SNP molecular marker related to cold resistance character of DDO gene of penaeus vannamei boone and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to the cold resistance character of a penaeus vannamei DDO gene and application of the SNP molecular marker, and belongs to the technical field of penaeus vannamei breeding, the nucleotide sequence of the SNP molecular marker is shown as a sequence 1 in a sequence table, and the SNP molecular marker is remarkably related to the cold resistance character of the penaeus vannamei. The method comprises the following steps: extracting genome DNA of muscular tissues of penaeus vannamei boone to be detected, carrying out PCR amplification by taking the genome DNA as template DNA, purifying a PCR amplification product, sequencing the obtained product, and screening the penaeus vannamei boone variety with cold resistance according to genotypes of different sites on the SNP molecular marker. The marker is high in accuracy and good in stability, is suitable for molecular marker assisted breeding, can be used for rapidly and accurately screening litopenaeus vannamei individuals with cold-resistant characters in an early stage, and remarkably improves the breeding efficiency and accuracy of new cold-resistant varieties, so that the breeding success rate and economic benefits are improved.

Description

Technical Field

[0001] This invention belongs to the field of breeding technology for Litopenaeus vannamei, specifically relating to a SNP molecular marker related to the cold resistance trait of the DDO gene in Litopenaeus vannamei and its application. Background Technology

[0002] South American white shrimp ( Litopenaeus vannamei Litopenaeus vannamei, also known as the whiteleg shrimp, is one of the most economically valuable aquaculture species in my country. Native to tropical and subtropical seas, this species has a weak ability to adapt to low-temperature environments. When the water temperature is below its physiological tolerance limit, it is prone to problems such as slowed growth, weakened immune function, and metabolic abnormalities, which can even lead to mass mortality and cause serious losses to the aquaculture industry.

[0003] D-aspartate oxidase (DDO) is an important redox enzyme in organisms, catalyzing the oxidative deamination of D-amino acids such as D-aspartate. This process is closely related to various physiological processes, including energy metabolism, nervous system function, and oxidative stress response. Under low-temperature stress, the energy metabolism pathways and redox states of aquatic animals undergo significant changes, requiring the activation of relevant genes to cope with the changes in metabolic rate and increased reactive oxygen species caused by low temperature. Therefore, it is speculated that the DDO gene may play an important role in the response of Litopenaeus vannamei to low-temperature stress by regulating key metabolic pathways and intracellular redox states. However, there are currently no systematic studies, either domestically or internationally, on the association between DDO gene polymorphism and cold tolerance traits in Litopenaeus vannamei.

[0004] With the development of molecular biology and genomics, single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have become an effective tool for quantitative trait locus mapping and molecular breeding due to their advantages such as high coverage density in the genome, good stability, and suitability for automated detection. Identifying SNP sites closely associated with important economic traits (such as growth, disease resistance, and stress resistance) enables early and rapid screening of breeding materials, significantly improving the accuracy and efficiency of breeding. However, there are currently no reports of SNP markers related to D-aspartate oxidase in cold-resistant Litopenaeus vannamei. Summary of the Invention

[0005] To address the aforementioned shortcomings, this invention discloses a cold-resistance-related SNP molecular marker for the DDO gene of Litopenaeus vannamei and its application. Based on screening the DDO gene of Litopenaeus vannamei, SNP molecular markers related to cold-resistance are obtained. These molecular markers are then used as functional markers for the cold-resistance trait of Litopenaeus vannamei for the breeding of new cold-resistance varieties of Litopenaeus vannamei.

[0006] This invention is achieved using the following technical solution: A molecular marker for cold tolerance associated with the DDO gene in Litopenaeus vannamei is disclosed. The nucleotide sequences of the SNP markers are shown in Sequence 1 of the sequence listing. Specifically, the 66bp site is designated D.4243 G>A, where the base is either G or A, and the mutation type is G / G homozygous or A / G heterozygous; the 68bp site is designated D.4245 C>T, where the base is either C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous; the 99bp site is designated D.4274 T>A, where the base is either T or A, and the mutation type is T / T homozygous, A / T heterozygous, or A / A homozygous; and the 100bp site is designated D.4275... T>C, the base at this site is T or C, and the mutation type is T / T homozygous, C / T heterozygous, or C / C homozygous; the 108bp site is denoted as D.4283 G>C, the base at this site is G or C, and the mutation type is G / G homozygous, C / G heterozygous, or C / C homozygous.

[0007] The application of the cold-resistance-related SNP molecular markers of the DDO gene in Litopenaeus vannamei involves using these SNP molecular markers for selective breeding of Litopenaeus vannamei to screen for varieties with cold-resistance traits. Specifically, this is achieved by extracting genomic DNA from the muscle tissue of the Litopenaeus vannamei to be tested, using it as template DNA for PCR amplification and purification of the PCR amplification products, and then sequencing the obtained products to determine the genotypes at the 66bp, 68bp, 99bp, 100bp, and 108bp sites of the SNP molecular markers. When the genotype at the 66bp locus is AG, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 68bp locus is TT or CT, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 99bp locus is AA or AT, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 100bp locus is CC or CT, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 108bp locus is CC or CG, select this individual as a backup parent for breeding Litopenaeus vannamei.

[0008] Furthermore, during the PCR amplification process, the primer combination used to detect the SNP molecular markers related to the cold resistance trait of the DDO gene in Litopenaeus vannamei includes the following primers: Primer F: GTATCAACCCCCTCAGACACGCGAA (as shown in sequence 2 in the sequence listing); Primer R: TCGCCCTCGAACTTGTCGGCGAACA (as shown in sequence 3 in the sequence listing).

[0009] Meanwhile, the PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer F at a concentration of 10 μmol / L, 2 μL of primer R at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0010] The PCR amplification reaction procedure can be performed according to the following steps: S1. Pre-denaturate at 94℃ for 3 min; S2. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s. S3. Extend at 72℃ for 10 minutes.

[0011] Compared with existing technologies, this technical solution has the following advantages: This invention provides a cold-resistance-related SNP molecular marker for the DDO gene of Litopenaeus vannamei and its application. The marker has high accuracy and good stability, and is suitable for marker-assisted breeding. It can be used for early, rapid, and accurate screening of Litopenaeus vannamei individuals with cold-resistance traits, significantly improving the breeding efficiency and accuracy of cold-resistance varieties. This lays a reliable foundation for the continuous improvement and large-scale farming of cold-resistance varieties, and helps to promote the research process of cold-resistance and stress-resistant farming of Litopenaeus vannamei, thereby improving farming efficiency and economic benefits. Attached Figure Description

[0012] Figure 1 This is a partial sequence (positions 63-69) of the product obtained from amplifying the DDO gene in Example 1, showing the AG and GG peaks at the D.4243 G>A site.

[0013] Figure 2 This is a partial sequence (positions 65-71) of the product obtained from amplifying the DDO gene in Example 1, showing the CC, CT, and TT peaks at the D.4245 C>T site.

[0014] Figure 3 This is a partial sequence of the product obtained from amplifying the DDO gene in Example 1 (positions 96-103), showing the peak values ​​of TT, AT, and AA at the D.4274 T>A site; and the peak values ​​of TT, CT, and CC at the D.4275 T>C site.

[0015] Figure 4This is a partial sequence (positions 105-111) of the product obtained from amplifying the DDO gene in Example 1, showing the peak values ​​of GG, CG, and CC at the D.4283 G>C site. Detailed Implementation

[0016] The present invention is further illustrated by the following examples, but these are not intended to limit the invention. Specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.

[0017] Example 1: The screening process for SNP molecular markers related to the cold resistance trait of the DDO gene in Litopenaeus vannamei described in this invention is as follows: (1) 120 whiteleg shrimp weighing about 3 grams were selected and temporarily kept for 2 days. Then, a cold resistance experiment was conducted under the stress conditions of 9.5-10.5℃. The first 40 shrimp that died were designated as the low temperature sensitive group, and the last 40 shrimp that survived were designated as the low temperature tolerant group.

[0018] (2) Five white shrimp were randomly selected from the low temperature sensitive group and the low temperature tolerant group, muscle tissue was extracted and genomic DNA was extracted using the conventional phenol-form extraction method. The obtained genomic DNA was stored at -20 °C for later use. The appendage muscle tissue of white shrimp can be used for DNA extraction and genotype detection, which has minimal impact on the health of shrimp.

[0019] (3) Primer combinations were designed based on the DDO gene sequence of Litopenaeus vannamei, and then the SNP sites located in the DDO gene were amplified and screened. The primer combination included primer F with the sequence GTATCAACCCCCTCAGACACGCGAA and primer R with the sequence TCGCCCTCGAACTTGTCGGCGAACA. The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer F at a concentration of 10 μmol / L, 2 μL of primer R at a concentration of 10 μmol / L, and 20 μL of ddH2O. The PCR amplification reaction procedure includes the following steps: S1. Pre-denaturate at 94℃ for 3 min; S2. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s. S3. Extend at 72℃ for 10 minutes.

[0020] (4) The PCR amplification products were purified and sequenced after detection by 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak diagram analysis, to screen for relevant SNP sites. The PCR amplification product sequence of one sample is shown below: GTATCAACCCCCTCAGACACGCGAAGGCCGCCCAGTCGCTCCGCCACCACCAACCCCAACCGCAGGCTCTCCCCACGAAGGCCACCCCTCGGTCTCCTTCCTCCGCGATGCCGTCGGCGTGCGTGGTGGGCGCGGGCGTGGTGGGGCTCACGACGGCCACGCTGCTGCAGGAGGCGCGGCCGGACGTCAAGGTCACGCTGTTCGCCGACAAGTTCGAGGGCGA; The 66th bp site is designated as D.4243 G>A, the 68th bp site as D.4245 C>T, the 99th bp site as D.4274 T>A, the 100th bp site as D.4275 T>C, and the 108th bp site as D.4283 G>C. (5) Based on the selected SNP sites, the Litopenaeus vannamei in the sensitive group and the tolerant group were detected and genotyped according to the above method. The samples of different SNP sites in the sensitive group and the tolerant group were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The specific results are shown in Table 1.

[0021] Analysis of Table 1 shows that the genotypic polymorphism at the marked loci has a significant impact on the cold tolerance trait of Litopenaeus vannamei, as detailed below: Individuals with the AG genotype at the 66bp locus are inferior in cold resistance and should be avoided as backup parents for breeding Litopenaeus vannamei varieties. Individuals with the TT or CT genotype at the 68bp locus are individuals with a dominant cold resistance trait and can be selected as reserve parents for breeding of Litopenaeus vannamei varieties. Individuals with the AA or AT genotype at the 99bp locus are individuals with a dominant cold resistance trait and can be selected as backup parents for breeding of Litopenaeus vannamei varieties. Individuals with the CC or CT genotype at the 100bp locus are individuals with a dominant cold resistance trait and can be selected as reserve parents for breeding of Litopenaeus vannamei varieties. Individuals with the CC or CG genotype at the 108bp locus are individuals with a dominant cold-resistant trait and can be selected as backup parents for breeding Litopenaeus vannamei varieties.

[0022] Table 1. Genotype and allele frequency distribution at different loci in the target fragment of the DDO gene.

[0023] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A molecular marker for cold tolerance associated with the DDO gene in Litopenaeus vannamei, characterized in that: The nucleotide sequences of the SNP molecular markers are shown in Sequence 1 of the sequence listing. The 66bp site is denoted as D.4243 G>A, where the base is G or A, and the mutation type is G / G homozygous or A / G heterozygous. The 68bp site is denoted as D.4245 C>T, where the base is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous. The 99bp site is denoted as D.4274 T>A, where the base is T or A, and the mutation type is T / T homozygous, A / T heterozygous, or A / A homozygous. The 100bp site is denoted as D.4275 T>C, where the base is T or C, and the mutation type is T / T homozygous, C / T heterozygous, or C / C homozygous. The 108bp site is denoted as D.4283. If G>C, the base at this site is either G or C, and the mutation type is G / G homozygous, C / G heterozygous, or C / C homozygous.

2. The application of the SNP molecular marker related to the cold resistance trait of the DDO gene in Litopenaeus vannamei as described in claim 1, characterized in that: The SNP molecular markers were used for selective breeding of Litopenaeus vannamei to screen for Litopenaeus vannamei varieties with cold-resistant traits. Specifically, genomic DNA was extracted from the muscle tissue of the Litopenaeus vannamei to be tested, and then used as template DNA for PCR amplification and purification of the PCR amplification products. The obtained products were then sequenced to determine the genotypes at the 66bp, 68bp, 99bp, 100bp, and 108bp sites of the SNP molecular markers. When the genotype at the 66bp locus is AG, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 68bp locus is TT or CT, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 99bp locus is AA or AT, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 100bp locus is CC or CT, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype at the 108bp locus is CC or CG, select this individual as a backup parent for breeding Litopenaeus vannamei.

3. The application according to claim 2, characterized in that: During the PCR amplification process, the primer combination used to detect SNP molecular markers related to the cold resistance trait of the DDO gene in Litopenaeus vannamei includes the following primers: Primer F: GTATCAACCCCCTCAGACACGCGAA; Primer R: TCGCCCTCGAACTTGTCGGCGAACA.

Images