12 results about "Turbot" patented technology

The present invention discloses a method for identifying the phenotype of turbot with low-salt tolerance, belonging to the field of selective breeding of economic traits of aquatic animals. The method is as follows: Prepare a culture pond, inject fresh water, and adjust the water temperature, dissolved oxygen to be consistent with the environment where the test population is located. After the test turbot population has fasted for 72 hours, place it in the fresh water pond for cultivation, and record the initial time. Check the color change of the pigmented side of the fish body every hour. After black stripes appear, record the appearance time of the black stripes. Immediately return the experimental fish to the normal salinity environment after the recording is completed, and the body color of the fish will recover. The determination of the phenotype of turbot with high-efficiency low-salt tolerance is realized according to the formula. The individual low-salt tolerance breeding phenotype values are arranged from large to small, and the individuals with the top rankings are selected. The phenotype identification method provided by the present invention can achieve more efficient and accurate results, and cause no damage to the tested individuals, laying a foundation for subsequent genetic evaluation and selective breeding of this trait.

The application provides a turbot compound immune enhancer, a preparation method and application thereof. The application discloses application of a composition containing a series of components in preparation of a turbot immune enhancer, and the immune enhancer can effectively improve expression of a proinflammatory related gene of the turbot, reduce a number of bacteria in a liver or an intestinal tract, enhance a bactericidal capacity of the turbot, enhance an antioxidant stress capacity of the turbot, relieve liver damage of the turbot after being infected by bacteria, and relieve tissue damage of the turbot after being infected by bacteria. The immune enhancer component is simple, environment-friendly, low in cost and ideal in effect, and provides a new scheme for improving a breeding level of marine fish and improving a survival rate.

The invention discloses a compound flavor enhancer for improving meat quality of turbots and application of the compound flavor enhancer. The compound flavor enhancer comprises glutamic acid, aspartic acid, succinic acid, inosinic acid and guanylic acid. The compound flavor enhancer is applied to cultivation of turbots, namely, the compound flavor enhancer is used as an additive component of feed, and traditional chilled fish cultivation is replaced by compound feed cultivation added with the compound flavor enhancer. The formula of the feed is scientific in design, nutritional requirements of the turbots can be accurately met, the breeding cost is effectively reduced, and the addition of the compound flavor enhancer can significantly improve the adverse effect on the meat quality of the turbots caused by replacing chilled fresh fish with the compound feed on the premise of not influencing the growth performance; therefore, the meat quality and flavor of the scophthalmus maximus cultured by the compound feed are close to or even reach the level of iced fresh fish culture.

The invention discloses a fish feed formula screening method based on multiple factors, which optimizes the multi-factor experimental design, reduces the experimental group and simplifies the operation process on the basis of the breeding environment, the physiological indexes of fish bodies and the characteristics of feed raw materials. Meanwhile, a mathematical model can be simulated and constructed, the change conditions of various combinations of different factors can be predicted, and the optimal combination of the change factors can be given; the breeding environment, the fish body physiological indexes and the feed raw materials are precisely combined, the fish feed formula level and quality are improved, and the formula cost and the feed cost are saved; and the application effect of the new raw material (new additive) in the formula can be quickly, simply and effectively evaluated. The invention also provides a fish feed formula for scophthalmus maximus culture, which is obtained by screening based on the method, and a fish antibacterial peptide with high thermal stability and bactericidal activity. The method has the advantages of simplicity, effectiveness, rapidness and the like.

The present invention discloses the use of conophora japonica in the preparation of products for preventing and / or treating shield ciliate disease in marine fish. The conophora japonica may be a conophora japonica preparation. The preparation comprises an active ingredient, and the active ingredient is conophora japonica, an alcohol extract of conophora japonica, or an aqueous extract of conophora japonica. The present invention confirms through in vitro insecticide tests and animal infection tests that the addition of conophora japonica can kill shield ciliates, and can significantly reduce the infection rate and mortality rate of shield ciliates in turbot, thus having a good effect in preventing and treating shield ciliate disease. Conophora japonica has the advantages of low toxicity to turbot and environmental protection, and can reduce the pollution to the environment caused by formaldehyde, copper sulfate, etc. emitted during the turbot farming process for the treatment of shield ciliate disease.

The present application relates to the SNP molecular marker of the body length correlation under the fermented soybean meal feeding of Scophthalmus maximus and application thereof, and belongs to the technical field of molecular marker, the body length trait of the present application is analyzed by using whole genome correlation analysis on Scophthalmus maximus, the SNP molecular marker of the significant correlation under the fermented soybean meal feeding of Scophthalmus maximus and body length trait is obtained, including at least one of 6 SNP sites, can be applied to the molecular assisted breeding of Scophthalmus maximus, the screening can be carried out at the genome level through the breeding method disclosed in the present application, the breeding cycle can be greatly shortened, the dependence on phenotypic traits is reduced, the selection breeding efficiency is improved, and good application prospect is obtained.

The present application relates to the SNP molecular marker of the body weight correlation under the fermented soybean meal feeding of Scophthalmus maximus and application thereof, belongs to the molecular marker technical field, the present application utilizes the whole genome correlation analysis to carry out the analysis to the body weight character of Scophthalmus maximus, obtains the SNP molecular marker of the significant correlation under the fermented soybean meal feeding with the body weight character, including at least one of 6 SNP sites, can be applied to the molecular assisted breeding of Scophthalmus maximus, through the screening of the breeding method disclosed in the present application in the genomic level, can greatly shorten the breeding cycle, reduce the dependence on the phenotype character, improve the selection breeding efficiency, and have good application prospect.

The present invention discloses a microsatellite marker primer related to the feed conversion rate of turbot, belonging to the field of fish DNA marker technology and application. The primer sequences are the forward sequence GTACAAGTACACAACAGCAGT and the reverse sequence ACCATTGAAGACAGAAGTGT. Using the primer to perform PCR amplification on the DNA of turbot individuals, individuals capable of amplifying a specific fragment size of 238bp are screened. Individuals with this genotype have a higher feed conversion rate. Using the primer in the breeding of turbot varieties with high feed conversion rate, compared with the conventional breeding method, this method can shorten the breeding years and improve the breeding efficiency.

The invention discloses an application of intermediary tulipa bark in preparation of a product for preventing and / or treating marine fish pellioniasis. The intaglio pomace can be an intaglio pomace preparation. The preparation comprises an active component, and the active component is poliodendron simsii, poliodendron simsii alcohol extract or poliodendron simsii water extract. An in-vitro insecticidal test and an animal infection test confirm that the pellionia obtusifolia can kill pellionia obtusifolia, the pellionia obtusifolia infection rate and the death rate of turbot pellionia obtusifolia can be obviously reduced, and the pellionia obtusifolia has a good effect of preventing and treating pellionia obtusifolia diseases. The Chinese tulip bark has the advantages of small toxicity to the turbot and environmental protection, and can reduce the environmental pollution caused by formaldehyde, copper sulfate and the like which are discharged in the turbot breeding process and are used for treating the shield ciliate disease.

The invention relates to the technical field of bioengineering, and discloses a preparation method and a preparation device of a turbot edwardsiella tarda inactivated vaccine, the preparation device comprises a bottom plate, a storage assembly is fixedly mounted at the top of the bottom plate, a constant-temperature culture assembly is fixedly mounted at the top of the bottom plate, and a detection assembly is fixedly mounted at the top of the constant-temperature culture assembly. A uniform mixing assembly is fixedly mounted in the constant-temperature culture assembly. According to the preparation method and the preparation device of the Edwardsiella tarda inactivated vaccine for the scophthalmus maximus, when the bacterial count is 15.0-60.0 * 10 < 8 > CFU / mL, 0.05% (V / V) formaldehyde can be added for inactivation (generally, the addition amount is not less than 0.5%), and stimulation of formaldehyde to fish bodies in the later period is reduced; if the addition amount of the formaldehyde is 0.5%, the formaldehyde needs to be washed and centrifuged for multiple times by using sterile normal saline after being inactivated, and the workload and the possibility of pollution of other bacteria are easily increased in the process. And the overall immune challenge protection rate can be improved, and the immune effect is higher than that of a conventional antigen.

The invention belongs to the technical field of fish breeding, and particularly relates to a fish seminal plasma exosome, an extraction method and application in fish breeding. The extraction method of the fish seminal plasma exosome comprises the following steps: S1, centrifuging fish seminal fluid to obtain seminal plasma; s2, mixing the seminal plasma with PBS and BPS according to a certain volume ratio, and standing; s3, centrifuging the standing liquid to obtain a precipitate I; s4, centrifuging the precipitate I to obtain exosome precipitate; s5, adding seminal plasma into the exosome precipitate in proportion, mixing and resuspending to obtain a mixed solution I; s6, centrifuging the mixed solution I obtained in the step S5 to obtain supernate rich in exosome particles; and S7, placing the supernatant in an EPF column for centrifugation. The fish seminal plasma exosome can be used for in-vitro fertilization and artificial insemination pretreatment of fish sperms, especially in-vitro fertilization and artificial insemination pretreatment of turbot sperms, and can improve the fertilization success rate, the sperm activation efficiency and the sperm motility.

The invention relates to an SNP molecular marker related to the body length of scophthalmus maximus fed with fermented soybean meal and application of the SNP molecular marker, and belongs to the technical field of molecular markers, the body length character of the scophthalmus maximus is analyzed through genome-wide association analysis, the SNP molecular marker remarkably related to the body length character of the scophthalmus maximus fed with the fermented soybean meal is obtained, and the SNP molecular marker comprises at least one of six SNP loci; the scophthalmus maximus molecular marker can be applied to scophthalmus maximus molecular assisted breeding, screening is conducted on the genome level through the breeding method, the breeding period can be greatly shortened, dependence on phenotypic characters is reduced, the selective breeding efficiency is improved, and the scophthalmus maximus molecular marker has good application prospects.