Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

28 results about "Melicertus" patented technology

Melicertus is a genus of "king" prawns, comprising eight species which were previously classified as members of the genus Penaeus...

Penaeus vannamei quality prediction and grade evaluation method and system

The invention provides a penaeus vannamei quality prediction and grade evaluation method and system, and belongs to the field of penaeus vannamei cold-chain transportation process quality prediction, and the method comprises the steps: S1, constructing a penaeus vannamei data set, and carrying out the dynamic time-varying coupling correlation graph generation, convection-diffusion cooperative information propagation, multi-task joint optimization and end-to-end MLP prediction to obtain a penaeus vannamei data set; obtaining a prediction result of the quality of the penaeus vannamei; s2, splicing is performed according to the prediction result and the actual quality data, and a feature matrix is constructed; clustering the feature matrix by using a rule fusion K-means + + clustering method to obtain an optimal clustering center set; and S3, based on the prediction result and the clustering center set, carrying out dynamic prediction and evaluation on the quality of the penaeus vannamei in the refrigeration state in a period of time in the future. According to the invention, an intelligent solution is provided for quality monitoring in cold-chain logistics, and economic loss caused by quality deterioration is significantly reduced.
Owner:BEIJING TECH & BUSINESS UNIV

Compound exocarpium citri rubrum feed additive for preventing and controlling enterohepatic cytozoonosis of South America white shrimps

The invention belongs to the field of aquaculture feed additives, and particularly relates to a compound preparation with a synergistic effect of an exocarpium citri grandis extract and probiotics and a preparation method of the compound preparation, and the compound preparation is used for preventing and treating enterohepatic cytozoonosis of penaeus vannamei. Comprising an exocarpium citri grandis extract preparation step, a bacillus subtilis and clostridium butyricum culture step and a compound exocarpium citri grandis feed additive preparation step. 0.1%-0.5% of the compound exocarpium citri rubrum feed additive is added into shrimp feed, and penaeus vannamei is fed; compared with a direct feeding feed, the compound exocarpium citri rubrum feed additive has the advantages that the morbidity of the enterocytozoonosis hepatopenaei of the shrimps is effectively reduced, and meanwhile, the occurrence of other diseases is reduced.
Owner:喀什大学 +1

Penaeus vannamei body size estimation method and device and storage medium

The invention discloses a penaeus vannamei body size estimation method and device and a storage medium, and relates to the technical field of breeding industry image processing, and the method comprises the steps: collecting a penaeus vannamei data set image, and carrying out the marking of the penaeus vannamei data set image; constructing a penaeus vannamei body detection model, improving the penaeus vannamei body detection model, and training the improved penaeus vannamei body detection model based on the marked penaeus vannamei body data set image; and based on the trained penaeus vannamei body detection model, measuring the body size of the penaeus vannamei and estimating the length of the penaeus vannamei body. According to the method, the expression and fusion capabilities of the multi-scale features are enhanced, the positioning precision of the feature points of the prawns is improved, and a set of non-contact estimation system for the body sizes of the prawns is developed. The coordinates of the feature points of the shrimp bodies are accurately obtained, the body size indexes are calculated, and accurate estimation of the shrimps with different completeness degrees is achieved. Rapid and accurate non-contact prawn body size measurement is realized, and powerful technical support is provided for intelligent and accurate cultivation of the penaeus vannamei.
Owner:NANJING AGRICULTURAL UNIVERSITY

Deep learning-based method for breeding and multiplying penaeus vannamei

The application is a deep learning-based method for breeding and multiplying Penaeus vannamei, which comprises: obtaining genomic data of the initial population; obtaining specific trait data of the screened initial population; locating a specific gene sequence set according to the specific trait data and the genomic data; the gene sequence set is a gene number set related to the specific trait; and determining the breeding shrimp for breeding according to the gene number set. The application first breeds Penaeus vannamei populations of different families, obtains the trait phenotype data and genomic data of Penaeus vannamei under different families, determines the gene sequence meeting the trait phenotype requirements according to the correlation degree between the trait phenotype data and the genomic data, that is, locates the gene sequence related to the specific trait, and then selects the next generation of Penaeus vannamei according to the gene sequence set, or directly breeds the breeding shrimp with stable traits.
Owner:GUANGDONG YUEHAI FEED GROUP

SNP molecular marker related to cold resistance character of DDO gene of penaeus vannamei boone and application of SNP molecular marker

The invention discloses an SNP molecular marker related to the cold resistance character of a penaeus vannamei DDO gene and application of the SNP molecular marker, and belongs to the technical field of penaeus vannamei breeding, the nucleotide sequence of the SNP molecular marker is shown as a sequence 1 in a sequence table, and the SNP molecular marker is remarkably related to the cold resistance character of the penaeus vannamei. The method comprises the following steps: extracting genome DNA of muscular tissues of penaeus vannamei boone to be detected, carrying out PCR amplification by taking the genome DNA as template DNA, purifying a PCR amplification product, sequencing the obtained product, and screening the penaeus vannamei boone variety with cold resistance according to genotypes of different sites on the SNP molecular marker. The marker is high in accuracy and good in stability, is suitable for molecular marker assisted breeding, can be used for rapidly and accurately screening litopenaeus vannamei individuals with cold-resistant characters in an early stage, and remarkably improves the breeding efficiency and accuracy of new cold-resistant varieties, so that the breeding success rate and economic benefits are improved.
Owner:GUANGXI ACADEMY OF FISHERY SCI

40S ribosomal protein SA molecular marker and application thereof in prawn multi-trait selection

The invention discloses a 40S ribosomal protein SA molecular marker, the nucleotide sequence of the 40S ribosomal protein SA molecular marker is shown as a sequence 1 in a sequence table, and the basic group on the 175th site is C or T. The molecular marker is applied to breeding of penaeus vannamei boone, specifically, genome DNA of muscular tissue of penaeus vannamei boone to be detected is extracted, the genome DNA is used as a template for PCR amplification and purification of a PCR amplification product, then the obtained product is sequenced, the genotype of the 175th site in the molecular marker is determined, and the molecular marker is used for breeding of penaeus vannamei boone. Therefore, genotype individuals with advantages are selected for breeding the penaeus vannamei boone, and research and application of disease-resistant and stress-resistant breeding of the penaeus vannamei boone are promoted.
Owner:NAT AQUATIC TECH PROMOTION STATION +1

A method for identifying whether a sample to be tested is infected with SGDV and a special primer pair thereof

ActiveCN116144648BInfectious DisorderMelicertus
The application discloses a method for identifying whether a sample to be detected is infected with a shrimp glass disease virus (SGDV) and a special primer pair thereof. The inventor of the application finds a new small ribonucleic acid virus SGDV in Penaeus vannamei Boone, and the nucleotide sequence of the virus is shown in SEQ ID NO: 3. Experiments prove that a primer pair composed of a primer F shown in SEQ ID NO: 1 and a primer R shown in SEQ ID NO: 2 can accurately identify whether the sample to be detected is infected with the SGDV. The application has important application value, and helps us to deepen the understanding of virus diversity, provides guidance for the breeding of the Penaeus vannamei Boone and has important significance for preventing infectious diseases in aquaculture.
Owner:BEIJING UNIV OF CHEM TECH

Rapid breaker for gill tissues of penaeus vannamei boone

The utility model belongs to the technical field of shrimp gill tissue crushing, and particularly relates to a quick crusher for gill tissues of penaeus vannamei boone, which comprises an adjusting base, an adjusting type container cooling mechanism is mounted at the top of the adjusting base, and the adjusting type container cooling mechanism comprises a plurality of cooling clamping plates. The multiple cooling clamping plates are annularly arranged and slidably mounted above the adjusting base, and circulating cooling channels are formed in the cooling clamping plates. A cooling liquid storage box is arranged on one side of the adjusting base, an electric lifting push rod is fixed to the top of the cooling liquid storage box, a supporting plate is fixed to the top of the electric lifting push rod, and a first motor is fixed to the top of one end of the supporting plate. According to the utility model, through the cooling system which can be moved and adjusted, by adjusting the position of the cooling system, the containers with different specifications can be attached and fixed, the low temperature in the containers can be maintained, the containers are convenient to disassemble and replace, the containers with proper capacities can be selected according to required sample sizes, and the use is more convenient.
Owner:NANJING AGRICULTURAL UNIVERSITY

A microecological preparation for temporary rearing of whiteleg shrimp after capture, and its preparation method and application

ActiveCN120118811BAntibacterial agentsBacteriaAnimal scienceMelicertus
The invention discloses a probiotic preparation for post-harvest temporary aquaculture of whiteleg shrimp (Penaeus vannamei), a preparation method thereof, and an application thereof. The probiotic preparation is characterized in that the probiotic preparation comprises at least one of a fermented Lactobacillus mucilaginosus RC3 strain and a Lactobacillus plantarum B6 strain, the fermented Lactobacillus mucilaginosus RC3 having a preservation number of CGMCC No. 30602, and the Lactobacillus plantarum B6 having a preservation number of CGMCC No. 30603. The probiotic preparation is prepared by mixing a fermented Lactobacillus mucilaginosus RC3 seed liquid and a Lactobacillus plantarum B6 seed liquid in a volume ratio of (1-2):(1-2), and then inoculating the mixture into an MRS liquid culture medium in a volume ratio of 5-10% to obtain the probiotic preparation for post-harvest temporary aquaculture of whiteleg shrimp. The probiotic preparation has the advantages of reducing the contents of nitrite nitrogen and ammonia nitrogen in aquaculture water, improving the antioxidant and immune properties of shrimp, optimizing intestinal flora, and improving the muscle quality of shrimp.
Owner:NINGBO UNIV

South american white shrimp heat shock protein 60a gene molecular marker and application thereof

The application discloses a kind of Penaeus vannamei heat shock protein 60A gene molecular markers, it includes molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G and molecular marker H on the sequence of Penaeus vannamei heat shock protein 60 gene;The molecular marker described in the application is significantly related to the cold tolerance of Penaeus vannamei, and can be used as a functional marker for the cold tolerance of Penaeus vannamei;The genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F, the molecular marker G and the molecular marker H are determined by extracting the genomic DNA of the muscle tissue of the Penaeus vannamei to be tested, performing PCR amplification and sequencing the obtained product, and then selecting individuals with dominant genotypes for Penaeus vannamei breeding, so as to accurately and efficiently breed Penaeus vannamei with cold tolerance and stress resistance, and provide a feasible scheme for breeding cold-tolerant varieties of Penaeus vannamei.
Owner:GUANGXI ACADEMY OF FISHERY SCI

Brevibacillus parvus GBW-M0 and application thereof in aquaculture

The application provides a Brevibacillus parabrevis GBW-M0 and application thereof in aquaculture. The Brevibacillus parabrevis GBW-M0 is classified as Brevibacillus parabrevis Brevibacillus laterosporus , and the preservation number is CGMCC No. 32335. The Brevibacillus parabrevis GBW-M0 is prepared through seed liquid preparation and submerged fermentation to obtain Brevibacillus parabrevis GBW-M0 fermentation liquor. The Brevibacillus parabrevis GBW-M0 fermentation liquor can reduce the concentration of hepatointestinal ciliates carried in the Penaeus vannamei, and is used for preventing and controlling microsporidian diseases of aquaculture animals. Meanwhile, the Brevibacillus parabrevis GBW-M0 fermentation liquor can inhibit the growth of Microcystis aeruginosa, and is used for treating blue-green algae blooms in aquaculture water bodies, thereby improving the success rate of aquaculture.
Owner:QINGDAO SHANGDE BIOTECH +1

Biological preparation for preventing and treating enteritis diseases of penaeus vannamei boone as well as preparation method and

PendingCN121592558AAntibacterial agentsBacteriaBiotechnologyMelicertus
The invention belongs to the technical field of biological agents, and discloses a biological agent for preventing and treating enteritis diseases of penaeus vannamei as well as a preparation method and application of the biological agent, the biological agent comprises lactobacillus rhamnosus BY13207, and the total viable count of the biological agent is 1.5 * 10 < 9 >-3 * 10 < 9 > cfu / mL; the lactobacillus rhamnosus BY13207 is preserved in the China General Microbiological Culture Collection Center on August 11, 2025, and the preservation number of the lactobacillus rhamnosus BY13207 is CGMCC No.35559. The lactobacillus rhamnosus BY13207 added in the lactobacillus rhamnosus BY13207 has very strong antagonistic action and anti-inflammatory action, can inhibit the growth and reproduction of various pathogenic microorganisms of prawns and enhance the disease resistance of the prawns; the compound has broad-spectrum antibacterial activity, and can effectively eliminate harmful bacteria in prawn culture water and reduce the risk of disease occurrence.
Owner:SHANDONG BEIYOU BIOTECHNOLOGY CO LTD

A low-sensitization penaeus vannamei, and a preparation method and application thereof

The application provides a kind of low sensitization of penaeus vannamei and its preparation method and application, belong to food biotechnology field.The application uses fucoidan to treat penaeus vannamei by covalent modification, after treatment, protein spatial conformation has changed significantly, allergen epitope is hidden.After BALB / c mouse sensitization model and RBL-2H3 cell degranulation model test shows, the sensitization of covalent modification penaeus vannamei decreases by 72.88%, low sensitization penaeus vannamei can inhibit mast cell degranulation and increase the threshold of sensitization, but still has immunogenicity.Through the construction of BALB / c mouse oral tolerance model, it is found that low sensitization penaeus vannamei can significantly alleviate the multiple immunoglobulin-mediated hypersensitivity caused by mouse allergy, which proves that low sensitization penaeus vannamei has auxiliary effect on oral tolerance, can promote oral tolerance ability, can be used as an effective immune tolerance agent for shrimp allergy patients.
Owner:DALIAN POLYTECHNIC UNIVERSITY

A method for improving the mating rate of penaeus vannamei

A method for improving the mating rate of Penaeus vannamei, comprising the following steps: step one, cultivating diatoms in a parent culture pond: scraping the naturally propagated benthic diatoms from the inner wall of the water inlet pipeline in the breeding field or near the middle tide line of the beach to obtain the benthic diatom liquid; culturing the benthic diatoms in still water: continuously adding filtered seawater to culture the benthic diatoms by flowing water; and culturing in a pond: moving female and male parent shrimps into the parent culture pond in which the benthic diatoms are cultivated until the female shrimps mature; step two, moving the female shrimps into the male shrimp culture pond for mating: selecting the female shrimps with mature gonads and moving them into the male shrimp culture pond for mating; step three, moving the female shrimps that have successfully mated into an egg laying pond for laying eggs, and taking out the female shrimps after laying eggs and returning them to the original culture pond. The method stabilizes the water quality by managing the benthic diatoms in the culture pond, provides a stable mating environment, and improves the mating rate; the operation is simple, the parent shrimps are less damaged, the cost is lower, the success rate is high, and the mating rate is as high as 90%.
Owner:GUANGDONG OCEAN UNIVERSITY

Bacillus tequilensis G4 and application thereof

The invention discloses bacillus tequilensis G4 and application thereof, the bacillus tequilensis G4 is a strain G4 which is screened from intestinal contents of penaeus vannamei and has a bacteriostatic effect on four pathogenic bacteria, and the strain G4 is identified as the bacillus tequilensis through 16S rDNA (ribosomal deoxyribonucleic acid) sequences. And then separating and purifying the antibacterial substance, and exploring the inhibition mechanism of the coarsely extracted antibacterial substance on four pathogenic bacteria. According to the invention, the bacillus tequilensis G4 crude extract bacteriostat is also applied to pork preservation.
Owner:JIANGSU OCEAN UNIV

Compound feed for juvenile penaeus vannamei as well as preparation process and equipment of compound feed

The invention provides a compound feed for juvenile penaeus vannamei as well as a preparation process and equipment of the compound feed. The compound feed comprises fish meal, euphausia superba powder, soybean meal, cottonseed protein, flour, soybean phospholipid oil, bile acid, carnitine, a vitamin premix, vitamin C phosphate, xanthophyll, methionine, choline chloride, monocalcium phosphate and a mineral premix. The compound feed is designed according to the physiological needs of juvenile penaeus vannamei in the liver conversion stage, and the health condition of hepatopancreas of the juvenile penaeus vannamei can be effectively improved by adding multivitamins, bile acid and carnitine, so that the juvenile penaeus vannamei is assisted to smoothly pass the liver conversion stage. Meanwhile, the feed intake can be remarkably increased, sufficient nutrition guarantee is provided for growth of the juvenile shrimps, and therefore the growth speed of the juvenile shrimps is increased. Besides, the preparation process comprises the steps of mixing for multiple times, crushing, conditioning, granulating, curing, cooling, sieving and the like, and special equipment is adopted for collaborative operation, so that the stable quality of the feed is guaranteed, and powerful support is provided for efficient culture of the penaeus vannamei boone.
Owner:SHENZHEN AOHUA GRP CO LTD

Pond for white shrimp (penaeus vannamei) broodstock

The present application relates to a kind of penaeus vannamei ovipositor breeding ponds, including several ovipositor breeding pond bodies, the upper portion in ovipositor breeding pond body is equipped with for the reproduction of seed shrimp spawning space, the lower portion of spawning space is equipped with for the hatching of shrimp eggs ovipositor space, the bottom of ovipositor space is equipped with one side with pool wall form the ovipositor bottom plate of positionable hinged, ovipositor bottom plate includes upper portion of egg-blocking net layer, middle portion of aeration layer, lower portion of water-permeable net layer, aeration layer is equipped with multiple aeration pipes, aeration pipe is communicated with external air source, aeration pipe is distributed with aeration hole, the lower portion of ovipositor space is equipped with for the cultivation of fry breeding space, the bottom of breeding space is equipped with fry outlet on one side.The present application uses the way of pond bottom aeration to replace the existing artificial ovipositor and mechanism ovipositor mode, integrates the hatching and fry function of prawn on the ovipositor breeding pond body, with better ovipositor effect, breeding yield is improved, breeding cost is reduced, and ovipositor breeding efficiency is significantly improved, etc.
Owner:ZHEJIANG MARICULTURE RES INST

Molecular markers of programmed cell death in penaeus vannamei and applications thereof

This invention discloses a molecular marker for programmed cell death protein in Litopenaeus vannamei and its application. The molecular marker includes molecular marker A, molecular marker B, molecular marker C, and molecular marker D located on the 6-like gene sequence of the programmed cell death protein in Litopenaeus vannamei. This invention utilizes these molecular markers as functional markers for Litopenaeus vannamei's resistance to Vibrio parahaemolyticus, thereby improving the disease resistance breeding of Litopenaeus vannamei. Specifically, genomic DNA is extracted from the muscle tissue of the Litopenaeus vannamei to be tested, and then used as template DNA for PCR amplification and purification of the PCR amplification products. The obtained products are then sequenced to determine the genotypes of molecular markers A, B, C, and D, thereby selecting individuals with superior genotypes for Litopenaeus vannamei breeding, promoting the research and application of disease-resistant aquaculture of Litopenaeus vannamei.
Owner:GUANGXI ACADEMY OF FISHERY SCI

A method for culturing pacific white shrimp (penaeus vannamei) and giant gourami (osphronemus goramy) in a cage

ActiveCN116602250BPisciculture and aquariaMelicertusNutrition
The application relates to the field of aquaculture, in particular to a culture method of longsnout catfish (Leiocassis longirostris) in the culture of penaeus vannamei, which comprises the following steps: pond preparation, fry stocking, feed feeding, water quality management, daily management, fishing and harvesting, etc. The application establishes a multi-nutrient level culture mode of fish and shrimp symbiosis, fully utilizes the water space of the culture pond of penaeus vannamei, improves the water utilization rate of the pond, improves the production efficiency, utilizes the habits of longsnout catfish and penaeus vannamei, plays the effect of fish and shrimp ecological comprehensive disease prevention, improves the growth environment of fish, improves the feed utilization rate, reduces the total feed coefficient, reduces the wastewater discharge, and improves the energy efficiency of aquaculture. The application is simple in operation and easy to popularize.
Owner:SHANGHAI FISHERIES RES INST

Bacillus altitudinis strain JYD51 and application thereof in aquaculture

The application discloses a Bacillus altitudinis JYD51 and application thereof in aquaculture, which has been preserved in the China General Microbiological Culture Collection Center on October 10, 2024, and the preservation number is CGMCC No.32164. The JYD51 strain can be fermented by using a culture medium rich in organic matter, and the fermentation product has no toxic effect on Penaeus vannamei and crabs, can inhibit the infection of hepatopancreas ciliates on the Penaeus vannamei and the harm of Paramoeba on the crabs. Meanwhile, the microbial agent prepared by the JYD51 strain and Bacillus sphaericus JYQ7 can effectively control the harm of the hepatopancreas ciliates on the Penaeus vannamei and the Paramoeba on the crabs, purify the water environment for the growth of the Penaeus vannamei and the crabs, and improve the survival rate and product quality of the Penaeus vannamei and the crabs in aquaculture.
Owner:HUAIAN XIANGLAN GOLD LAND BIOTECHNOLOGY CO LTD

Intelligent detection method for feeding behavior of penaeus vannamei boone in recirculating aquaculture system and model building method

The invention provides an intelligent detection method for feeding behaviors of penaeus vannamei in a recirculating aquaculture system and a model building method, and belongs to the technical field of aquaculture monitoring. Comprising the following steps: acquiring an image data set of ingestion of penaeus vannamei in different appetite states shot in a field environment, and dividing the image data set into a training set and a test set; performing frame extraction on the video data in batches, and extracting an optical flow graph after preprocessing; the method comprises the following steps of: constructing a double-flow neural network OptiPulse-ShrimpNet capable of capturing the feeding behavior of the prawns; and training and testing the model. The model established by the invention can automatically adjust the space-time perception field according to the dynamic characteristics of the prawn ingestion movement, accurately capture weak biological movement signals in the overwater high-angle shooting view angle, automatically track the long-time behavior track of more than 30 minutes, and solve the behavior intensity characteristic parameters of the ingestion key stage.
Owner:OCEAN UNIV OF CHINA +1

Molecular marker of BBOX1 gene related to anti-vibrio disease trait of penaeus vannamei and application thereof

The application discloses a BBOX1 gene molecular marker related to the Vibrio resistance trait of Penaeus vannamei, which comprises any one or more of a molecular marker A, a molecular marker B and a molecular marker C, and the molecular markers are located on a gamma-butyrobetaine dioxygenase gene sequence of the Penaeus vannamei; the molecular marker is used as a functional marker of the Vibrio resistance trait of the Penaeus vannamei, the genomic DNA of muscle tissue of the Penaeus vannamei to be detected is extracted, and then the genomic DNA is used as template DNA to perform PCR amplification and purification of a PCR amplification product, and then the product is sequenced to determine the genotypes of the molecular marker A, the molecular marker B and the molecular marker C, so that the genotypic individuals with the Vibrio resistance advantage are screened to breed the Penaeus vannamei, the obtained result is accurate and has high application value, the breeding process of the fine variety with the Vibrio resistance trait can be accelerated, and the survival rate of the shrimp culture is improved, which has important significance.
Owner:GUANGXI ACADEMY OF FISHERY SCI

Molecular markers of the secretory complex 1 gene in Penaeus vannamei and its application

The present invention discloses a molecular marker of the secretory complex 1 gene of whiteleg shrimp, which includes any one or more of molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K and molecular marker L; the present invention uses the molecular marker as a functional marker of the whiteleg shrimp's resistance to Vibrio parahaemolyticus, thereby improving the disease resistance breeding of whiteleg shrimp. Specifically, the genomic DNA of the muscle tissue of the whiteleg shrimp to be tested is extracted, and then used as a template DNA for PCR amplification and purification of the PCR amplification product, and then the obtained product is sequenced to determine the genotype of the molecular marker, thereby selecting individuals with an advantageous genotype for whiteleg shrimp breeding. The SNPs disclosed in this patent can obtain an accurate Vibrio resistance pedigree, providing a feasible solution for the selection and breeding of whiteleg shrimp resistant to Vibrio.
Owner:GUANGXI ACADEMY OF FISHERY SCI

Penaeus vannamei pond water quality comprehensive evaluation method based on deep learning

The invention discloses a comprehensive evaluation method for water quality of a penaeus vannamei pond based on deep learning. The method comprises the following steps: firstly, acquiring multi-dimensional water quality monitoring data of a penaeus vannamei aquaculture pond; carrying out preprocessing operation on the obtained original data; then, stationary wavelet transform is executed on the processed water quality time sequence data, multi-scale characteristic decomposition and denoising are achieved, and low-frequency trend characteristics and high-frequency disturbance characteristics of water quality signals are extracted; and finally, inputting the features subjected to wavelet decomposition into a pre-trained deep learning model, extracting spatial features through a convolutional neural network, modeling a time dependency relationship through a long-term and short-term memory network, and obtaining five types of water quality grade evaluation results through a Softmax output layer. Based on the method, automatic, refined and real-time comprehensive evaluation of the water quality of the aquaculture pond can be achieved, the accuracy and stability of water quality evaluation are improved, and effective technical support is provided for intelligent monitoring and health management of the aquaculture environment of the penaeus vannamei boone.
Owner:TIANJIN AGRICULTURE COLLEGE

Preparation method of clostridium butyricum fermentation metabolite and application of clostridium butyricum fermentation metabolite in aquatic animal breeding

The invention belongs to the technical field of aquaculture feed additives, and particularly relates to a preparation method of a clostridium butyricum fermentation metabolite and application of the clostridium butyricum fermentation metabolite in aquatic animal breeding. According to the clostridium butyricum fermentation medium disclosed by the invention, the fermentation medium is improved, and components such as methyl-beta-cyclodextrin, betaine and algal polysaccharides are added into the clostridium butyricum fermentation medium, so that accumulation of fermentation metabolites of the clostridium butyricum is facilitated, the fermentation effect of the clostridium butyricum is remarkably improved, and moreover, the fermentation effect of the clostridium butyricum is improved. The obtained clostridium butyricum fermentation metabolite is compounded with clostridium butyricum to prepare a feed additive, after the feed additive is used for culturing penaeus vannamei boone, the weight gain of the penaeus vannamei boone is obvious, the weight gain of the penaeus vannamei boone is increased from 7.3 g / head to 15.8 g / head, and meanwhile, the survival rate of the penaeus vannamei boone reaches up to 95%.
Owner:SHANDONG TIANRUNHE BIO-ENG CO LTD

SNP marker related to growth rate of penaeus vannamei and application thereof

The application discloses a SNP marker related to growth speed of Penaeus vannamei and application thereof, a nucleotide sequence of the SNP marker is shown in SEQ ID NO:1, and polymorphism of the SNP marker is reflected at the 501th position of the SEQ ID NO.1 sequence, and the polymorphism site is G or T. The SNP marker related to growth speed of Penaeus vannamei and application thereof can be used for early selection of breeding materials of Penaeus vannamei according to actual breeding requirements, further can effectively improve breeding efficiency and accuracy, improve the genetic level of a Penaeus vannamei breeding population, and thus can accurately and efficiently breed a fine variety of Penaeus vannamei.
Owner:SHENZHEN HUAHAI SEED IND CO LTD +1

Molecular marker related to cold tolerance of penaeus vannamei and application thereof

This invention discloses a molecular marker associated with the cold resistance trait of Litopenaeus vannamei and its application. The molecular marker includes molecular marker A, molecular marker B, and molecular marker C. Molecular marker A is located on the sequence described in Sequence 1 of the sequence listing, and molecular markers B and C are located on the sequences described in Sequence 2 of the sequence listing. The molecular markers are significantly correlated with the cold resistance trait of Litopenaeus vannamei and can serve as functional markers for the cold resistance ability of Litopenaeus vannamei, thereby improving the efficiency of cold-resistant breeding of Litopenaeus vannamei. The method involves extracting genomic DNA from the muscle tissue of the Litopenaeus vannamei to be tested and using it as template DNA for PCR amplification and purification of the amplification products. Then, the obtained products are sequenced to determine the genotypes of molecular markers A, B, and C. Individuals with dominant genotypes are selected for Litopenaeus vannamei breeding, thereby accurately and efficiently breeding Litopenaeus vannamei varieties with strong cold resistance and stress tolerance.
Owner:GUANGXI ACADEMY OF FISHERY SCI

Penaeus vannamei ammonia nitrogen stress response miRNA and application thereof

The invention relates to a penaeus vannamei ammonia nitrogen stress response miRNA (micro Ribonucleic Acid) and application thereof, and the sequence of the miRNA is as shown in SEQ ID NO. 1, namely 5 '-TAATACTGTCAGGTAAAGATGT-3'. Comprising the following steps: obtaining a penaeus vannamei boone sample; the method comprises the following steps: extracting total RNA (Ribonucleic Acid) from a penaeus vannamei boone sample, and then inversely transcribing the RNA into cDNA (Complementary Deoxyribonucleic Acid Carrying out real-time fluorescent quantitative PCR (Polymerase Chain Reaction) reaction by using the upstream primer and the downstream primer by taking the cDNA as a template to obtain the expression quantity of miRNA (Micro Ribonucleic Acid); if the expression quantity of the miRNA is obviously different from that of the penaeus vannamei which is not stressed by the ammonia nitrogen, the penaeus vannamei can be judged to be stressed by the ammonia nitrogen; the sequence of the stem-loop primer is as shown in SEQ ID NO.2; the sequence of the stem-loop primer is as shown in SEQ ID NO.2; the stem-loop primer is GTCGTATCCAGTGGTCCGAGGTATTCGCATGGATACGACGACATC; the sequence of the stem-loop primer is as shown in SEQ ID NO.2; the sequence of the upstream primer is as shown in SEQ ID NO.3: CGCGCGTAATACTGTCAGGTAAA (SEQ ID NO.3), and the sequence of the downstream primer is as shown in SEQ ID NO.4); and the sequence of the downstream primer is as shown in SEQ ID NO.4: AGTGCAGGGTCCGAGGTATT (SEQ ID NO.4). The invention further discloses a kit for detecting the content of the CAGGGTATT.
Owner:GUANGDONG OCEAN UNIVERSITY