94 results about "Penaeus" patented technology

The invention provides a penaeus vannamei quality prediction and grade evaluation method and system, and belongs to the field of penaeus vannamei cold-chain transportation process quality prediction, and the method comprises the steps: S1, constructing a penaeus vannamei data set, and carrying out the dynamic time-varying coupling correlation graph generation, convection-diffusion cooperative information propagation, multi-task joint optimization and end-to-end MLP prediction to obtain a penaeus vannamei data set; obtaining a prediction result of the quality of the penaeus vannamei; s2, splicing is performed according to the prediction result and the actual quality data, and a feature matrix is constructed; clustering the feature matrix by using a rule fusion K-means + + clustering method to obtain an optimal clustering center set; and S3, based on the prediction result and the clustering center set, carrying out dynamic prediction and evaluation on the quality of the penaeus vannamei in the refrigeration state in a period of time in the future. According to the invention, an intelligent solution is provided for quality monitoring in cold-chain logistics, and economic loss caused by quality deterioration is significantly reduced.

The invention belongs to the field of food processing, and provides a preparation method of penaeus vannamei powder gel suitable for people with dysphagia, which comprises the following steps: taking penaeus vannamei meat, blending until no obvious particles exist, freezing, carrying out vacuum drying, powdering, sieving, mixing with water, fully hydrating to obtain a penaeus vannamei powder solution, adjusting the pH value of the penaeus vannamei powder solution to 9-11, stirring, adjusting the pH value to 6-8, and preparing the penaeus vannamei powder gel. And continuously stirring, adding carrageenan, heating and cooling to obtain the penaeus vannamei meal gel. The method disclosed by the invention is simple and easy to implement, and the pH migration treatment and the carrageenan treatment are utilized to generate a synergistic effect, so that the prepared penaeus vannamei powder gel meets the fifth-level standard of an IDDSI framework, and can meet the diet requirements of special crowds such as dysphagia patients on multiple aspects such as nutrition and texture.

According to the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei, an SNP molecular marker is cloned from a gamma-BBD gene, and the SNP marker is the 828th base G or A from the 5'terminal of a first nucleotide sequence shown in a sequence table. The primer pair of the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei comprises a primer gamma-BBD-F and a primer gamma-BBD-R, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.1 and SEQ ID NO.2: (1) SEQ ID NO.1: GCCAACAGGTCAACAG, (2) SEQ ID NO.3: GCAACAGGTCAAG, (3) SEQ ID NO.4: GCAACAGGTCAAG, and (4) SEQ ID NO.5: GCAACAGGTCAAG: And (2) TGAAGCCGTCGGCGAAGAAG as shown in SEQ ID NO. 2: According to the present invention, the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GA at the site of the SNP marker is significantly higher than the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GG, such that the high ammonia nitrogen tolerance of the litopenaeus vannamei can be effectively determined by detecting the SNP site of the litopenaeus vannamei; the SNP marker is closely related to the high ammonia nitrogen resistance character of the litopenaeus vannamei and can be effectively used for molecular marker-assisted breeding of the litopenaeus vannamei.

The invention relates to the technical field of aquatic product preservation, and discloses a natural eutectic solvent for maintaining the quality of frozen penaeus vannamei boone and application, the natural eutectic solvent is composed of choline chloride, sorbitol and water, the molar ratio of choline chloride to sorbitol is (1-5): (1-5), and the mass of water is 15-25% of the total mass of choline chloride and sorbitol. The invention also provides an application of the solvent, and the application comprises the following steps: soaking the penaeus vannamei meat in the solvent, and then freezing and storing the penaeus vannamei meat. A supramolecular network system is constructed through hydrogen-bond interaction between choline chloride and sorbitol, growth of ice crystals in the freezing storage process is inhibited, a protein structure is stabilized, and loss of unfrozen juice is reduced, so that the quality of the penaeus vannamei, such as texture, color and flavor, is maintained. The natural deep-eutectic solvent is natural and safe in component, low in heat, simple to prepare and convenient to apply, the application limitation of a traditional anti-freezing agent is solved, and the natural deep-eutectic solvent has a good industrial prospect.

The invention discloses a shrimp seed breeding method for regulating and controlling water quality through microalgae and probiotics under specific illumination. According to the technical scheme, the shrimp seed breeding method is characterized by comprising the following steps that firstly, a seedling breeding workshop is built; step 2, microalgae-probiotic culture: selecting microalgae and probiotic types beneficial to shrimp seedling culture, and culturing to obtain a microalgae solution and a probiotic solution; 3, seedling raising and putting preparation; step 4, putting shrimp larvae; step 5, putting of algae-probiotics; step 6, seedling culture illumination control; 7, feeding the young shrimps with bait; 8, monitoring and regulating water quality; and 9, evaluating the young shrimps out of the pond. According to the method, illumination is precisely controlled, the growth environment of microalgae and probiotics is optimized, and the synergistic effect of the microalgae and probiotics in the aspects of water purification, nutrition supply, disease prevention and control and the like is fully exerted, so that the water quality of penaeus vannamei larvae is improved, the survival rate and health condition of the penaeus vannamei larvae are improved, and the survival rate of penaeus vannamei larvae is increased. And a good foundation is laid for large-scale and high-efficiency culture of the penaeus vannamei.

The present invention discloses a relay aquaculture method for Penaeus japonicus, and relates to the field of biological aquaculture. The method employs a mixture of a protein source, a fat source, a complex vitamin, a complex inorganic salt, an attractant, and (-)-caryophyllene oxide-modified xanthan gum to prepare a bait for the relay aquaculture of Penaeus japonicus, resulting in a good survival rate, specific growth rate, and feed conversion coefficient for the Penaeus japonicus. The method also employs glucosamine-modified humic acid, which is used in the preparation of an amino acid fertilizer paste, which is then used in the relay aquaculture of Penaeus japonicus, resulting in an even better survival rate, specific growth rate, and feed conversion coefficient for the Penaeus japonicus.

The method comprises the following steps: drying and crushing shrimp heads and shrimp shells, adding water according to a ratio of 1: 3, adding 0.5%-0.7% of compound protease, and carrying out enzymolysis at 50-55 DEG C for 2-3 hours; after enzyme deactivation, adding 7-10% of brown sugar to adjust the pH value to 6.0-6.5, and sterilizing; the method comprises the following steps: inoculating pineapple endophytic lactic acid bacteria (CGMCC 25352), hansenula polymorpha (CGMCC 25353) and aspergillus oryzae, mixing the three strains according to the viable count of 1: 1: 1 (the total inoculum size is 3-4.5%, and the CFU / g is 10-10), and fermenting for 46-48 hours at the temperature of 30-32 DEG C in a dark place; and filtering and storing at-80 DEG C. The product is free of salt addition, the fermentation period is less than or equal to 48 hours, the amino acid nitrogen content is greater than or equal to 0.51 g / 100g, the total content of lactic acid (6.88 mg / g), succinic acid (3.73 mg / g) and free amino acid is greater than or equal to 313mg / 100g, the volatile amino salt content is less than or equal to 38.72 mg / 100mL, and the product has salty and fresh flavor and orange-yellow clarified appearance. The problems of high salt, long period and heavy fishy smell of the traditional shrimp soy sauce are solved.

The application discloses an automatic oxygenation device for South American prawn culture ponds, which comprises a floating mechanism, wherein the floating mechanism comprises a floating plate and a float, the float is arranged on the floating plate, and a surge oxygenation mechanism and a non-powered self-translation mechanism are arranged on the floating mechanism. The application relates to the technical field of oxygenation devices, and particularly provides the automatic oxygenation device for South American prawn culture ponds, which can generate more bubbles, has a better oxygenation effect, can generate a surge effect in the oxygenation process, can diffuse the bubbles to a larger range, has a larger oxygenation range, can move in the culture pond in the oxygenation process without any independent drive, has a wider action range, and can actively control the moving speed.

The invention discloses a penaeus vannamei body size estimation method and device and a storage medium, and relates to the technical field of breeding industry image processing, and the method comprises the steps: collecting a penaeus vannamei data set image, and carrying out the marking of the penaeus vannamei data set image; constructing a penaeus vannamei body detection model, improving the penaeus vannamei body detection model, and training the improved penaeus vannamei body detection model based on the marked penaeus vannamei body data set image; and based on the trained penaeus vannamei body detection model, measuring the body size of the penaeus vannamei and estimating the length of the penaeus vannamei body. According to the method, the expression and fusion capabilities of the multi-scale features are enhanced, the positioning precision of the feature points of the prawns is improved, and a set of non-contact estimation system for the body sizes of the prawns is developed. The coordinates of the feature points of the shrimp bodies are accurately obtained, the body size indexes are calculated, and accurate estimation of the shrimps with different completeness degrees is achieved. Rapid and accurate non-contact prawn body size measurement is realized, and powerful technical support is provided for intelligent and accurate cultivation of the penaeus vannamei.

The application discloses a compound Chinese herbal medicine fermentation preparation for preventing and treating hepatotoxicity of Penaeus vannamei and a preparation method thereof. Spore bacillus is used as a fermentation strain to perform aerobic fermentation on four traditional Chinese herbal medicine stem and leaf wastes, i.e. Astragalus stem and leaf, Rhubarb stem and leaf, Codonopsis stem and leaf and Coptis stem and leaf, so as to obtain a compound Chinese herbal medicine fermentation product with higher active substances. The compound Chinese herbal medicine fermentation preparation of the application can be added into the feed of Penaeus vannamei, so as to effectively prevent and treat hepatotoxicity of Penaeus vannamei.

The utility model discloses a kind of feed devices for Penaeus vannamei breeding with timing feeding, including box, the top of the box is equipped with mounting bracket by sliding mechanism, the side of the mounting bracket is equipped with moving plate and L-shaped plate by moving mechanism. Feed is stored by feeding hopper, feed can be discharged by discharging mechanism, Penaeus vannamei in the box can be fed, feed can be scattered by scattering mechanism, so that feed is more evenly dispersed, the speed of second motor is adjusted, so that the range of feed dispersion increases or decreases, moving plate is moved by moving mechanism, feeding hopper is moved by moving plate, so that the vertical position of discharging position is adjusted, mounting bracket is moved by sliding mechanism, feeding hopper is moved by mounting bracket, so that the horizontal position of discharging position is adjusted, so that the horizontal and vertical positions of feeding hopper are conveniently adjusted.

The utility model relates to the technical field of culture water filtering equipment, and one embodiment of the utility model provides an automatic backwashing South America white shrimp culture water filter which comprises a shell and a pair of supports, the supports are both fixed to the bottom of the shell, a side cover is arranged on one side of the shell, and a connecting assembly is arranged between the shell and the side cover. The filtering and flushing assembly is arranged on the side cover and the shell and comprises a driving motor, the driving motor is installed on the side surface of the side cover, a pair of partition plates is arranged in the shell, one partition plate is connected with the output end of the driving motor, and a filtering layer is connected between the partition plates. According to the technical scheme, the technical problems that a traditional filter in the prior art generally does not have an automatic backwashing function, needs to be manually cleaned, is tedious to operate and is difficult to ensure timely cleaning are solved.

The invention discloses a probe for detecting a penaeus japonicus SNP molecular marker combination, a penaeus japonicus 31K liquid phase breeding chip and application, and belongs to the technical field of molecular marker breeding. The penaeus japonicus SNP molecular marker combination is composed of 31097 SNP molecular markers. The 31097 SNP molecular markers are as shown in the specification table 1. The invention also provides application of the penaeus japonicus liquid phase breeding chip in penaeus japonicus breeding, sample detection, genetic resource genetic diversity analysis, genetic and evolutionary analysis, genetic relationship identification, whole genome association analysis and penaeus japonicus genome selection. The penaeus japonicus 31K liquid phase breeding chip provided by the invention has the characteristics of good site representativeness, strong specificity, high polymorphism and the like, is widely applicable to detection of different varieties of penaeus japonicus materials, can establish a modern breeding system, and promotes the development of the penaeus japonicus molecular breeding industry.

The application is a deep learning-based method for breeding and multiplying Penaeus vannamei, which comprises: obtaining genomic data of the initial population; obtaining specific trait data of the screened initial population; locating a specific gene sequence set according to the specific trait data and the genomic data; the gene sequence set is a gene number set related to the specific trait; and determining the breeding shrimp for breeding according to the gene number set. The application first breeds Penaeus vannamei populations of different families, obtains the trait phenotype data and genomic data of Penaeus vannamei under different families, determines the gene sequence meeting the trait phenotype requirements according to the correlation degree between the trait phenotype data and the genomic data, that is, locates the gene sequence related to the specific trait, and then selects the next generation of Penaeus vannamei according to the gene sequence set, or directly breeds the breeding shrimp with stable traits.

The utility model belongs to the technical field of genetic material extraction appliance, concretely relates to special centrifugal tube suit of south American white prawn nucleic acid extraction, including the pipe body, the top threaded connection of pipe body has the pipe cap, the position department of pipe body outer wall is close to the fixed setting of mounting ring of top, the outer wall of pipe cap is below the sliding ring of mounting ring and is connected with the damping sliding, the position department of mounting ring bottom close to the outside edge is hinged with four upper articulated rods at equal intervals, the top of sliding ring is hinged with the lower articulated rod of corresponding position of upper articulated rod, and the corresponding upper articulated rod is hinged with the lower articulated rod between setting articulated assembly. The utility model places the pipe body on the test tube rack through the amplitude of the lower articulated rod and the upper articulated rod protruding from the outside of the pipe body to support the pipe body, so that the pipe body can be adapted to different diameter types of test tube racks, increase the types of centrifugal tubes that can be adapted to test tube racks, facilitate the use of centrifugal tubes, and at the same time, reduce the types of test tube racks that need to be purchased, and reduce the cost of purchasing test tube racks.

The invention discloses an SNP molecular marker related to the cold resistance character of a penaeus vannamei DDO gene and application of the SNP molecular marker, and belongs to the technical field of penaeus vannamei breeding, the nucleotide sequence of the SNP molecular marker is shown as a sequence 1 in a sequence table, and the SNP molecular marker is remarkably related to the cold resistance character of the penaeus vannamei. The method comprises the following steps: extracting genome DNA of muscular tissues of penaeus vannamei boone to be detected, carrying out PCR amplification by taking the genome DNA as template DNA, purifying a PCR amplification product, sequencing the obtained product, and screening the penaeus vannamei boone variety with cold resistance according to genotypes of different sites on the SNP molecular marker. The marker is high in accuracy and good in stability, is suitable for molecular marker assisted breeding, can be used for rapidly and accurately screening litopenaeus vannamei individuals with cold-resistant characters in an early stage, and remarkably improves the breeding efficiency and accuracy of new cold-resistant varieties, so that the breeding success rate and economic benefits are improved.

The utility model discloses a shrimp shell remover and a culture device, and belongs to the technical field of aquaculture. The shrimp shell remover comprises a box body; the filtering partition plate is arranged in the box body, the internal space of the box body is divided into a first water tank and a second water tank by the filtering partition plate, and a plurality of first filtering holes are formed in the side wall of the filtering partition plate; the water inlet connector is arranged at the bottom of the box body and is communicated with the first water tank; the water outlet connector is arranged at the bottom of the box body, and the water outlet connector is communicated with the second water tank; the drainage pipe is vertically arranged in the second water tank, a flow guide baffle is arranged on the inner wall face of the drainage pipe, and the flow guide baffle and the water inlet connector are arranged in an up-down opposite mode; the first ends of the escape pipes penetrate through the side wall of the first water tank, the second ends of the escape pipes penetrate through the side wall of the drainage pipe, and the height of the escape pipes is larger than that of the flow guide baffle. According to the utility model, shrimp shells in the culture pond can be removed, and the water quality and the normal growth of the penaeus vannamei boone are ensured.

The utility model relates to the technical field of aquaculture, and provides a penaeus vannamei boone culture intelligent feeding and water quality purification all-in-one machine which comprises a feeding tank, a buoyancy ring arranged at the lower end of the feeding tank, a distinguishing feeding assembly arranged in the feeding tank, a separation cover of a conical structure, and an extension pipe arranged at the upper end of the separation cover. A feeding port is formed in the upper end of the extension pipe, an extension cavity is formed in the side wall of the separation cover, a feeding tank is inserted into the feeding port, a material guide port is formed in the side wall of the feeding tank, a material stacking port is formed in the side wall of the extension pipe, and the material stacking port corresponds to the material guide port in position. By means of the technical scheme, the problems that in the related technology / prior art, traditional feeding mostly depends on manpower, a large amount of manpower is consumed, the labor intensity is large, the feeding amount and the feeding position are difficult to accurately control, the feeding amount is too large, feed is left in water, waste is caused, and water quality is polluted are solved; the growth and development of the prawns can be influenced when the feeding amount is too small.

The application discloses a method for identifying whether a sample to be detected is infected with a shrimp glass disease virus (SGDV) and a special primer pair thereof. The inventor of the application finds a new small ribonucleic acid virus SGDV in Penaeus vannamei Boone, and the nucleotide sequence of the virus is shown in SEQ ID NO: 3. Experiments prove that a primer pair composed of a primer F shown in SEQ ID NO: 1 and a primer R shown in SEQ ID NO: 2 can accurately identify whether the sample to be detected is infected with the SGDV. The application has important application value, and helps us to deepen the understanding of virus diversity, provides guidance for the breeding of the Penaeus vannamei Boone and has important significance for preventing infectious diseases in aquaculture.

This invention discloses a SNP marker, detection primers, and applications for genes related to nitrite resistance in Litopenaeus vannamei. The SNP molecular marker is located at the 193bp site of the sequence shown in SEQ ID NO.2, with mutation types of A / A homozygous, G / G homozygous, and A / G heterozygous. Litopenaeus vannamei with the A / A homozygous SNP molecular marker exhibits significantly higher nitrite resistance than those with the G / G homozygous and A / G heterozygous genotypes. This invention accelerates the breeding process of superior nitrite-resistant Litopenaeus vannamei varieties by identifying SNP markers associated with nitrite resistance and applying these markers to establish a marker-assisted breeding method for nitrite resistance in Litopenaeus vannamei.

The application discloses a process for removing pollutants in factory breeding tail water of penaeus vannamei, and belongs to the technical field of breeding tail water treatment. The process comprises the following steps: (1) filtering breeding wastewater to remove solid matters; (2) adding composite bacteria to the filtered breeding wastewater for aeration treatment to obtain aeration wastewater, wherein the composite bacteria comprise, by weight, 1-2 parts of rhodococcus, 2-3 parts of bacillus subtilis, 3-4 parts of halococcus and 0.8-1.5 parts of photosynthetic bacteria; (3) adding a flocculating agent to the aeration wastewater, treating the aeration wastewater at 45-50 DEG C for 0.5-1 h, and filtering to obtain a first filtrate; (4) adding modified activated carbon to the first filtrate, treating the first filtrate at 45-50 DEG C for 1-2 h, filtering to obtain a second filtrate; and (5) flowing and mixing the second filtrate through a macroporous adsorption resin to obtain a third filtrate, and sterilizing the third filtrate. The application realizes efficient removal of pollutants in the breeding tail water of penaeus vannamei through the combination of physical, chemical and biological treatments.

The invention provides a penaeus vannamei feed table residual feed quantity grade intelligent evaluation feeding system and method, the system comprises a data acquisition module, an intelligent evaluation module and a feeding control module, after the system is started, feed table images are continuously acquired through the data acquisition module; the method comprises the following steps: acquiring image data, preprocessing the image data, sending the preprocessed image data to an intelligent evaluation module and a feeding control module, analyzing the image in real time through an improved MobileNetV2 convolutional neural network model, evaluating a residual feed amount grade, generating a feeding instruction according to the residual feed amount grade, and sending the feeding instruction to feeding equipment to dynamically adjust the feeding amount as required. According to the method, the feeding strategy of the penaeus vannamei is dynamically adjusted based on the residual feed amount, rapid response from monitoring to feeding is achieved, feed waste is reduced, the feed cost is saved, and the water quality pollution risk is reduced.

The application discloses a Penaeus vannamei HIF-1 alpha gene SNP molecular marker, which is located at the bases of the 67th, 119th, 133th, 172th, 340th, 409th, 437th, 474th, 577th, 647th and 749th nucleotides in the nucleotide sequence shown in sequence 1 of the sequence table. The molecular marker is used as a functional marker of the nitrite tolerance trait of the Penaeus vannamei to carry out selection, specifically, genomic DNA of muscle tissue of the Penaeus vannamei to be detected is extracted, the obtained genomic DNA is used as a template to carry out PCR amplification and purification of the PCR amplification product, then the obtained PCR amplification product is sequenced, the genotype of the molecular marker is determined, and thus individuals with dominant genotypes are selected for Penaeus vannamei breeding, and a Penaeus vannamei strain with good nitrite tolerance trait can be obtained.

The utility model belongs to the technical field of shrimp gill tissue crushing, and particularly relates to a quick crusher for gill tissues of penaeus vannamei boone, which comprises an adjusting base, an adjusting type container cooling mechanism is mounted at the top of the adjusting base, and the adjusting type container cooling mechanism comprises a plurality of cooling clamping plates. The multiple cooling clamping plates are annularly arranged and slidably mounted above the adjusting base, and circulating cooling channels are formed in the cooling clamping plates. A cooling liquid storage box is arranged on one side of the adjusting base, an electric lifting push rod is fixed to the top of the cooling liquid storage box, a supporting plate is fixed to the top of the electric lifting push rod, and a first motor is fixed to the top of one end of the supporting plate. According to the utility model, through the cooling system which can be moved and adjusted, by adjusting the position of the cooling system, the containers with different specifications can be attached and fixed, the low temperature in the containers can be maintained, the containers are convenient to disassemble and replace, the containers with proper capacities can be selected according to required sample sizes, and the use is more convenient.

The invention belongs to the technical field of aquaculture, and particularly relates to a rotary moss cleaning brush for a penaeus vannamei culture pond, which comprises a culture pond, an output motor, a swing arm and a brush, an output motor capable of driving the swing arm and the brush to rotate is mounted at the top of the culture pond; the swing arm is fixedly connected to an output rod of the output motor. The brush is in contact with the inner side wall of the culture pond; an arc-shaped baffle is fixedly connected to the bottom of the swing arm; the side wall of the arc-shaped baffle is arranged close to the inner side wall of the culture pond; the arc-shaped baffle is positioned around the brush; wherein the swing arm, the brush and the arc-shaped baffle rotate by a circle in the culture pond and then rotate reversely, so that the brush repeatedly cleans the inner wall of the culture pond back and forth, and the effect is better compared with the effect of cleaning through reverse movement towards one side; the side wall of the arc-shaped baffle is close to the inner side wall of the output motor, a gap is reserved, and direct contact between the penaeus vannamei and the brush can be reduced.

The invention relates to the technical field of microorganisms, in particular to saccharomyces cerevisiae for producing hyodeoxycholic acid and application of the saccharomyces cerevisiae. The technical problem to be solved by the invention is to improve the breeding feed for penaeus vannamei. According to the technical scheme, the saccharomyces cerevisiae DZNSC-13-045 capable of producing hyodeoxycholic acid is provided, and the preservation number of the saccharomyces cerevisiae DZNSC-13-045 is CGMCC (China General Microbiological Culture Collection Center) No.29594. The saccharomyces cerevisiae DZNSC-13-045 is used for producing hyodeoxycholic acid. The invention also provides an application of the saccharomyces cerevisiae in increasing the hyodeoxycholic acid content of bred animals. A strain of saccharomyces cerevisiae is screened and identified, and the content of hyodeoxycholic acid in perinereis aibuhitensis bodies can be effectively increased by adding the saccharomyces cerevisiae in the perinereis aibuhitensis feeding process.

The present application relates to a kind of concentrated frozen chlorella applied to the method of south American white prawn breeding in, belong to the technical field of breeding, comprising the following steps: concentrated frozen chlorella under-20 ℃ condition is transferred to 0~4 ℃ condition and is stored;In 0~4 ℃ condition, the concentrated frozen chlorella is completely thawed to obtain concentrated chlorella;Before 2~8h, the concentrated chlorella obtained after thawing is pretreated by being sprinkled with concentrated chlorella in the breeding pond: the treatment mode of pretreatment is to take concentrated chlorella and seawater mixed in the light container to form mixed solution, add bacteria to mixed solution, then add fermentation carbon source to obtain algal liquid by fermentation.The present application is pretreated before use to concentrated frozen chlorella, to solve the problem that concentrated frozen chlorella is seriously dirty in south American white prawn breeding, water quality index is difficult to control, and the survival rate of breeding is low.

The invention discloses a probiotic preparation for post-harvest temporary aquaculture of whiteleg shrimp (Penaeus vannamei), a preparation method thereof, and an application thereof. The probiotic preparation is characterized in that the probiotic preparation comprises at least one of a fermented Lactobacillus mucilaginosus RC3 strain and a Lactobacillus plantarum B6 strain, the fermented Lactobacillus mucilaginosus RC3 having a preservation number of CGMCC No. 30602, and the Lactobacillus plantarum B6 having a preservation number of CGMCC No. 30603. The probiotic preparation is prepared by mixing a fermented Lactobacillus mucilaginosus RC3 seed liquid and a Lactobacillus plantarum B6 seed liquid in a volume ratio of (1-2):(1-2), and then inoculating the mixture into an MRS liquid culture medium in a volume ratio of 5-10% to obtain the probiotic preparation for post-harvest temporary aquaculture of whiteleg shrimp. The probiotic preparation has the advantages of reducing the contents of nitrite nitrogen and ammonia nitrogen in aquaculture water, improving the antioxidant and immune properties of shrimp, optimizing intestinal flora, and improving the muscle quality of shrimp.

The invention relates to the technical field of microorganisms, and particularly discloses a bifidobacterium breve BB18 and an application of an exopolysaccharide BB18-EPS (extracellular polysaccharide) produced by the bifidobacterium breve BB18. The strain is preserved in the China General Microbiological Culture Collection Center on June 9, 2025, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.34621. The exopolysaccharide BB18-EPS secreted by the strain can be used as a food additive for gel modification of shrimp myofibrillar protein (MP), and the product performance is remarkably improved. Experiments prove that BB18-EPS drives ordered crosslinking of myosin through a hydrophobic effect, promotes transformation of a secondary structure of MP to alpha-helix, and optimizes the recombination efficiency of a molecular chain; meanwhile, through interaction of hydroxyl, sugar residues and water molecules, the density of a gel network is enhanced, and the thermal stability and the deformation resistance are improved. The composite gel system can be applied to the fields of minced penaeus vannamei products and the like, and the product texture and the processing yield are effectively improved.

The invention discloses a process for removing pollutants in industrial aquaculture tail water of penaeus vannamei boone, and belongs to the technical field of aquaculture tail water treatment. Comprising the following steps: (1) filtering breeding wastewater to remove solids; (2) compound bacteria are added into the filtered breeding wastewater for aeration treatment, aerated wastewater is obtained, and the compound bacteria comprise rhodococcus ruber, bacillus subtilis, brevibacterium halotolerans and photosynthetic bacteria according to the weight ratio of (1-2): (2-3): (3-4): (0.8-1.5); (3) adding a flocculating agent into the aerated wastewater, treating at 45-50 DEG C for 0.5-1 hour, and filtering to obtain a first filtrate; (3) adding modified activated carbon into the first filtrate, treating at 45-50 DEG C for 1-2 hours, and filtering to obtain a second filtrate; and (4) treating the second filtrate through mixed macroporous adsorption resin to obtain a third filtrate, and sterilizing the third filtrate. By combining physical, chemical and biological treatment, pollutants in the penaeus vannamei culture tail water are efficiently removed.