91 results about "Litopenaeus" patented technology

The invention discloses a xanthine oxidase inhibitory peptide with uric acid reducing activity and application thereof, and belongs to the technical field of biological medicines.The xanthine oxidase inhibitory peptide is obtained by conducting enzymolysis, separation and purification on processing byproducts such as litopenaeus vannamei heads and shells with xanthine oxidase inhibitory activity. The xanthine oxidase inhibitory peptide is screened by using a molecular docking technology, and the amino acid sequence of the xanthine oxidase inhibitory peptide is Pro-Pro-Val-Pro-Pro-Pro. The xanthine oxidase inhibitory peptide has an XOD (X-Oxidase) half inhibitory concentration of 3.181 + / -0.1786 mM. The invention further proves that the xanthine oxidase inhibitory peptide has a certain improvement effect on hyperuricemia mice, and the xanthine oxidase inhibitory peptide mainly has the effects of reducing the content of serum uric acid, creatinine and urea nitrogen of the hyperuricemia mice, inhibiting the activity of xanthine oxidase (XOD) in serum and liver of the mice, inhibiting synthesis of uric acid and improving kidney injury of the mice, and the xanthine oxidase inhibitory peptide has a certain improvement effect on the hyperuricemia mice through Toxinpred prediction. The xanthine oxidase inhibitory peptide uric acid reducing peptide is free of toxic and side effects and has a wide market application prospect.

The use of an SNP site combination of Litopenaeus vannamei in trait evaluation of mixed-family culture, a probe and a kit. The SNP site combination of Litopenaeus vannamei comprises 1125 SNP sites, wherein the physical positions are determined on the basis of alignment with a reference genome sequence of Litopenaeus vannamei. Also disclosed are a molecular probe for capturing the SNP site combination and a kit comprising the molecular probe. By means of using the SNP site combination for paternity identification, the present invention can achieve the mixed culture of individuals of different families in the early stage, so that the common environmental effect caused by separate family culture in the early stage is effectively reduced, and the accuracy of a trait evaluation result of mixed culture is improved; moreover, the genetic relationship between individuals can be accurately calculated. Compared with physical marks, the present invention avoids the phenomena of falling and dislocation of marks on individuals and human identification errors, thus obtaining accurate pedigrees.

The invention provides a penaeus vannamei behavior state acoustic intelligent identification method and a model building method, and belongs to the technical field of aquaculture acoustic monitoring. Comprising the following steps: acquiring audio data of penaeus vannamei in different behavior states; filtering and framing, threshold detection and feature extraction are carried out on the audio, and a standardized audio feature data set is constructed; a deep learning model ASP-SEResNet fusing attention statistical pooling and a channel attention mechanism is built, the deep learning model comprises a feature channel optimization branch based on a compression-excitation module and a time sequence feature expression branch adopting attention weighted statistic aggregation, and joint representation of acoustic features is achieved through a double-path feature fusion mechanism; training and optimizing the model to obtain a final model; experimental results show that the method shows excellent classification performance on a prawn audio feature data set, and high-precision identification of five behavior states of the penaeus vannamei can be realized.

According to the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei, an SNP molecular marker is cloned from a gamma-BBD gene, and the SNP marker is the 828th base G or A from the 5'terminal of a first nucleotide sequence shown in a sequence table. The primer pair of the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei comprises a primer gamma-BBD-F and a primer gamma-BBD-R, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.1 and SEQ ID NO.2: (1) SEQ ID NO.1: GCCAACAGGTCAACAG, (2) SEQ ID NO.3: GCAACAGGTCAAG, (3) SEQ ID NO.4: GCAACAGGTCAAG, and (4) SEQ ID NO.5: GCAACAGGTCAAG: And (2) TGAAGCCGTCGGCGAAGAAG as shown in SEQ ID NO. 2: According to the present invention, the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GA at the site of the SNP marker is significantly higher than the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GG, such that the high ammonia nitrogen tolerance of the litopenaeus vannamei can be effectively determined by detecting the SNP site of the litopenaeus vannamei; the SNP marker is closely related to the high ammonia nitrogen resistance character of the litopenaeus vannamei and can be effectively used for molecular marker-assisted breeding of the litopenaeus vannamei.

The invention provides an anti-white spot syndrome virus peptide derived from litopenaeus vannamei, and belongs to the technical field of biology. The amino acid sequence of the anti-white spot syndrome virus peptide provided by the invention is as shown in SEQ ID NO.1, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.2. The invention further provides a recombinant expression vector and host bacteria containing the anti-white spot syndrome virus peptide gene, and application of the recombinant expression vector and host bacteria in anti-white spot syndrome virus drugs, vaccines, feeds and feed additives, and the recombinant expression vector and host bacteria have wide application prospects and economic benefits.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of litopenaeus vannamei and application of the SNP molecular marker, and belongs to the field of molecular marker-assisted breeding of aquatic animals. Specifically, after a target fragment located on the MEF2 gene of the litopenaeus vannamei is amplified through PCR (polymerase chain reaction), the genotype of the SNP molecular marker located on the MEF2 gene is identified by using a Sanger sequencing method or a PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method, and three genotypes of GG, GC and CC are found. Through correlation analysis of the genotype of the SNP molecular marker and the growth traits of the litopenaeus vannamei, it is found that the growth traits of the litopenaeus vannamei with the genotype of GG are superior to those of GC and CC genotypes. Therefore, the SNP molecular marker can be used as a functional site for screening litopenaeus vannamei with excellent growth traits, and the research provides data for mining litopenaeus vannamei growth traits related molecular markers.

The application relates to a feed additive of herbal extracts for Litopenaeus vannamei and application thereof. The feed additive of herbal extracts is composed of dandelion extracts and houttuynia cordata extracts. The dandelion extracts and the houttuynia cordata extracts are mixed in a proportion of 1:1 and then added into the basic feed of Litopenaeus vannamei, so that the growth performance of the Litopenaeus vannamei is remarkably improved, the intestinal and hepatopancreas tissue structures are improved, and the immunity is enhanced. Meanwhile, the extracts effectively regulate the intestinal flora structure, increase the abundance and diversity of the intestinal flora, and promote the nutrient absorption and digestion functions. The extracts have a synergistic effect, are low in price, green in environmental protection, safe and free of residues.

The invention provides a breeding method suitable for breeding litopenaeus vannamei in saline-alkali soil, and relates to the technical field of aquaculture. According to the breeding method suitable for breeding the litopenaeus vannamei in the saline-alkali soil, the proportion of Ca < 2 + > to Mg < 2 + > to K < + > in a water body is optimized to be 2.8: 1: 0.3 by customizing a compound ion regulation and control solution, SO4 < 2-> / Cl <-> is controlled to be 0.14-0.8, and the pH is stabilized to be 8.2-8.8 in combination with a citric acid-sodium citrate buffer system; a slow-medium-fast segmented domestication strategy is adopted to adapt to different development stages of the fries; ethanol clostridium protein (CAP) is added into the feed to be combined with compound probiotics, so that immune metabolism regulation and control are enhanced. Experiments prove that according to the method, the survival rate of the litopenaeus vannamei seedlings reaches 86.3% + / -2.1%, the culture period is shortened by 12-15 days, the hepatopancreas SOD activity is improved by 42.6%, the vibrio inhibition rate reaches 78.5%, and the method is remarkably superior to the prior art. The method does not need large-scale pond transformation, adapts to different types of saline-alkali soil water bodies, realizes efficient green culture, and has important application value.

The application discloses a SNP molecular marker of Litopenaeus vannamei growth traits, a detection primer, a kit and application thereof. The SNP molecular marker is shown as SEQ ID NO. 1, and the polymorphism of the base at the 497th position from the 5' end of SEQ ID NO. 1 is A / G; the SNP molecular marker can simultaneously screen body length and weight to carry out Litopenaeus vannamei breeding, and the SNP molecular marker can also be detected by using a primer designed according to the sequence of SEQ ID NO. 1 or prepared into a kit. Meanwhile, the AA genotype of the SNP molecular marker Chr25_11409188 provided in the application can be used to select Litopenaeus vannamei parents, further improve the growth speed of the body length and weight of a breeding population, provide an innovative tool for molecular breeding of Litopenaeus vannamei, shorten a breeding cycle, and help industrial development and efficiency improvement.

The application discloses a method for constructing a dynamic specialized line of Litopenaeus vannamei nitrite tolerance traits. The method comprises the following steps: collecting and cultivating a nitrite tolerance population, screening the nitrite tolerance population, screening three rounds of individuals in the nitrite tolerance population, cultivating zero-generation parents and breeding F1 generation, cultivating the F1 generation and breeding F2 generation, cultivating the F2 generation and breeding F3 generation, and dynamically maintaining the nitrite tolerance trait specialized line. The specialized line breeding method of the Litopenaeus vannamei has the characteristics of simplicity, high efficiency and low cost, and does not need to construct a family line, thereby laying a technical foundation for large-scale and extensive breeding of the Litopenaeus vannamei nitrite tolerance traits.

The invention belongs to the technical field of cell culture, and particularly relates to a litopenaeus vannamei hepatopancreas blister cell separation and in-vitro culture method which comprises the following steps: S1, obtaining hepatopancreas of litopenaeus vannamei; s2, mixing the hepatopancreas in the step S1 with trypsin, and performing sieving treatment to obtain a sieved solution; s3, performing precipitation resuspension and Percoll treatment on the sieved liquid obtained in the step S2 for multiple times to obtain a cell suspension; and S4, inoculating the cell suspension in the step S3 into a culture medium, sealing the culture medium, and placing the culture medium in an incubator. The hepatopancreas B cells of the litopenaeus vannamei obtained through separation and purification by a density gradient centrifugation optimization method are complete in morphology and relatively good in activity. Successful separation of the B cells is beneficial to research on change and immune response of the B cells in pathogen infection, and a technical support is provided for follow-up research on a molecular basis of immune function differences of different types of hepatocytes.

The invention belongs to the technical field of genetic engineering, and particularly relates to a double-stranded RNA preparation for regulating and controlling shrimp molting as well as a synthesis method and application of the double-stranded RNA preparation. The prawn shelling is regulated and controlled by synthesizing specific double-stranded RNA, and the preparation method of the preparation comprises the following steps: firstly, cloning a target gene cDNA sequence related to the key physiological process of prawn shelling; secondly, constructing the sequence into an in-vitro transcription vector, and extracting and purifying recombinant plasmids; and finally, synthesizing the high-purity and high-stability double-stranded RNA preparation aiming at the target gene by taking the plasmid as a template and utilizing an in-vitro transcription system. In-vivo injection experiments prove that when the dsRNA preparation is injected into the litopenaeus vannamei body, the molting process of the litopenaeus vannamei can be obviously delayed.

The invention discloses a feed additive and compound feed for improving the muscle quality of litopenaeus vannamei, and belongs to the technical field of aquatic feed. The feed additive comprises the following air-dried substance components in percentage by weight: 1%-30% of procyanidine, 1%-30% of levodopa and 40%-98% of broad bean powder, the compound feed comprises the feed additive and a main feed composed of fish meal, chicken meal, soybean meal, soybean protein concentrate, peanut meal, wheat middling, squid paste, fish oil, soybean lecithin, vitamin premix, mineral premix and the like. According to the litopenaeus vannamei compound feed, the synthesis of muscle collagen is promoted through the procyanidine, the muscle hardness, chewiness and shearing force are improved, meanwhile, the content of free amino acid is increased through the levodopa, the wind taste of the muscle is improved, and the antioxidant capacity and the water retention capacity of the muscle are improved, so that the muscle quality of the litopenaeus vannamei is improved.

The invention discloses a 40S ribosomal protein SA molecular marker, the nucleotide sequence of the 40S ribosomal protein SA molecular marker is shown as a sequence 1 in a sequence table, and the basic group on the 175th site is C or T. The molecular marker is applied to breeding of penaeus vannamei boone, specifically, genome DNA of muscular tissue of penaeus vannamei boone to be detected is extracted, the genome DNA is used as a template for PCR amplification and purification of a PCR amplification product, then the obtained product is sequenced, the genotype of the 175th site in the molecular marker is determined, and the molecular marker is used for breeding of penaeus vannamei boone. Therefore, genotype individuals with advantages are selected for breeding the penaeus vannamei boone, and research and application of disease-resistant and stress-resistant breeding of the penaeus vannamei boone are promoted.

The application discloses a method for constructing a fast-growing specialized line of Litopenaeus vannamei. The method comprises the following steps: collecting and cultivating a fast-growing population, screening the fast-growing population, screening individuals in the fast-growing population for three rounds, cultivating zero-generation parents and breeding F1 generation, cultivating the F1 generation and breeding F2 generation, cultivating the F2 generation and breeding F3 generation, and dynamically maintaining the fast-growing specialized line. The shrimp line cultivation method of the application does not need to construct a family line, and has the characteristics of simplicity, high efficiency and low cost, thereby laying a technical foundation for large-scale and extensive breeding of the fast-growing trait of Litopenaeus vannamei.

This invention discloses a SNP marker, detection primers, and applications for genes related to nitrite resistance in Litopenaeus vannamei. The SNP molecular marker is located at the 193bp site of the sequence shown in SEQ ID NO.2, with mutation types of A / A homozygous, G / G homozygous, and A / G heterozygous. Litopenaeus vannamei with the A / A homozygous SNP molecular marker exhibits significantly higher nitrite resistance than those with the G / G homozygous and A / G heterozygous genotypes. This invention accelerates the breeding process of superior nitrite-resistant Litopenaeus vannamei varieties by identifying SNP markers associated with nitrite resistance and applying these markers to establish a marker-assisted breeding method for nitrite resistance in Litopenaeus vannamei.

This invention discloses umami peptides derived from Litopenaeus vannamei and their applications, belonging to the field of bioactive peptide technology. Seven umami peptides are described, with amino acid sequences as follows: ASRM, RCNG, DNCY, GAEF, DEGF, EDMQF, and PNRMPY, as shown in SEQ ID NO. 1–7. The invention also discusses the application of these umami peptides as or in the preparation of umami enhancers. This invention utilizes virtual screening and molecular simulation techniques to discover new umami peptides from the protein sequences of Litopenaeus vannamei, enriching the marine umami peptide library. Furthermore, it investigates the key amino acids and mechanisms of action of umami peptide receptor binding, providing a reference for studying the umami presentation mechanisms of peptides with different structures.

The invention discloses a comprehensive aquaculture method for litopenaeus vannamei and snail composite biofloc, and belongs to the technical field of aquaculture. The breeding method comprises the following steps: carrying out composite domestication on the snails in a low-salinity-resistant water body and a high-turbidity-resistant water body, constructing a litopenaeus vannamei-snail-biofloc comprehensive breeding system, and carrying out daily breeding management. According to the method, snails are introduced into a litopenaeus vannamei biofloc culture system, redundant biofloc is efficiently utilized in an in-situ culture water body through the ingestion effect of the snails, and on one hand, additional snail culture biomass increase is obtained; on the other hand, the control level of total suspended solids in the culture water body is improved, the utilization rate of aquatic animals on nitrogen in the feed is increased, ecological synergy of litopenaeus vannamei, snails and biological floccules is achieved, and an environment-friendly technical path is provided for high-density prawn culture.

This invention provides a method for the artificial breeding of Litopenaeus vannamei, including steps such as scientifically selecting broodstock, optimizing the breeding environment, controlling the breeding process, fertilization, hatching of fertilized eggs, and intensive rearing. During the breeding process, specific photoperiods and staged feeding strategies are employed, with different ratios of formulated feed and nutritional preparations to meet the nutritional needs of the broodstock. After initial rearing, the hatched juvenile shrimp are graded and selected, followed by intensive rearing. During the intensive rearing stage, water quality parameters are adjusted, and necessary trace elements, vitamins, and specific feeds are administered to promote the healthy growth of the juvenile shrimp. This invention, through meticulous management, significantly improves the breeding success rate and larval survival rate of Litopenaeus vannamei, providing an effective breeding strategy for aquaculture.

This invention provides a method for preparing a visual sensor based on mulberry anthocyanins and its application in aquatic product monitoring. Using mulberry anthocyanins as an indicator, combined with citric acid, chitosan, and polyvinyl alcohol, a novel freshness sensor is constructed on filter paper via an impregnation method. The anthocyanins (MAs) exhibit a significant color change within the pH range of 3–12, and their main components are various cyanidin and pelargonidin glycosides. Testing showed that the sensor prepared by the membrane method exhibited the best stability, remaining viable for over 15 days at 4°C, and demonstrating high sensitivity to volatile ammonia. Specifically, the sensor with 1.25% MAs added showed a sensitivity of 11.79%–18.35% to 0.025%–0.1% NH3 within 30 minutes. When used for monitoring the freshness of Litopenaeus vannamei, the sensor's color difference value (ΔE) was highly correlated with storage time and TVB-N value, with the color gradually changing from purplish-red to grayish-blue, achieving visual and qualitative detection of aquatic product freshness.

The invention discloses a litopenaeus vannamei egg membrane outer layer protein VMO1 and an application thereof in egg entering of a prawn foreign protein. The amino acid sequence of the egg membrane outer layer protein VMO1 of the litopenaeus vannamei is as shown in SEQ ID NO. 2. The litopenaeus vannamei vitelline membrane outer layer protein gene LvVMO1 is cloned from litopenaeus vannamei for the first time, and experiments prove that the litopenaeus vannamei vitelline membrane outer layer protein gene LvVMO1 is generated in the hepatopancreas tissue of the litopenaeus vannamei and enters eggs through a hemolymph way. A VMO1-EGFP in-vivo tracing test further shows that VMO1 is generated in hepatopancreas of the litopenaeus vannamei, enters the ovary through hemolymph, can carry foreign proteins such as EGFP, is transferred from an abdominal injection site and is enriched in the ovary. The invention provides an effective technical means for introducing a gene editing system into litopenaeus vannamei egg cells by using foreign proteins to realize genetic improvement and other applications of litopenaeus vannamei, and has wide application prospects and great economic values.

The invention discloses a litopenaeus vannamei Vg polyclonal antibody as well as a preparation method, a quantitative detection method and application thereof, and relates to the field of biotechnology and immunodetection. The polyclonal antibody is obtained by immunizing a polypeptide antigen containing an amino acid sequence SEQ ID NO: 1 (CPTKYEIETEGEKV), and the polyclonal antibody can specifically recognize the litopenaeus vannamei Vg. The invention provides and establishes a novel non-double antibody sandwich enzyme-linked immunosorbent assay (ELISA) method for the first time, and the core of the novel non-double antibody sandwich enzyme-linked immunosorbent assay (ELISA) method is that a Litopenaeus vannamei VgR ligand binding structural domain is used as a solid-phase capture molecule, and the polyclonal antibody is used as a detection antibody to form a receptor-ligand-antibody detection mode. The method effectively avoids the technical bottleneck that paired antibodies are difficult to prepare in a traditional method, and has the advantages of wide linear range and good repeatability.

The invention relates to the technical field of litopenaeus vannamei feeds, in particular to an artificial compound feed for improving the muscle quality of freshwater cultured litopenaeus vannamei and a preparation method thereof.The artificial compound feed is prepared from, by weight, 18%-22% of fish meal, 33%-37% of soybean meal, 20%-24% of wheat flour, 1%-5% of squid powder, 2%-3% of fish oil, 1%-2% of soybean lecithin, 0.2%-1% of choline chloride and 0.1%-0.2% of calcium propionate; the feed additive is prepared from the following raw materials in percentage by weight: 0.05%-0.1% of an antioxidant, 0.2%-0.5% of sodium alginate, 1%-2% of monocalcium phosphate, 1%-2% of a multi-vitamin multi-mineral premix, 0.8% of a hydroxyproline and glutamine mixture and 10%-13% of microcrystalline cellulose. 0.8% by weight of a mixture of hydroxyproline and glutamine is added, so that the collagen content, hardness, water holding capacity and muscle fiber density in the muscle of the freshwater cultured prawns as well as the content of flavor amino acids (such as glycine, alanine and glutamic acid) and important umami substances IMP are remarkably improved; therefore, the muscle taste and flavor of the low-salt or freshwater cultured litopenaeus vannamei are improved.

The invention relates to the technical field of aquatic product culture, in particular to a composition and feed for aquatic product culture as well as a preparation method and application of the composition and feed. The invention provides a composition and feed for aquaculture of aquatic products, and the composition and feed can effectively improve the survival rate of shrimps and promote the growth of the shrimps, and are green and pollution-free. In the invention, the two components, namely the elderberry powder and the perillyl alcohol, have a synergistic effect. By controlling the specific components and dosage, the survival rate of the litopenaeus vannamei can reach 97.00% or above, and the final body length reaches 3.57 cm or above; it is guaranteed that the survival rate of the crayfish reaches 93.50% or above, and the final body weight reaches 32.71 g or above.

This invention provides a molecular marker 27W1 for breeding high-fertility Litopenaeus vannamei populations and its applications. The nucleotide sequence of the molecular marker 27W1 is shown in SEQ ID No. 1, wherein the allele frequency of G at base 301 in high-fertility Litopenaeus vannamei populations is ≥98.33%. This invention also provides primers for the molecular marker 27W1, including amplification primers with nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, and extension primers with nucleotide sequences shown in SEQ ID No. 4. The high-fertility molecular marker 27W1 for Litopenaeus vannamei can be used for early breeding of Litopenaeus vannamei, regardless of growth stage, to rapidly select parent populations with excellent reproductive traits and promote the breeding process of new high-fertility Litopenaeus vannamei varieties.

The application discloses a SNP molecular marker related to the low-oxygen tolerance trait of Litopenaeus vannamei Lvpsma5 genes, wherein the SNP molecular marker is located at the 904th nucleotide from the 5' end of a nucleotide sequence shown in SEQ ID NO:1, and the base is T or C; the application also discloses primers for amplifying the SNP molecular marker, a kit, a detection method of the low-oxygen tolerance trait of Litopenaeus vannamei, and application of reagents for detecting the SNP molecular marker, the primers, the kit or the method in identifying or breeding the low-oxygen tolerance trait of Litopenaeus vannamei; the low-oxygen tolerance trait of an individual with a TC genotype of the SNP molecular marker is significantly higher than that of an individual with a TT genotype; the SNP molecular marker can be used for molecular marker assisted breeding and genetic improvement of Litopenaeus vannamei, so as to improve the low-oxygen tolerance of Litopenaeus vannamei and increase the breeding benefit.

This invention discloses the XO-inhibiting peptide AGDY and its applications, belonging to the field of bioactive peptide technology. The amino acid sequence of the XO-inhibiting peptide AGDY is shown in SEQ ID NO.3. The invention also discloses the application of the XO-inhibiting peptide AGDY in the preparation of xanthine oxidase inhibitors and in the preparation of drugs with the effect of inhibiting uric acid levels. This invention used molecular docking and BLAST+ software to virtually screen 15 potential XO-inhibiting peptides from the complete protein sequence of Litopenaeus vannamei. High-performance liquid chromatography (HPLC) was used to determine the XO-inhibiting activity, and the results showed that 7 small molecule peptides exhibited significant XO-inhibiting activity, possessing potential value in preventing hyperuricemia.

The invention discloses dsRNA (double-stranded ribonucleic acid) targeting a C3orf38 gene of litopenaeus vannamei and application of the dsRNA. According to the invention, dsRNA targeting the Litopenaeus vannamei C3orf38 gene (LvC3orf38) is designed and synthesized, and the dsRNA is used for inhibiting gene expression, so that it is found that inhibition of LvC3orf38 gene expression can inhibit duplication of the DIV1 in a prawn body, and the survival rate of the prawn infected with the DIV1 is improved. In addition, by inhibiting expression of the LvC3orf38 gene, weight gain of the prawns can be promoted, and growth of the prawns is promoted. Therefore, a preparation capable of inhibiting the expression of the LvC3orf38 gene can be used for improving the resistance of the prawns to the decapod iridovirus disease and promoting the growth of the prawns. A green and environment-friendly prevention and treatment strategy is provided for prevention and treatment of the full-eye iridovirus disease, the contradiction between disease resistance and growth can be solved, and the requirements of the modern breeding industry for high efficiency, safety and economy are met.

The invention relates to the technical field of genetic breeding of aquatic animals, in particular to a low-loss litopenaeus vannamei growth phenotype determination method. The preparation method comprises the following steps: performing anesthesia treatment on a prawn sample to be measured to enable the prawn to enter an anesthetic state, then transferring the prawn into a normal seawater environment, measuring the growth phenotype of the prawn in a window period, and then recovering the normal state of the prawn. According to the method disclosed by the invention, through short-time eugenol anesthesia, mechanical injury and stress reaction caused by jumping and struggling of the prawns in the phenotype determination process are effectively inhibited, and the loss rate of the prawns is obviously reduced. Compared with the prior art, the method has the advantages of simplicity and convenience in operation, extremely low prawn loss, high growth phenotype determination efficiency and the like, is suitable for growth character evaluation in a large-scale genetic breeding process of prawns, and has a wide application prospect.