Penaeus vannamei HIF-1alpha gene SNP (Single Nucleotide Polymorphism) molecular marker and application thereof

Abstract

The invention discloses SNP (Single Nucleotide Polymorphism) molecular markers of a Penaeus vannamei HIF-1alpha gene. The SNP molecular markers are respectively positioned at basic groups of the 67th site, the 119th site, the 133rd site, the 172nd site, the 340th site, the 409th site, the 437th site, the 474th site, the 577th site, the 647th site and the 749th site of a nucleotide sequence shown in a sequence 1 in a sequence table. The molecular marker is used as a functional marker of the nitrite-resistant character of the penaeus vannamei for breeding, specifically, genome DNA of muscular tissue of the penaeus vannamei to be detected is extracted, then the obtained genome DNA is used as a template for PCR amplification and purification of a PCR amplification product, then the obtained PCR amplification product is sequenced, and the content of the nitrite-resistant character of the penaeus vannamei is determined. The genotype of the molecular marker is determined, so that dominant genotype individuals are selected for breeding the penaeus vannamei boone, and a penaeus vannamei boone strain with good nitrite-resistant character can be obtained.

Description

Technical Field

[0001] The invention belongs to the technical field of whiteleg shrimp breeding, and particularly relates to a whiteleg shrimp HIF-1α gene SNP molecular marker and application thereof. Background Art

[0002] Litopenaeus vannamei is one of the most important economic shrimps in the world, with delicious meat, rapid growth and rich nutrition. China's aquaculture production ranks among the top in the world. In recent years, with the extension of aquaculture time, a large amount of residual bait, excrement and metabolites will settle on the bottom of the pond due to high-density aquaculture of white shrimp, which aggravates the deterioration of the water environment and affects the health and production of shrimp. Nitrite is one of the common environmental pollutants in aquaculture systems. Nitrite, as an intermediate product of the nitrogen cycle in water, comes from the nitrification of ammonia nitrogen and the denitrification of nitrate. Therefore, as long as there is nitrogen in the water, nitrite will be generated. In the process of shrimp farming, due to the large amount of organic nitrogen remaining in the water, the nitrite in the water is still low in the early stage of farming, but it rises sharply in the middle and late stages of farming, which is a limiting factor in the middle and late stages of farming. A certain mass concentration of nitrite will inhibit the growth and metamorphosis of shrimp, especially the destruction of the oxygen carrying and oxygen release capacity of hemocyanin, which is considered to be one of the main mechanisms of its toxicity to shrimp.

[0003] Hypoxia-inducible factor-1 (HIF-1) is a key transcription factor that exists in various animals and humans and regulates the response of multiple molecules to hypoxia. It has a wide range of target genes, and more than 100 have been identified. HIF-1 is a heterodimer composed of α and β subunits. The α and β subunits of the HIF-1 gene are mainly constitutively transcribed and translated independently of oxygen tension, but only HIF is regulated at the post-translational level. HIF-1α is the active subunit of HIF-1. Under normoxic conditions, HIF-1α is continuously synthesized and continuously hydrolyzed through the ubiquitin-proteasome pathway. Under hypoxic conditions, HIF-1α degradation is blocked, and the accumulation in the cytoplasm increases, and it moves to the nucleus and combines with HIF-1B to form HIF-1 molecules. HIF-1α regulates the organism by activating erythropoietin, glucose transporters, and glycolytic enzymes, thereby increasing oxygen exchange or promoting metabolism to adapt to the hypoxic environment.

[0004] Nitrite binds to hemocyanin, destroying its ability to carry and release oxygen, causing hypoxia in shrimp, which further inhibits shrimp growth and metamorphosis, causing shrimp immunity to decline and even death. The present invention provides basic data and reference for molecular-assisted breeding of new varieties of nitrite-resistant white shrimp by studying the SNP marker sites related to the HIF-1α gene and the nitrite-resistant traits of white shrimp. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker of HIF-1α gene of white shrimp, and use them as functional markers of nitrite-nitrogen resistance of white shrimp, so as to lay a foundation for molecular-assisted breeding of nitrite-nitrogen resistance strains of white shrimp.

[0006] The present invention is achieved by adopting the following technical solutions: A SNP molecular marker of HIF-1α gene of white shrimp, comprising molecular marker D.12311 (C>T), molecular marker D.12363 (G>T), molecular marker D.12377 (T>A), molecular marker D.12416 (C>A), molecular marker D.12584 (A>G), molecular marker D.12653 (T>C), molecular marker D.12681 (G ...584 (A>G), molecular marker D.12653 (T>C), molecular marker D.12681 (G>A), molecular marker D.12416 (C>A), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D.12584 (A>G), molecular marker D. 2718 (T>G), molecular marker D.12821 (T>A), molecular marker D.12891 (G>A), molecular marker D.12993 (G>A), and are located respectively at the 67th, 119th, 133rd, 172nd, 340th, 409th, 437th, 474th, 577th, 647th, and 749th bases of the nucleotide sequence shown in Sequence 1 of the sequence listing.

[0007] The polymorphic forms of the molecular marker D.12311, molecular marker D.12363, molecular marker D.12377, molecular marker D.12416, molecular marker D.12584, molecular marker D.12653, molecular marker D.12681, molecular marker D.12718, molecular marker D.12821, molecular marker D.12891, and molecular marker D.12993 are C / T, G / T, A / T, A / C, A / G, C / T, A / G, G / T, A / T, A / G, and A / G, respectively.

[0008] The genotype of the molecular marker D.12311 includes CC genotype and CT genotype; The genotype of the molecular marker D.12363 includes a GG genotype and a GT genotype; The genotype of the molecular marker D.12377 includes AT genotype and TT genotype; The genotype of the molecular marker D.12416 includes AC genotype and CC genotype; The genotypes of the molecular marker D.12584 include AA genotype, GG genotype and AG genotype; The genotypes of the molecular marker D.12653 include CT genotype and TT genotype; The genotype of the molecular marker D.12681 includes AG genotype and GG genotype; The genotype of the molecular marker D.12718 includes GT genotype and TT genotype; The genotypes of the molecular marker D.12821 include AA genotype, AT genotype and TT genotype; The genotype of the molecular marker D.12891 includes AG genotype and GG genotype; The genotypes of the molecular marker D.12993 include AG genotype and GG genotype.

[0009] The application of the SNP molecular marker of the HIF-1α gene of white shrimp is used for the breeding of white shrimp resistant to nitrite nitrogen. Specifically, the genomic DNA of the muscle tissue of the white shrimp to be tested is first extracted, and the obtained genomic DNA is used as a template for PCR amplification and purification of the PCR amplification product, and then the obtained PCR amplification product is sequenced to determine the genotypes of the molecular marker D.12311, molecular marker D.12363, molecular marker D.12377, molecular marker D.12416, molecular marker D.12584, molecular marker D.12653, molecular marker D.12681, molecular marker D.12718, molecular marker D.12821, molecular marker D.12891, and molecular marker D.12993; When the genotype of the molecular marker D.12311 is the dominant genotype CC genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; When the genotype of the molecular marker D.12363 is the dominant genotype GG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12377 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12416 is the CC genotype of the dominant genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12584 is the dominant genotype of GG genotype or AG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12653 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the molecular marker D.12681 is a dominant genotype of GG, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12718 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12821 is the dominant genotype of AA genotype or AT genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12891 is the dominant genotype GG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12993 is the dominant genotype, the GG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties.

[0010] Furthermore, during the PCR amplification process, the primers used to detect the SNP molecular marker of the HIF-1α gene of the white shrimp include primer F1, primer R1, and primer F2; The nucleotide sequence of the primer F1 is: TGTCCTTATGTGTCGGTGGTT (as shown in sequence 2 in the sequence list); The nucleotide sequence of the primer R1 is: CTCTCCTTAGCATCATCACTTGG (as shown in sequence 3 in the sequence list); The nucleotide sequence of the primer F2 is: GTTGGTGTTGAGTTCGGATGAT (as shown in sequence 4 in the sequence listing).

[0011] Furthermore, two PCR amplifications were performed during the PCR amplification process, the amplification system of the first PCR included 5 μL of 2×Es Taq MasteMix, 0.2 μL of a template with a concentration of 100 ng / μL, 0.4 μL of a primer F1 with a concentration of 10 μmol / L, 0.4 μL of a primer R1 with a concentration of 10 μmol / L, and 4 μL of ddH2O; the amplification system of the second PCR included 25 μL of 2×Es Taq MasteMix, 1 μL of the product of the first PCR amplification diluted 100 times, 2 μL of a primer F2 with a concentration of 10 μmol / L, 2 μL of a primer R1 with a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0012] Furthermore, the amplification program of the first PCR amplification is: S101: pre-denaturation at 94°C for 5 min; S102: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 amplification cycles; S103: post-extension at 72°C for 7 min; The amplification procedure of the second PCR is: S201: pre-denaturation at 94°C for 3 min; S202: denaturation at 94°C for 30 s, annealing at 66°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; S203: Post-extension at 72°C for 7 min.

[0013] Compared with the prior art, this technical solution has the following beneficial effects: 1. The present invention provides a HIF-1α gene SNP site associated with the nitrite-nitrogen resistance trait of white shrimp, wherein 10 of the 11 SNP sites have extremely significant correlations with the nitrite-nitrogen resistance trait of white shrimp, and 1 SNP site is significantly correlated with the nitrite-nitrogen resistance trait of white shrimp, and 6 of the SNP sites can be selected as TaggerSNPs.

[0014] 2. Applying the molecular markers provided by the present invention to the breeding of nitrite-resistant Penaeus vannamei, retaining individuals with favorable genotypes and eliminating individuals with unfavorable genotypes can effectively improve the nitrite-resistant ability of Penaeus vannamei, and the genotypes of the selected individuals are stable and do not undergo genetic differentiation, so that accurate screening can be performed without large-scale nitrite stress experiments. It can be seen that the use of the present invention to assist the breeding of nitrite-resistant traits of Penaeus vannamei through molecules can significantly improve the breeding efficiency and accuracy and promote the breeding process, providing a good foundation for the research on nitrite-resistant varieties of Penaeus vannamei. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is a partial fragment sequence of the product obtained by amplifying the HIF-1α gene in the embodiment, a represents the 62nd to 72nd positions, wherein the CC and CT peak diagrams of the D.12311 (C>T) site are shown; b represents the 114th to 124th positions, wherein the GG and GT peak diagrams of the D.12363 (G>T) site are shown; c represents the 128th to 138th positions, wherein the AT and TT peak diagrams of the D.12377 (T>A) site are shown; d represents the 167th to 177th positions, wherein the AC and CC peak diagrams of the D.12416 (C>A) site are shown.

[0016] Figure 2It is a partial fragment sequence of the product obtained by amplifying the HIF-1α gene in the embodiment, e represents the 335th to 345th positions, wherein the AA and AG peak diagrams of the D.12584 (A>G) site are shown; f represents the 404th to 414th positions, wherein the CT and TT peak diagrams of the D.12653 (T>C) site are shown; g represents the 432nd to 442nd positions, wherein the AG and GG peak diagrams of the D.12681 (G>A) site are shown; h represents the 469th to 479th positions, wherein the GT and TT peak diagrams of the D.12718 (T>G) site are shown.

[0017] Figure 3 It is a partial fragment sequence of the product obtained by amplifying the HIF-1α gene in the embodiment, i represents the 572nd to 582nd positions, wherein the AA, AT, and TT peak graphs of the D.12821 (T>A) site are displayed; j represents the 642nd to 652nd positions, wherein the AG and GG peak graphs of the D.12891 (G>A) site are displayed; k represents the 744th to 754th positions, wherein the AG and GG peak graphs of the D.12993 (G>A) site are displayed.

[0018] Figure 4 It is a linkage analysis map of 11 SNP sites of the HIF-1α gene of Penaeus vannamei described in the Examples. DETAILED DESCRIPTION

[0019] The present invention is further described by the following examples, but is not intended to be limiting of the present invention. Specific experimental conditions and methods not specified in the following examples are conventional methods commonly known to those skilled in the art.

[0020] Embodiment: The screening process of the SNP molecular marker of the HIF-1α gene of Penaeus vannamei described in the present invention is as follows: (1) Take several plastic drums with a volume of 1000L, fill them with 500L of aquaculture water, and add analytically pure sodium nitrite to make the concentration of sodium nitrite in the aquaculture water in the plastic drums be 757.18mg / L; select 240 whiteleg shrimps weighing about 10g and temporarily culture them for 3 days, then put 30 whiteleg shrimps in each plastic drum for nitrite nitrogen stress experiment. During the whole experiment, the water was kept aerated, the pH value was kept at 8.2±0.3, the temperature was kept at 27±0.5℃, and the salinity was kept at 30.0‰ , dissolved oxygen was maintained at 7-8 mg / L, no feed was fed during the experiment to maintain the experimental concentration of nitrite nitrogen, new water was replaced every 24 hours during the experiment, and the concentration of sodium nitrite was readjusted to 757.18 mg / L, when the white shrimp turned sideways and did not swim away quickly or had no obvious reaction when touched with a wooden stick, and still turned sideways, it was considered dead; after 3 hours of stress, the death of individuals was recorded, and 51 white shrimp that died within 3-12 hours and 56 that survived after 96 hours were selected as samples of the nitrite-nitrogen-sensitive group and the nitrite-nitrogen-tolerant group respectively; (2) All samples selected in step (1) were subjected to ammonium acetate / isopropanol method to extract total DNA from muscle tissue of whiteleg shrimp, and the quality and integrity of the extracted DNA were detected by ultra-micro UV spectrophotometer and agarose gel electrophoresis. The obtained total DNA was stored at -20 °C for future use; (3) Screening partial DNA fragments of the HIF-1α gene of white shrimp to design specific primers, the following primers were obtained: Primer F1, the sequence of which is: TGTCCTTATGTGTCGGTGGTT; Primer R1, the sequence of which is: CTCTCCTTAGCATCATCACTTGG; Primer F2, the sequence of which is: GTTGGTGTTGAGTTCGGATGAT; (4) The total DNA obtained in step (2) was used as a template, and the primers designed in step (3) were used to perform nested PCR amplification of the target fragment. In the specific PCR amplification process, two PCR amplifications were performed. The amplification system of the first PCR included 5 μL of 2×Es Taq MasteMix, 0.2 μL of a template with a concentration of 100 ng / μL, 0.4 μL of a primer F1 with a concentration of 10 μmol / L, 0.4 μL of a primer R1 with a concentration of 10 μmol / L, and 4 μL of ddH2O; the amplification system of the second PCR included 25 μL of 2×Es Taq MasteMix, 1 μL of the product of the first PCR amplification diluted 100 times, 2 μL of a primer F2 with a concentration of 10 μmol / L, 2 μL of a primer R1 with a concentration of 10 μmol / L, and 20 μL of ddH2O. The amplification program of the first PCR amplification is: S101: pre-denaturation at 94°C for 5 min; S102: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 amplification cycles; S103: post-extension at 72°C for 7 min; The amplification procedure of the second PCR is: S201: pre-denaturation at 94°C for 3 min; S202: denaturation at 94°C for 30 s, annealing at 66°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; S203: post-extension at 72°C for 7 min; (5) The PCR amplification product obtained in step (4) was purified and sequenced after 1% agarose gel electrophoresis, and the sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence comparison and peak analysis, to screen out related SNPs sites; See also Figures 1 to 3 , the nucleotide sequence of the PCR amplification product of one of the samples is shown in Sequence 1 of the sequence table, wherein the 67th position is D.12311 (C>T), the 119th position is D.12363 (G>T), the 133rd position is D.12377 (T>A), the 172nd position is D.12416 (C>A), the 340th position is D.12584 (A>G), the 409th position is D.12653 (T>C), the 437th position is D.12681 (G>A), the 474th position is D.12718 (T>G), the 577th position is D.12821 (T>A), the 647th position is D.12891 (G>A), and the 749th position is D.12993 (G>A); (6) Based on the selected SNPs, the white shrimp in the sensitive group and the tolerant group were tested and genotyped according to the above method. The samples of different SNPs in the sensitive group and the tolerant group were counted, and the genotype frequency and allele frequency were calculated. The chi-square analysis was used for independence test. The specific results are shown in Table 1. Table 1 Chi-square analysis results of SNP marker loci

[0021] According to the analysis in Table 1, the dominant type of molecular marker D.12311 (C>T) is CC genotype, the dominant type of molecular marker D.12363 (G>T) is GG genotype, the dominant type of molecular marker D.12377 (T>A) is TT genotype, the dominant type of molecular marker D.12416 (C>A) is CC genotype, the dominant type of molecular marker D.12584 (A>G) is AG and GG genotype, and the dominant type of molecular marker D.126 The dominant type of 53 (T>C) is TT genotype, the dominant type of molecular marker D.12681 (G>A) is GG genotype, the dominant type of molecular marker D.12718 (T>G) is TT genotype, the dominant type of molecular marker D.12821 (T>A) is AA and AT genotypes, the dominant type of molecular marker D.12891 (G>A) is GG genotype, and the dominant type of molecular marker D.12993 (G>A) is GG genotype.

[0022] At the same time, linkage disequilibrium analysis was performed on 11 SNP loci. Figure 4 It was found that D.12311 (C>T) and D.12653 (T>C), D.12584 (A>G) and D.12821 (T>A), D.12363 (G>T), D.12377 (T>A), D.12681 (G>A) and D.12718 (T>G) were completely linked; the sites D.12681 (G>A), D.12584 (A>G), D.12311 (C>T), D.12416 (C>A), D.12993 (G>A), and D.12891 (G>A) can be selected as Tagger SNPs.

[0023] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A SNP molecular marker of HIF-1α gene of Penaeus vannamei, characterized by: The SNP molecular markers of the HIF-1a gene of white shrimp include molecular marker D.12311, molecular marker D.12363, molecular marker D.12377, molecular marker D.12416, molecular marker D.12584, molecular marker D.12653, molecular marker D.12681, molecular marker D.12718, molecular marker D.12821, molecular marker D.12891, and molecular marker D.12993, and are located at the 67th, 119th, 133rd, 172nd, 340th, 409th, 437th, 474th, 577th, 647th, and 749th bases of the nucleotide sequence shown in sequence 1 of the sequence table, respectively.

2. The use of the SNP molecular marker of the HIF-1α gene of Penaeus vannamei according to claim 1, characterized in that: The SNP molecular marker of the HIF-1α gene of white shrimp is used for the breeding of white shrimp nitrite-nitrogen-resistant varieties, specifically, the genomic DNA of the muscle tissue of the white shrimp to be tested is first extracted, and the obtained genomic DNA is used as a template for PCR amplification and purification of the PCR amplification product, and then the obtained PCR amplification product is sequenced to determine the genotypes of the molecular marker D.12311, molecular marker D.12363, molecular marker D.12377, molecular marker D.12416, molecular marker D.12584, molecular marker D.12653, molecular marker D.12681, molecular marker D.12718, molecular marker D.12821, molecular marker D.12891, and molecular marker D.12993; When the genotype of the molecular marker D.12311 is the dominant genotype CC genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; When the genotype of the molecular marker D.12363 is the dominant genotype GG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12377 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12416 is the CC genotype which is the dominant genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12584 is the dominant genotype of GG genotype or AG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12653 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12681 is the dominant genotype GG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12718 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12821 is the dominant genotype of AA genotype or AT genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12891 is the dominant genotype GG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12993 is the dominant genotype, the GG genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties.

3. The use of the SNP molecular marker of the HIF-1α gene of Penaeus vannamei according to claim 2, characterized in that: During the PCR amplification process, the primers used to detect the SNP molecular marker of the HIF-1α gene of the white shrimp include primer F1, primer R1, and primer F2; The nucleotide sequence of the primer F1 is: TGTCCTTATGTGTCGGTGGTT; The nucleotide sequence of the primer R1 is: CTCTCCTTAGCATCATCACTTGG; The nucleotide sequence of the primer F2 is: GTTGGTGTTGAGTTCGGATGAT.

4. The use of the SNP molecular marker of the HIF-1α gene of Penaeus vannamei according to claim 2, characterized in that: During the PCR amplification process, two PCR amplifications were performed, and the amplification system of the first PCR included 5 μL of 2×Es TaqMasteMix, 0.2 μL of a template with a concentration of 100 ng / μL, 0.4 μL of a primer F1 with a concentration of 10 μmol / L, 0.4 μL of a primer R1 with a concentration of 10 μmol / L, and 4 μL of ddH2O; the amplification system of the second PCR included 25 μL of 2×Es TaqMasteMix, 1 μL of the product of the first PCR amplification diluted 100 times, 2 μL of a primer F2 with a concentration of 10 μmol / L, 2 μL of a primer R1 with a concentration of 10 μmol / L, and 20 μL of ddH2O.

5. The use of the SNP molecular marker of the HIF-1α gene of Penaeus vannamei according to claim 2, characterized in that: The amplification program of the first PCR amplification is: S101: pre-denaturation at 94°C for 5 min; S102: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 amplification cycles; S103: post-extension at 72°C for 7 min; The amplification procedure of the second PCR is: S201: pre-denaturation at 94°C for 3 min; S202: denaturation at 94°C for 30 s, annealing at 66°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; S203: Post-extension at 72°C for 7 min.

Images