154 results about "Penaeus" patented technology

The invention provides a penaeus vannamei quality prediction and grade evaluation method and system, and belongs to the field of penaeus vannamei cold-chain transportation process quality prediction, and the method comprises the steps: S1, constructing a penaeus vannamei data set, and carrying out the dynamic time-varying coupling correlation graph generation, convection-diffusion cooperative information propagation, multi-task joint optimization and end-to-end MLP prediction to obtain a penaeus vannamei data set; obtaining a prediction result of the quality of the penaeus vannamei; s2, splicing is performed according to the prediction result and the actual quality data, and a feature matrix is constructed; clustering the feature matrix by using a rule fusion K-means + + clustering method to obtain an optimal clustering center set; and S3, based on the prediction result and the clustering center set, carrying out dynamic prediction and evaluation on the quality of the penaeus vannamei in the refrigeration state in a period of time in the future. According to the invention, an intelligent solution is provided for quality monitoring in cold-chain logistics, and economic loss caused by quality deterioration is significantly reduced.

The invention discloses a method for extracting shrimp oil from penaeus vannamei boone processing by-products, which specifically comprises the following steps: freeze-drying penaeus vannamei boone heads, crushing into powder, adding absolute ethyl alcohol in proportion, and carrying out ultrasonic extraction and solid-liquid separation to obtain a solid matter and a supernatant A; and evaporating and concentrating the supernate to obtain the penaeus vannamei oil with high extraction rate. The extraction rate is more than 95%. The method provided by the invention not only improves the extraction rate of shrimp oil from South America white, but also greatly shortens the extraction time.

The invention discloses SNP (Single Nucleotide Polymorphism) molecular markers of a Penaeus vannamei HIF-1alpha gene. The SNP molecular markers are respectively positioned at basic groups of the 67th site, the 119th site, the 133rd site, the 172nd site, the 340th site, the 409th site, the 437th site, the 474th site, the 577th site, the 647th site and the 749th site of a nucleotide sequence shown in a sequence 1 in a sequence table. The molecular marker is used as a functional marker of the nitrite-resistant character of the penaeus vannamei for breeding, specifically, genome DNA of muscular tissue of the penaeus vannamei to be detected is extracted, then the obtained genome DNA is used as a template for PCR amplification and purification of a PCR amplification product, then the obtained PCR amplification product is sequenced, and the content of the nitrite-resistant character of the penaeus vannamei is determined. The genotype of the molecular marker is determined, so that dominant genotype individuals are selected for breeding the penaeus vannamei boone, and a penaeus vannamei boone strain with good nitrite-resistant character can be obtained.

The utility model provides water temperature regulation and control equipment for penaeus vannamei culture, which belongs to the technical field of aquaculture equipment and comprises a flow regulation mechanism communicated with culture equipment. The flow adjusting mechanism communicates with refrigeration equipment through a first flow dividing pipe and communicates with heating equipment through a second flow dividing pipe. The output end of the first water pump is communicated with a filter box and a second water pump, and the second water pump is communicated with the refrigeration equipment and the heating equipment. By arranging the flow adjusting mechanism, switching of cold water and hot water and adjustment of water quantity are achieved, so that adjustment of water temperature in the breeding barrel is achieved, and proper breeding water temperature is guaranteed; according to the penaeus vannamei breeding device, water is recycled, meanwhile, circulating water is subjected to split-flow heating or refrigeration, water temperature adjustment is guaranteed, the water utilization rate is increased, meanwhile, the water level in the breeding barrel can be prevented from being too high, and the breeding effect of penaeus vannamei is improved.

The present invention relates to the technical field of water treatment, and provides a system for water quality purification for factory farming of penaeus vannamei, which comprises a treatment tank (100), a bearing platform (200) and a cultivation tank (400), wherein the treatment tank (100) is fixed onto the bearing platform (200), and the cultivation tank (400) is fixed onto the bearing platform (200); a separation plate (101) is fixed in the treatment tank (100), a first water through hole (102) is formed in the separation plate (101), and the separation plate (101) divides the treatment tank (100) into an overflow area (103) and a purification and oxygen enrichment area (104), the purification and oxygen enrichment area (104) being in communication with a pipeline at the bottom of the cultivation tank (400); and a flow-dividing assembly (110) is fixed in the overflow area (103), a desilting assembly (120) is fixed to the bottom of the overflow area (103), a filter assembly (130) is fixed in the purification and oxygen enrichment area (104), the filter assembly (130) comprises a filter box (131), and a disinfection box (150) is fixed onto a side wall of the treatment tank (100). Thus, disinfectant and water can be fully mixed, improving the disinfection and purification effect, and in turn the stress on the penaeus vannamei is reduced, thereby reducing the death rate thereof.

The invention belongs to the technical field of aquaculture, and particularly relates to application of resveratrol in culture of penaeus vannamei boone, which is characterized in that the application dosage and mode of the resveratrol are that the penaeus vannamei boone is fed according to the weight proportion of 0.033-0.067 per thousand of the total weight of the penaeus vannamei boone everyday. The resveratrol is used for improving the immune function of penaeus vannamei boone, improving the survival rate, increasing the body weight growth rate and counting immune cells. The resveratrol is also used for improving the anti-oxidative stress capability of the South America white, including improving the superoxide dismutase activity of the shrimp body, and / or improving the shrimp hepatopancreas lysozyme activity of the shrimp body, and / or improving the total anti-oxidative capability of the shrimp body. The resveratrol can enhance the immune epidemic prevention level of the penaeus vannamei population on stress sources such as vibrio infection, reduce the oxidative stress risk of the penaeus vannamei population and avoid the expansion of breeding loss caused by group stress.

The invention belongs to the field of food processing, and provides a preparation method of penaeus vannamei powder gel suitable for people with dysphagia, which comprises the following steps: taking penaeus vannamei meat, blending until no obvious particles exist, freezing, carrying out vacuum drying, powdering, sieving, mixing with water, fully hydrating to obtain a penaeus vannamei powder solution, adjusting the pH value of the penaeus vannamei powder solution to 9-11, stirring, adjusting the pH value to 6-8, and preparing the penaeus vannamei powder gel. And continuously stirring, adding carrageenan, heating and cooling to obtain the penaeus vannamei meal gel. The method disclosed by the invention is simple and easy to implement, and the pH migration treatment and the carrageenan treatment are utilized to generate a synergistic effect, so that the prepared penaeus vannamei powder gel meets the fifth-level standard of an IDDSI framework, and can meet the diet requirements of special crowds such as dysphagia patients on multiple aspects such as nutrition and texture.

The invention discloses a 5-HT1B gene molecular marker related to growth of penaeus vannamei boone and application, and belongs to the technical field of molecular marker-assisted breeding of aquatic animals. The sequence of the molecular marker is shown as SEQ ID NO.3, the molecular marker comprises five sites of E3-157G / A, E3-454C / G, E3-469C / T, E3-478G / C and E3-514G / T, and the dominant genotypes are AA or AG, GG or CG, CT, CG and TT or GT in sequence. The invention further provides a haplotype molecular marker composed of the E3-157G / A and the E3-514G / T, and the haplotype molecular marker comprises the E3-157G / A and the E3-514G The penaeus vannamei feed can be used for culture and improvement of penaeus vannamei; the method is not limited by the development stage, and can provide technical means and theoretical support for early breeding of penaeus vannamei individuals / families / varieties; the method can further shorten the breeding time and reduce the breeding cost.

The invention provides a methylobacterium strain JC03 for producing single-cell protein and application of the methylobacterium strain JC03 in the field of aquaculture, and belongs to the technical field of microorganisms. The methylobacterium strain JC03 is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.32616. The strain is high in growth efficiency, high in thallus crude protein content, rich in amino acid spectrum, high in essential amino acid content and rich in functional components for improving the immunocompetence of aquatic animals; the single-cell protein produced by the strain can completely or partially replace fish meal protein in feeds of marine fishes such as turbot, pseudosciaena crocea, grouper and rainbow trout; vegetable protein in feed of freshwater fish such as grass carp can be completely replaced; animal and plant proteins in feeds for shrimps and crabs, such as penaeus vannamei, can be completely replaced, and animal and plant proteins in stichopus japonicus feeds can be completely replaced; the immunocompetence of fed aquatic animals can be obviously improved. The invention provides a microbial strain for efficiently converting methanol to produce single-cell protein, and the microbial strain has a wide application prospect in the field of aquaculture.

The invention discloses South America white shrimp compound feed raw material crushing equipment for saline-alkali soil culture, and relates to the technical field of South America white shrimp compound feed raw material crushing. The side face of a crushing tank is fixedly connected with a control panel, and the bottom of the crushing tank is fixedly connected with a driving part; by arranging the contact mechanism, the crushing rod is driven to continuously rotate through the output end of the driving component, so that when materials in the crushing tank are slowly discharged, the extrusion force of the materials in the tank on the sliding plate is smaller than that of the materials in the crushing tank, and the crushing efficiency is improved. And when centrifugal force is generated during rotation of the crushing rods, the sliding plates and the sliding rods drive the rubber blocks to move towards the inner side of the crushing tank through the action of the centrifugal force, meanwhile, the rubber blocks collide with the inner side of the crushing tank, and meanwhile, part of impurities attached to the inner side of the tank body are shaken off through impact force generated during vibration.

According to the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei, an SNP molecular marker is cloned from a gamma-BBD gene, and the SNP marker is the 828th base G or A from the 5'terminal of a first nucleotide sequence shown in a sequence table. The primer pair of the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei comprises a primer gamma-BBD-F and a primer gamma-BBD-R, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.1 and SEQ ID NO.2: (1) SEQ ID NO.1: GCCAACAGGTCAACAG, (2) SEQ ID NO.3: GCAACAGGTCAAG, (3) SEQ ID NO.4: GCAACAGGTCAAG, and (4) SEQ ID NO.5: GCAACAGGTCAAG: And (2) TGAAGCCGTCGGCGAAGAAG as shown in SEQ ID NO. 2: According to the present invention, the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GA at the site of the SNP marker is significantly higher than the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GG, such that the high ammonia nitrogen tolerance of the litopenaeus vannamei can be effectively determined by detecting the SNP site of the litopenaeus vannamei; the SNP marker is closely related to the high ammonia nitrogen resistance character of the litopenaeus vannamei and can be effectively used for molecular marker-assisted breeding of the litopenaeus vannamei.

The invention relates to the technical field of aquatic product preservation, and discloses a natural eutectic solvent for maintaining the quality of frozen penaeus vannamei boone and application, the natural eutectic solvent is composed of choline chloride, sorbitol and water, the molar ratio of choline chloride to sorbitol is (1-5): (1-5), and the mass of water is 15-25% of the total mass of choline chloride and sorbitol. The invention also provides an application of the solvent, and the application comprises the following steps: soaking the penaeus vannamei meat in the solvent, and then freezing and storing the penaeus vannamei meat. A supramolecular network system is constructed through hydrogen-bond interaction between choline chloride and sorbitol, growth of ice crystals in the freezing storage process is inhibited, a protein structure is stabilized, and loss of unfrozen juice is reduced, so that the quality of the penaeus vannamei, such as texture, color and flavor, is maintained. The natural deep-eutectic solvent is natural and safe in component, low in heat, simple to prepare and convenient to apply, the application limitation of a traditional anti-freezing agent is solved, and the natural deep-eutectic solvent has a good industrial prospect.

The utility model discloses a feed putting device for penaeus vannamei breeding, which relates to the field of penaeus vannamei breeding and comprises a door-shaped supporting cross frame, a gear motor is arranged on one side of the door-shaped supporting cross frame, one side of the gear motor is connected with a reciprocating screw rod, the outer wall of the reciprocating screw rod is connected with a screw rod nut, and the screw rod nut is installed inside a T-shaped moving seat. A driving motor is arranged on one side of the T-shaped moving seat, a rotating rod is connected to one side of the driving motor, a cam is fixed to the outer wall of the rotating rod, a fixing cylinder is installed at the top of the T-shaped moving seat, a reset spring is fixed into the fixing cylinder, a limiting block is fixed to the top end of the reset spring, and a sliding column is fixed to the top of the limiting block. A storage box is fixed to the top of the sliding column, and a feeding pipe is fixedly connected to the side face of the storage box. By arranging the anti-blocking quick discharging mechanism, the plurality of groups of cams drive the storage box to vibrate up and down, so that the discharging speed is greatly improved, and meanwhile, the condition that feed holes are blocked by feed is also prevented.

The invention discloses a shrimp seed breeding method for regulating and controlling water quality through microalgae and probiotics under specific illumination. According to the technical scheme, the shrimp seed breeding method is characterized by comprising the following steps that firstly, a seedling breeding workshop is built; step 2, microalgae-probiotic culture: selecting microalgae and probiotic types beneficial to shrimp seedling culture, and culturing to obtain a microalgae solution and a probiotic solution; 3, seedling raising and putting preparation; step 4, putting shrimp larvae; step 5, putting of algae-probiotics; step 6, seedling culture illumination control; 7, feeding the young shrimps with bait; 8, monitoring and regulating water quality; and 9, evaluating the young shrimps out of the pond. According to the method, illumination is precisely controlled, the growth environment of microalgae and probiotics is optimized, and the synergistic effect of the microalgae and probiotics in the aspects of water purification, nutrition supply, disease prevention and control and the like is fully exerted, so that the water quality of penaeus vannamei larvae is improved, the survival rate and health condition of the penaeus vannamei larvae are improved, and the survival rate of penaeus vannamei larvae is increased. And a good foundation is laid for large-scale and high-efficiency culture of the penaeus vannamei.

The invention belongs to the field of aquaculture feed additives, and particularly relates to a compound preparation with a synergistic effect of an exocarpium citri grandis extract and probiotics and a preparation method of the compound preparation, and the compound preparation is used for preventing and treating enterohepatic cytozoonosis of penaeus vannamei. Comprising an exocarpium citri grandis extract preparation step, a bacillus subtilis and clostridium butyricum culture step and a compound exocarpium citri grandis feed additive preparation step. 0.1%-0.5% of the compound exocarpium citri rubrum feed additive is added into shrimp feed, and penaeus vannamei is fed; compared with a direct feeding feed, the compound exocarpium citri rubrum feed additive has the advantages that the morbidity of the enterocytozoonosis hepatopenaei of the shrimps is effectively reduced, and meanwhile, the occurrence of other diseases is reduced.

The invention relates to the technical field of paper cups, and discloses a compound bacterium for degrading nitrite in an aquaculture water body, the compound bacterium is composed of nitrifying bacteria, denitrifying bacteria, bacillus coagulans, a penetrant and a synergist, the nitrifying bacteria are mixed flora of autotrophic ammonia oxidizing bacteria and heterotrophic nitrifying bacteria, and the penetrant is a mixture of bacillus coagulans, denitrifying bacteria, bacillus coagulans, a penetrant and a synergist. The denitrifying bacteria comprise a synergistic effect system of the Pseudomonas (Pseudomonas) and the Paracoccus (Paracoccus), and the Pseudomonas (Pseudomonas) and the Paracoccus (Pseudomonas (Pseudomonas (Pseudomonas (Pseudomonas (Pseudomonas)) are The dual-path directional conversion of nitrite is realized through the synergistic effect of constructed nitrification-denitrification synergistic flora and a functional aid (polyethylene glycol-SDS-L-glutamine system). Parameter control shows that in a water body (NO2 <-> is equal to 2.5 mg / L) in the later culture period of the penaeus vannamei boone, the degradation rate reaches 81.4% within 48 hours, and the nitrate increment is controlled within 12%. The technology breaks through the bottleneck of failure of a traditional microbial agent in a high-salinity (35 per mill) and high-density culture environment, and is suitable for sea and fresh water whole-variety aquaculture.

The present invention discloses a relay aquaculture method for Penaeus japonicus, and relates to the field of biological aquaculture. The method employs a mixture of a protein source, a fat source, a complex vitamin, a complex inorganic salt, an attractant, and (-)-caryophyllene oxide-modified xanthan gum to prepare a bait for the relay aquaculture of Penaeus japonicus, resulting in a good survival rate, specific growth rate, and feed conversion coefficient for the Penaeus japonicus. The method also employs glucosamine-modified humic acid, which is used in the preparation of an amino acid fertilizer paste, which is then used in the relay aquaculture of Penaeus japonicus, resulting in an even better survival rate, specific growth rate, and feed conversion coefficient for the Penaeus japonicus.

The invention provides a rapid drug sensitivity detection kit for a breeding site, and belongs to the technical field of drug sensitivity detection. By preparing the penaeus vannamei polypeptide and adding the penaeus vannamei polypeptide into the casein tryptone liquid culture medium, the penaeus vannamei polypeptide has a remarkable promotion effect on the growth of common vibrio parahaemolyticus, vibrio harveyi and edwardsiella tarda in aquaculture, and the bacterial culture time can be shortened. The penaeus vannamei polypeptide is added into a drug sensitivity detection solution to be matched with a triphenyltetrazole chloride color developing agent and a drug sensitivity piece detection system, the prepared rapid drug sensitivity detection kit is used for drug sensitivity detection of clinical diseased prawn samples, and the drug sensitivity detection result can be judged only within 5 hours. The result judgment time is 4 hours earlier than that of a common drug sensitivity detection kit without the prawn polypeptide, and the problem of on-site rapid drug sensitivity detection of an aquaculture farm can be solved.

The utility model relates to an automatic material throwing device for penaeus vannamei culture, which comprises a base plate, walking wheels and a feeding part, the feeding part comprises a feeding roller and a feeding pipe arranged outside the feeding roller, the material throwing part comprises a material throwing roller and a material throwing box sleeved outside the material throwing roller, the material throwing box is connected with the feeding pipe through a connecting pipe, and the connecting pipe is connected with the feeding pipe. A feed throwing opening is formed in the front part of the feed throwing box, and bait is thrown out of the feed throwing opening by rotating the feed throwing roller; the collecting box is detachably arranged below the material throwing opening; the driving part is used for driving the device to operate; and the supporting part is used for supporting the device on the substrate. The automatic bait feeding device has the advantages that bait can be fed out at a constant speed through the designed feeding component, and equipment operation is prevented from being affected by blockage; through rotation of the throwing roller, baits are driven to generate centrifugal force in the throwing box and then thrown out of the throwing opening, automatic throwing can be achieved through combination of the throwing roller and the throwing roller, and compared with manual throwing, the automatic throwing device is efficient and uniform.

The method comprises the following steps: drying and crushing shrimp heads and shrimp shells, adding water according to a ratio of 1: 3, adding 0.5%-0.7% of compound protease, and carrying out enzymolysis at 50-55 DEG C for 2-3 hours; after enzyme deactivation, adding 7-10% of brown sugar to adjust the pH value to 6.0-6.5, and sterilizing; the method comprises the following steps: inoculating pineapple endophytic lactic acid bacteria (CGMCC 25352), hansenula polymorpha (CGMCC 25353) and aspergillus oryzae, mixing the three strains according to the viable count of 1: 1: 1 (the total inoculum size is 3-4.5%, and the CFU / g is 10-10), and fermenting for 46-48 hours at the temperature of 30-32 DEG C in a dark place; and filtering and storing at-80 DEG C. The product is free of salt addition, the fermentation period is less than or equal to 48 hours, the amino acid nitrogen content is greater than or equal to 0.51 g / 100g, the total content of lactic acid (6.88 mg / g), succinic acid (3.73 mg / g) and free amino acid is greater than or equal to 313mg / 100g, the volatile amino salt content is less than or equal to 38.72 mg / 100mL, and the product has salty and fresh flavor and orange-yellow clarified appearance. The problems of high salt, long period and heavy fishy smell of the traditional shrimp soy sauce are solved.

The application discloses an automatic oxygenation device for South American prawn culture ponds, which comprises a floating mechanism, wherein the floating mechanism comprises a floating plate and a float, the float is arranged on the floating plate, and a surge oxygenation mechanism and a non-powered self-translation mechanism are arranged on the floating mechanism. The application relates to the technical field of oxygenation devices, and particularly provides the automatic oxygenation device for South American prawn culture ponds, which can generate more bubbles, has a better oxygenation effect, can generate a surge effect in the oxygenation process, can diffuse the bubbles to a larger range, has a larger oxygenation range, can move in the culture pond in the oxygenation process without any independent drive, has a wider action range, and can actively control the moving speed.

The invention discloses application of freeze-dried squid powder, feed and a method for breeding shrimps, and relates to the technical field of feed. Wherein the freeze-dried squid powder is used for preparing the feed for promoting gonad development of male shrimps, and in the shrimp feed containing the fish meal, 40-60% of the fish meal is replaced by the freeze-dried squid powder. The invention not only provides a definite evidence for the obvious effect of the squid freeze-dried powder serving as a high-quality feed protein source in promoting the growth and gonad development of male parent shrimps of the penaeus vannamei, but also preliminarily reveals a molecular mechanism for regulating the growth and development of the male shrimps through a specific metabolic pathway; important scientific basis and technical support are provided for efficient and sustainable development of the aquatic product breeding industry.

The invention provides a litopenaeus vannamei gene introduction method based on sperm mediation. The method comprises the following steps: integrating a target gene onto plasmids, injecting the plasmids into maturely developed spermatophore of a male shrimp in advance, transferring the plasmids into the sperm by performing electrical stimulation on the sperm in the spermatophore of the male shrimp in an electrical stimulation mode, mating the female shrimp with the sperm to lay eggs, and introducing the target gene into a fertilized egg by using the sperm as a carrier, so as to obtain the target gene. The method is used for realizing efficient introduction of exogenous genes in a fertilized egg layer of the penaeus vannamei boone so as to finally realize creation of new germplasm of the penaeus vannamei boone.

The invention discloses a penaeus vannamei body size estimation method and device and a storage medium, and relates to the technical field of breeding industry image processing, and the method comprises the steps: collecting a penaeus vannamei data set image, and carrying out the marking of the penaeus vannamei data set image; constructing a penaeus vannamei body detection model, improving the penaeus vannamei body detection model, and training the improved penaeus vannamei body detection model based on the marked penaeus vannamei body data set image; and based on the trained penaeus vannamei body detection model, measuring the body size of the penaeus vannamei and estimating the length of the penaeus vannamei body. According to the method, the expression and fusion capabilities of the multi-scale features are enhanced, the positioning precision of the feature points of the prawns is improved, and a set of non-contact estimation system for the body sizes of the prawns is developed. The coordinates of the feature points of the shrimp bodies are accurately obtained, the body size indexes are calculated, and accurate estimation of the shrimps with different completeness degrees is achieved. Rapid and accurate non-contact prawn body size measurement is realized, and powerful technical support is provided for intelligent and accurate cultivation of the penaeus vannamei.

The application discloses a compound Chinese herbal medicine fermentation preparation for preventing and treating hepatotoxicity of Penaeus vannamei and a preparation method thereof. Spore bacillus is used as a fermentation strain to perform aerobic fermentation on four traditional Chinese herbal medicine stem and leaf wastes, i.e. Astragalus stem and leaf, Rhubarb stem and leaf, Codonopsis stem and leaf and Coptis stem and leaf, so as to obtain a compound Chinese herbal medicine fermentation product with higher active substances. The compound Chinese herbal medicine fermentation preparation of the application can be added into the feed of Penaeus vannamei, so as to effectively prevent and treat hepatotoxicity of Penaeus vannamei.

The utility model discloses a kind of feed devices for Penaeus vannamei breeding with timing feeding, including box, the top of the box is equipped with mounting bracket by sliding mechanism, the side of the mounting bracket is equipped with moving plate and L-shaped plate by moving mechanism. Feed is stored by feeding hopper, feed can be discharged by discharging mechanism, Penaeus vannamei in the box can be fed, feed can be scattered by scattering mechanism, so that feed is more evenly dispersed, the speed of second motor is adjusted, so that the range of feed dispersion increases or decreases, moving plate is moved by moving mechanism, feeding hopper is moved by moving plate, so that the vertical position of discharging position is adjusted, mounting bracket is moved by sliding mechanism, feeding hopper is moved by mounting bracket, so that the horizontal position of discharging position is adjusted, so that the horizontal and vertical positions of feeding hopper are conveniently adjusted.

The utility model relates to the technical field of culture water filtering equipment, and one embodiment of the utility model provides an automatic backwashing South America white shrimp culture water filter which comprises a shell and a pair of supports, the supports are both fixed to the bottom of the shell, a side cover is arranged on one side of the shell, and a connecting assembly is arranged between the shell and the side cover. The filtering and flushing assembly is arranged on the side cover and the shell and comprises a driving motor, the driving motor is installed on the side surface of the side cover, a pair of partition plates is arranged in the shell, one partition plate is connected with the output end of the driving motor, and a filtering layer is connected between the partition plates. According to the technical scheme, the technical problems that a traditional filter in the prior art generally does not have an automatic backwashing function, needs to be manually cleaned, is tedious to operate and is difficult to ensure timely cleaning are solved.

The invention discloses a probe for detecting a penaeus japonicus SNP molecular marker combination, a penaeus japonicus 31K liquid phase breeding chip and application, and belongs to the technical field of molecular marker breeding. The penaeus japonicus SNP molecular marker combination is composed of 31097 SNP molecular markers. The 31097 SNP molecular markers are as shown in the specification table 1. The invention also provides application of the penaeus japonicus liquid phase breeding chip in penaeus japonicus breeding, sample detection, genetic resource genetic diversity analysis, genetic and evolutionary analysis, genetic relationship identification, whole genome association analysis and penaeus japonicus genome selection. The penaeus japonicus 31K liquid phase breeding chip provided by the invention has the characteristics of good site representativeness, strong specificity, high polymorphism and the like, is widely applicable to detection of different varieties of penaeus japonicus materials, can establish a modern breeding system, and promotes the development of the penaeus japonicus molecular breeding industry.

The application is a deep learning-based method for breeding and multiplying Penaeus vannamei, which comprises: obtaining genomic data of the initial population; obtaining specific trait data of the screened initial population; locating a specific gene sequence set according to the specific trait data and the genomic data; the gene sequence set is a gene number set related to the specific trait; and determining the breeding shrimp for breeding according to the gene number set. The application first breeds Penaeus vannamei populations of different families, obtains the trait phenotype data and genomic data of Penaeus vannamei under different families, determines the gene sequence meeting the trait phenotype requirements according to the correlation degree between the trait phenotype data and the genomic data, that is, locates the gene sequence related to the specific trait, and then selects the next generation of Penaeus vannamei according to the gene sequence set, or directly breeds the breeding shrimp with stable traits.

The utility model belongs to the technical field of genetic material extraction appliance, concretely relates to special centrifugal tube suit of south American white prawn nucleic acid extraction, including the pipe body, the top threaded connection of pipe body has the pipe cap, the position department of pipe body outer wall is close to the fixed setting of mounting ring of top, the outer wall of pipe cap is below the sliding ring of mounting ring and is connected with the damping sliding, the position department of mounting ring bottom close to the outside edge is hinged with four upper articulated rods at equal intervals, the top of sliding ring is hinged with the lower articulated rod of corresponding position of upper articulated rod, and the corresponding upper articulated rod is hinged with the lower articulated rod between setting articulated assembly. The utility model places the pipe body on the test tube rack through the amplitude of the lower articulated rod and the upper articulated rod protruding from the outside of the pipe body to support the pipe body, so that the pipe body can be adapted to different diameter types of test tube racks, increase the types of centrifugal tubes that can be adapted to test tube racks, facilitate the use of centrifugal tubes, and at the same time, reduce the types of test tube racks that need to be purchased, and reduce the cost of purchasing test tube racks.