant type PET hydrolase provided by the invention has the advantages that the PET degradation activity is obviously improved, and the mutant type PET hydrolase has application value.

The invention relates to the technical field of in-vitro diagnosis, in particular to a new bunyavirus antibody and application thereof. The invention provides a novel bunyavirus antibody and application thereof. The new bunyavirus antibody obtained by screening can be specifically combined with different mutation types of new bunyavirus, is high in sensitivity and strong in specificity, and has a very good market application prospect. The detection sensitivity of the SFTSV is measured by using a double-antibody sandwich method, and the result shows that the antibody detection sensitivity of the novel bunyavirus provided by the invention is as low as 0.5 ng / mL, and the novel bunyavirus can be used for early diagnosis and detection of the SFTSV.

The invention is applicable to the technical field of biomedicine, and provides a method and a kit for detecting KCNJ5 gene mutation, and the method comprises the following steps: extracting a cfDNA sample; the method comprises the following steps: carrying out PCR (Polymerase Chain Reaction) amplification reaction by using a specific primer and a probe aiming at a KCNJ5 gene mutation site and taking a sample as a template; the specific primers and probes aiming at the mutation site of the KCNJ5 gene comprise specific primers and probes aiming at the mutation site of the G151R (c.451Ggt; the invention relates to a specific primer and a probe for G151R (c.451Ggt; the invention relates to a specific primer and a probe of L168R (c.503Tgt; C), aiming at L168R (c.503Tgt; g), a specific primer and a probe; sequencing a PCR amplification product, analyzing a sequencing result, and determining whether the KCNJ5 gene mutation exists or not. According to the invention, high-sensitivity and high-specificity detection of KCNJ5 gene mutation is realized by combining the specific primer and the probe with a digital PCR technology, and three main mutation types of the KCNJ5 gene can be detected at 0.01% mutation allele frequency level.

The invention relates to a detection kit for combined methylmalonemia, which is a cb1C type kit and comprises a specific primer pair and a probe combination for detecting at least one mutation site of MMACHC, the mutation site is selected from c.609Ggt; a is c.567 dupT, c.658660delAAG, c.482Ggt, and c.482Ggt; a, c.1Agt; g, c, 80Agt; g, c, 217Cgt; 315Cgt, T, c.315Cgt; g and c.394 Cgt; t). The MMACHC gene hotspot mutation region detection kit based on the real-time fluorescent quantitative PCR technology can detect multiple mutation sites on the MMACHC gene at the same time, detection of three genotypes of wild type, homozygous mutant type and heterozygous mutant type on each mutation site is completed, the gene detection requirements of clinical combined type MMA are effectively met, the detection time is shortened, and the detection efficiency is improved. The mutation site coverage rate of CblC defective methylmalonic acidmia combined with homocysteinemia on the MMACHC gene is increased to 93.28%, mutation hot spots of most people are covered, and various types of mutation conditions in hot spot mutation areas can be rapidly, accurately and sensitively detected.

The invention discloses an application of ARN2966 in the treatment of UMOD (Urban Molecular Orthodontic Disease) gene mutant autosomal dominant hereditary renal tubular interstitial nephropathy (ADTKD), and belongs to the field of biomedicine. The ARN2966 has the advantages that the ARN2966 can be used for the treatment of UMOD gene mutant autosomal dominant hereditary ADTKD, and the ARN2966 can be used for the treatment of UMOD gene mutant autosomal dominant hereditary ADTKD; the application comprises the application of the amyloid precursor protein (APP)-CD74 signal axis blocking agent in the preparation of the medicine for treating the hereditary tubulointerstitial nephropathy, and the application comprises the application of the amyloid precursor protein (APP)-CD74 signal axis blocking agent in the preparation of the medicine for treating the hereditary tubulointerstitial nephropathy. Compared with the prior art, the key effect of an APP-CD74 signal axis in ADTKD-Umod pathogenesis is disclosed for the first time, and ARN2966 provides a brand new intervention strategy for treatment of ADTKD-Umod through targeted regulation and control of the pathway. Compared with a broad-spectrum anti-inflammatory drug, the ARN2966 has high targeting specificity, and side effects caused by non-specific immunosuppression can be avoided. Although the ARN2966 does not enter a clinical research stage at present, due to the unique action mechanism and verified safety characteristics of the ARN2966, the ARN2966 has remarkable transformation medical value and clinical application prospect in the aspect of developing ADTKD-Umod targeted therapeutic drugs.

The invention relates to a PDC (Polycrystalline Diamond Compact) cell carrying a bar code DNA (Deoxyribose Nucleic Acid) tag convenient to track as well as a preparation method and application thereof, and belongs to the technical field of The invention provides an isolated culture method of PDC primary cells, and provides a method for constructing recombinant PDC cells containing bar code DNA tags. According to the PDC primary cell culture system, the cell caking rate is reduced, the cell viability and the adherence rate are improved, and continuous passage to 20 generations or above can be achieved. The PDC primary cells faithfully retain the heterogeneity of clinical tumor samples in the aspects of mutation types, tumor generation and development mechanisms and the like. The bar code DNA tag introduced into the PDC cell can be detected by carrying out targeted sequencing and single cell RNA sequencing on a bar code DNA tag sequence in cell genome DNA, so that different clone groups reserved from PDX of the PDC cell line are conveniently distinguished and tracked in a high-throughput manner.

Neonatal congenital digestive tract obstruction is digestive system structural deformity caused by various factors in the fetal development process, the invention provides a method for establishing a zebra fish model for neonatal congenital digestive tract obstruction, a gRNA target sequence is designed on an amino acid structural domain of a zebra fish ZIC3 gene, the specific sequence of sgRNA is GCGCCATAAGGTTCCGTACGAGG-3 or GCCCCGGACCATGGTGTGGGG, and a primer is synthesized; the ZIC3 mutation zebrafish juvenile fish grows to 6-7 days, and the zebrafish with the effective mutation type in embryo detection is obtained through multi-step detection.

The invention relates to an SNP (Single Nucleotide Polymorphism) molecular marker closely linked with a pepper color value character and application of the SNP molecular marker, a nucleotide sequence of the SNP molecular marker comprises at least one of 254720000 base and upstream and downstream bases thereof and 254890442 base and upstream and downstream bases thereof on a pepper chromosome 3, the 254720000 base is marked as R1, the mutation type of the R1 is T or A, and the mutation type of the R1 is T or A; the 254890442nd base is marked as R2, and the mutation type of the 254890442nd base is C or T. The SNP molecular marker provided by the invention can be used for screening and identifying high-color-value pepper varieties, and the molecular marker-assisted selection breeding efficiency of target traits can be accelerated; the SNP molecular marker is directly expressed in the form of DNA, can be detected in each development stage and in different tissues and organs of the pepper, is not limited by environment and seasons, is not influenced by the problems of whether expression or not and the like, and has the advantages of simplicity in operation, accurate amplification result and lower cost of required reagents.

The invention discloses an InDel molecular marker combination and application of the InDel molecular marker combination in heterologous cell therapy pharmacokinetic detection. The InDel molecular marker combination is selected from one or more of 161 InDel loci on a human chromosome; relative to a reference genome hg19, position information and mutation types of the 161 InDel sites are shown in a table 1. The InDel molecular marker combination can be used for distinguishing donor cells and recipient cells for cell therapy, different donors and recipients are detected by adopting the InDel molecular marker combination, after a specific InDel site is selected, the mutation frequency of the InDel site of a sample (the recipients subjected to cell therapy) after medication is detected, and the mutation frequency of the InDel site is detected. According to the InDel site mutation frequency, the proportion of heterologous cells in the sample can be calculated, the problem that no mature analysis method exists in heterologous cell therapy pharmacokinetic research is effectively solved, and the InDel molecular marker combination can also distinguish donors and receptors with fewer sites.

The application belongs to the field of genetic engineering and genetic breeding, and particularly relates to a high-temperature response gene HSP70 expression regulation SNP marker of Crassostrea gigas and application of the SNP marker in identifying high-temperature resistant oyster individuals. The SNP marker is the 251th base in the sequence shown in SEQ ID NO: 2, and the mutation type is C / G (trans-regulation site Marker13973). The application provides a SNP marker which is significantly related to the expression of the HSP70 gene, and the advantage of the application is that the genotype of parent oysters can be identified before seed breeding, and the tolerance of offspring to high-temperature environment is improved. The SNP marker obtained in the research has high reliability and stable results.

The invention provides a high-throughput DNA (deoxyribonucleic acid) detection method, platform, probe composition and kit for hereditary hemoglobinopathy. The high-throughput DNA detection method comprises the following steps: S1, designing probes for detecting known and unknown mutations in abnormal hemoglobinopathy related genes according to a specific rule; s2, synthesizing a probe; s3, extracting genome DNA from peripheral blood of a patient, constructing a library, hybridizing and capturing a target sequence, recovering a target region library, and performing library quality detection; s4, loading the library into a sequencing platform for high-throughput sequencing to obtain sequencing original data; and S5, performing data analysis on the sequencing original data. According to the application, a probe with a special sequence is designed, and sequencing data is subjected to information analysis, so that multiple hemoglobin mutation types can be detected at the same time, the detection efficiency and coverage are greatly improved, missing detection is avoided, and differential diagnosis can be performed on diseases with similar clinical manifestations.

The invention relates to a detection marker and a detection device for identifying primary and intrawall metastasis of esophageal multifocal squamous carcinoma, and belongs to the technical field of cancer detection markers. According to the invention, a detection site set composed of 20 genes is constructed, and the gene diagnosis purpose of distinguishing primary and intrawall metastasis of esophageal multi-lesion squamous cell carcinoma is realized by analyzing the difference of mutation types on lesions.

The present application relates to the technical field of gene mutation prediction, and discloses a gene mutation prediction method generated by multi-mode annotation, and the specific process comprises the following steps: carrying out mutation type annotation on input single-base mutation position information to obtain mutation basic information containing mutation types, then using an ANNOVAR annotation tool, SpliceAI splicing effect prediction software and reference mutation information of a function effect database to carry out multi-dimensional feature annotation, using Bayesian PCA based on the obtained multi-dimensional feature mutation data set to fill in the annotation data, then using an automatic engineering feature list and a separated feature selection list to carry out feature combination and screening, and obtaining a gene mutation prediction score after gradient generation tree algorithm. The present application can be used for predicting all non-synonymous exon mutations, has good performance in classifying rare benign mutations, and can identify a small amount of mutations with high pathogenic probability from a large amount of candidate mutations.

The present application relates to the technical field of in vitro diagnosis, in particular to antibodies of new bunyavirus and application thereof. The present application provides antibodies of new bunyavirus and application thereof. The antibodies of new bunyavirus screened by the present application can specifically bind to new bunyavirus of different mutation types, have high sensitivity and strong specificity, and have good market application prospect. The detection sensitivity of SFTSV is determined by using a double-antibody sandwich method, and the results show that the antibodies of new bunyavirus provided by the present application have a detection sensitivity as low as 0.5 ng / mL, and can be used for early diagnosis and detection of SFTSV.

The invention discloses a primer probe and a kit for detecting H3F3A gene mutation and its application, wherein the H3F3A gene mutation type is K27M, G34R and G34V mutation. The kit comprises a set of primer probe groups for detecting H3F3A gene mutation and a universal reference gene primer probe group, wherein the primer probe group for detecting H3F3A gene mutation comprises specific upstream primers for K27M, G34R and G34V mutations, a universal downstream primer and a universal fluorescent probe respectively. The kit provided by the invention can detect common mutation types H3F3A K27M, H3F3A G34R and H3F3A G34V in the H3F3A gene, has the advantages of high sensitivity, convenient and fast operation and low cost, and has broad clinical application prospects in diagnosing diseases such as diffuse midline glioma and diffuse cerebral hemispheric glioma.

The invention discloses an SNP (Single Nucleotide Polymorphism) marker related to the body size and temperature adaptability of worker bees of apis cerana and application of the SNP marker. According to the invention, 25 key SNP sites and 10 associated genes for regulating and controlling the body type and temperature adaptation of the apis cerana are screened by a selection signal analysis method. Research finds that in the second intron region (6452066th site of the chromosome 7 of the bees) of the Foxo gene, the mutation type is T / C, and the mutation type is closely related to the body size and temperature adaptability of the Chinese bees. Through verification, in Hainan apis cerana and Aba apis cerana with extremely different body sizes and living environment temperatures, mutation position genotypes are different, TT is a large-body cold-resistant dominant genotype, and CC / TC is a small-body heat-resistant dominant genotype; a gene expression quantity detection result shows that the expression quantity of the Foxo gene is in negative correlation with a large body type and cold resistance and is in positive correlation with a small body type and heat resistance. The method can be used for genetic improvement of bee body shape characters and has breeding application value.

The invention belongs to the technical field of molecular biological detection, and particularly relates to a primer, a kit and a detection method for detecting ALDH2 gene mutation. It is found for the first time that in ALDH2 * 2 gene specificity crRNA design, after a small amount of mismatched bases are added, ALDH2 mutant types can be efficiently distinguished by combining a CRISPR-Cas12a system. The detection method provided by the invention comprises the following steps: firstly, carrying out nucleic acid isothermal amplification on a sample to be detected by virtue of the specific RPA primer, then carrying out recognition combination and cutting on an RPA amplification product by virtue of a CRISPR-Cas12a fluorescence detection system, activating an ssDNA fluorescence probe to obtain a split product, and judging by virtue of fluorescence color development; or a CRISPR-Cas12a test paper detection system reads the result of the test paper strip, so that the detection of the c.1510Ggt of the ALDH2 * 2 gene is realized; c point mutation can be efficiently, accurately and quickly detected.

This invention discloses a set of primers and a high-throughput sequencing method for goose mitochondrial genome sequencing. The method comprises (1) extracting genomic DNA from the goose to be tested; (2) performing PCR amplification using the primer set described in this invention; (3) performing high-throughput sequencing; and (4) obtaining the mutation type and haplotype through detection. This invention provides the application of the PCR primers or the goose mitochondrial genome high-throughput sequencing method described in this invention in detecting different mutation types or haplotypes.

The present invention relates to a plasmonic microarray-based multiple detection kit for genetic mutations, and a multiple detection method for genetic mutations, using same, and, specifically, to a plasmonic microarray-based multiple detection kit for genetic mutations, and a multiple detection method for genetic mutations, using same, the kit comprising: a nucleic acid amplification composition for a target gene; a multi-analysis substrate on which a capture probe for capturing both a wild-type gene and a mutation-type gene of the target gene as nucleic acid amplification products is fixed in an array form on a surface fluorescence amplification substrate; and a fluorescent probe that binds to both the wild-type gene and the mutation-type gene captured by the capture probe, wherein the nucleic acid amplification composition includes: a nucleic acid amplification primer set that can amplify both the wild-type gene and the mutation-type gene of the target gene; and a probe having a quencher that binds to the wild-type gene.

Methods and apparatus for selecting genetic variants for a tumour-informed assay are provided. The method includes receiving a sample collected from a patient, the sample being associated with a cancer type, generating a mutational catalogue for the sample, the mutational catalogue indicating a proportion of genetic mutation types observed in the sample, selecting a set of signatures associated with the cancer type, the set including one or more signatures, each signature comprising a mutational profile, determining, based on the set of signatures associated with the cancer type and the mutational catalogue, a set of genetic variants most likely to be genuine somatic variants associated with the sample, and outputting the set of genetic variants for use in creating a tumour-informed assay for the patient.

The invention discloses a digital melting PCR multiple detection reagent or kit and method, and belongs to the field of nucleic acid of biotechnology. The technical problem to be solved by the invention is how to improve dPCR multiple detection capability and tumor mutation type detection. The reagent disclosed by the invention contains n probe groups, one probe group is used for identifying the same target spot, each probe is connected with a fluorophore and a quenching group, each probe group contains X probes, the fluorophores connected with the probes in each probe group are different, and X is greater than or equal to 2; marking the fluorophores connected with each probe group as a fluorophore combination, dividing the n probe groups into m probe groups according to the difference of the fluorophore combinations, and m is greater than or equal to 1 and less than or equal to n; the Tm value of at least one probe in each large probe group and the Tm value of at least one probe in each small probe group are different. The digital melting PCR multiple detection reagent disclosed by the invention can be used for detecting more than 20 gene mutation types.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker of a UBE2L6 gene related to multiple immune traits of pigs, the SNP molecular marker is located at the 13366722th basic group on a chromosome 2 of a pig reference genome Sscrofa11.1 version, and the mutation type of the SNP molecular marker is Agt; and G. According to the invention, the key functional SNP for simultaneously regulating and controlling pig cellular immunity and innate immunity is explored for the first time, multiple genetic effects are superposed, the breeding value is huge, and a rapid and accurate detection method can be established.

The invention discloses a primer combination, a kit and a system for NOTCH2NLC gene detection, the primer combination comprises the following primer combinations: a first group of long-range amplification primer combination, a second group of long-range amplification primer combination, a third group of long-range amplification primer combination and a fourth group of long-range amplification primer combination, the first group of long-range amplification primer combination comprises primers with nucleotide sequences shown as SEQ ID NO: 1 and SEQ ID NO: 2; a second group of long-range amplification primer combination, wherein the second group of long-range amplification primer combination comprises primers with nucleotide sequences as shown in SEQ ID NO: 6 and 7; and a repeated amplification primer combination, the repeated amplification primer combination comprising primers with nucleotide sequences as shown in SEQ ID NO: 3, 4 and 5. The primer combination provided by the invention is obtained through specific screening, the kit and the system based on the primer combination can detect more mutation types, insertion interruption of SNV, GGA and the like, lower-proportion chimerism and higher GGC repetition number can be detected, the operation is simple, and the detection cost is low.

The application belongs to the technical field of tumor drugs, and particularly relates to a TCR or antigen binding fragment thereof targeting a polypeptide-HLA-A1101 complex and application thereof. The variable region of the TCR is obtained by mutating a first TCR variable region, and the mutation position and mutation type are selected from any one of the following: (1) the mutation position is the 29th to 31st position of the variable region of the alpha chain, and the mutation type is that "DTT" is mutated into "LCL", "NSL", "MFL", "LHL", "HSA", "IQT" or "NDN"; (2) the mutation position is the 98th to 101st position of the variable region of the beta chain, and the mutation type is that "GQNN" is mutated into "ARHN" or "SEHS". The TCR has excellent functional affinity and strong recognition ability to KRASG12D, and does not specifically recognize the self epitope peptide SMC1A29-38.