Molecular marker and primer pair related to high ammonia nitrogen stress resistance of litopenaeus vannamei and application of molecular marker and primer pair

Through whole-genome association analysis and candidate SNP association analysis, SNP markers related to the high ammonia nitrogen tolerance of Penaeus vannamei were discovered. Primer pairs were designed for PCR amplification and sequencing, and the SNP site 828G>A was screened out. Individuals with the GA genotype were preferentially selected for breeding, which solved the problem of the existing technology that it is difficult to effectively improve the germplasm resources of Penaeus vannamei, and achieved efficient and accurate breeding results.

CN120666035APending Publication Date: 2025-09-19GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510755215.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve the germplasm resources of Penaeus vannamei and cultivate new varieties with strong tolerance to high ammonia nitrogen. Traditional breeding methods have problems such as long cycles, high costs and low efficiency.

Method used

Through genome-wide association analysis and candidate SNP association analysis, SNP markers related to the high ammonia nitrogen tolerance trait of vannamei were found. Primers were designed for PCR amplification and sequencing of γ-BBD-F and γ-BBD-R, and the SNP site 828G>A was screened out. Correlation analysis was performed using SPSS24.0 software, and individuals with the GA genotype were preferentially selected for breeding.

Benefits of technology

The system has achieved effective detection and selection of high ammonia nitrogen tolerance of Penaeus vannamei, improved breeding efficiency and accuracy, and enabled the selection of Penaeus vannamei varieties with strong stress resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120666035A_ABST
    Figure CN120666035A_ABST
Patent Text Reader

Abstract

According to the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei, an SNP molecular marker is cloned from a gamma-BBD gene, and the SNP marker is the 828th base G or A from the 5'terminal of a first nucleotide sequence shown in a sequence table. The primer pair of the molecular marker related to the high ammonia nitrogen resistance character of the litopenaeus vannamei comprises a primer gamma-BBD-F and a primer gamma-BBD-R, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.1 and SEQ ID NO.2: (1) SEQ ID NO.1: GCCAACAGGTCAACAG, (2) SEQ ID NO.3: GCAACAGGTCAAG, (3) SEQ ID NO.4: GCAACAGGTCAAG, and (4) SEQ ID NO.5: GCAACAGGTCAAG: And (2) TGAAGCCGTCGGCGAAGAAG as shown in SEQ ID NO. 2: According to the present invention, the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GA at the site of the SNP marker is significantly higher than the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype of GG, such that the high ammonia nitrogen tolerance of the litopenaeus vannamei can be effectively determined by detecting the SNP site of the litopenaeus vannamei; the SNP marker is closely related to the high ammonia nitrogen resistance character of the litopenaeus vannamei and can be effectively used for molecular marker-assisted breeding of the litopenaeus vannamei.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of aquatic animal genetics and molecular marker-assisted selection breeding, and in particular to a molecular marker related to the high ammonia nitrogen stress resistance of Litopenaeus vannamei, a detection primer and an application thereof. Background Art

[0002] The vannamei shrimp (Litopenaeus vannamei), native to the eastern Pacific Ocean and commonly known as the whiteleg shrimp, was introduced to my country from the United States in 1988. Soon after, breakthroughs in artificial breeding technology were achieved, but the scale of its cultivation remained small. It wasn't until 1999, with the introduction of specific pathogen-free (SPF) broodstock, that its cultivation began to increase annually. Due to its high economic value, strong vitality, wide adaptability, and strong disease resistance, it is currently the most widely farmed crustacean in my country and even the world.

[0003] Currently, semi-intensive and intensive farming methods are commonly used for the cultivation of Litopenaeus vannamei. These large-scale farming models typically require the addition of large amounts of feed to the water. In aquaculture water, excessive feeding, the accumulation of leftover bait, and the accumulation of excrement can easily lead to elevated ammonia nitrogen concentrations. In intensive aquaculture systems, ammonia nitrogen concentrations can reach as high as 46 mg / L. Ammonia nitrogen exists in aquaculture water in two primary forms: molecular ammonia (NH3) and ionized ammonium (NH4+). Molecular ammonia is more toxic than ionized ammonium because it is highly lipid-soluble and can penetrate cell membranes into aquatic tissues. Its concentration is also significantly affected by pH and temperature. NH3 concentrations increase with increasing pH; rising temperature also increases the proportion of NH3.

[0004] Effectively improving the genetic resources of Penaeus vannamei and cultivating new varieties with strong tolerance to high ammonia nitrogen levels are crucial for the sustainable development of the shrimp aquaculture industry. Currently, population and family selection are commonly used in the breeding of Penaeus vannamei. However, these methods suffer from long cycles, high costs, and limited utilization of genetic information. This is particularly true for traits that cannot be directly measured and have low heritability, leading to low efficiency in selection. The new generation of marker-assisted breeding (MAS) utilizes genetic markers closely associated with traits to directly select individuals as parents for breeding.

[0005] Molecular markers are substances or traits that are used to distinguish individuals or populations and are stably inherited. Commonly used molecular markers include first-generation markers such as RFLP and RAPD, second-generation SSR and AFLP, and third-generation markers such as SNPs. Third-generation SNPs are heritable variations of a single base at a specific genomic location, with any one allele occurring at a frequency greater than 1% within a population. These variations can occur in transitions, transversions, and insertions / deletions. SNP markers are widely used in marker-assisted breeding due to their numerous advantages, including their large number, widespread distribution, co-dominance, high stability, ease of automated large-scale analysis, ability to reveal hidden polymorphisms undetectable by other techniques, and potential correlation with gene function.

[0006] SNP molecular marker technology is now widely used in the genetic breeding of Penaeus vannamei, with much of the focus on studying key functional genes in the shrimp, including traits such as growth, reproduction, tolerance to low dissolved oxygen, tolerance to high nitrite, and resistance to Vibrio parahaemolyticus. While there have been reports of SNP molecular markers associated with high ammonia nitrogen tolerance in Penaeus vannamei, these sites were discovered using genome-wide association analysis using 40K gene chip sequencing data. Compared to the approximately 2.4G genome size of Penaeus vannamei, this approach often misses relevant sites. Summary of the Invention

[0007] The present invention aims to provide a newly discovered SNP marker associated with high ammonia nitrogen stress resistance. The SNP marker was identified through candidate SNP association analysis based on the results of a previous genome-wide association analysis using genome resequencing data. A primer pair for detecting the SNP marker of the present invention is also provided, as well as a method for marker-assisted genetic breeding of high ammonia nitrogen stress resistance in white shrimp (Penaeus vannamei) is established.

[0008] The present invention is achieved through the following technical solution: a molecular marker related to the high ammonia nitrogen tolerance trait of the vannamei shrimp is cloned from the γ-BBD gene to obtain a SNP molecular marker, which is the 828th base G or A from the 5' end of the first nucleotide sequence shown in the sequence table.

[0009] A primer pair for molecular markers related to the high ammonia nitrogen tolerance trait of Litopenaeus vannamei, the primer pair is primers γ-BBD-F and γ-BBD-R, and the nucleotide sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2:

[0010] (1) SEQ ID NO.1: GCCAACAGAGGTCAACAAG;

[0011] (2) SEQ ID NO. 2: TGAAGCCGTCGGCGAAGAAG.

[0012] The primers γ-BBD-F and γ-BBD-R were designed using Primer 5.0 software with the sequence of the γ-BBD gene mRNA (Gen Bank Accession: NO. XM_027361716.2) of Litopenaeus vannamei as a template.

[0013] The primer pair is used to perform PCR amplification on the segment where the SNP marker is located, and then the SNP marker is detected by sequencing, thereby determining the genotype of the SNP marker site of the tested Litopenaeus vannamei.

[0014] Molecular marker-assisted selection breeding method for high ammonia nitrogen tolerance traits in Litopenaeus vannamei.

[0015] (1) Sampling candidate populations of Litopenaeus vannamei, with the antennae or feet being the preferred sampling sites, and individual shrimp being marked using eye stalk collars or fluorescent markers;

[0016] (2) Direct sequencing of PCR products of the samples using the above primers to obtain SNP locus typing information;

[0017] (3) Combined with the typing information of other sites related to stress resistance, individuals with the GA genotype at the 828th SNP site in the γ-BBD gene were selected as breeding parents for high-ammonia nitrogen-tolerant Litopenaeus vannamei for large-scale farming.

[0018] A screening method using molecular markers related to high ammonia nitrogen tolerance in Litopenaeus vannamei comprises the following steps:

[0019] (1) Using the genomic DNA of the shrimp Litopenaeus vannamei after the high ammonia nitrogen stress experiment as a template, PCR amplification was performed using the above-mentioned primer pair, namely primer γ-BBD-F and primer γ-BBD-R, to obtain an amplified fragment with a length of 328 bp;

[0020] (2) sequencing the amplified fragment obtained in step (1) to obtain a partial sequence of the γ-BBD gene, performing BLAST comparison on the sequence results to screen out base mutation sites, i.e., SNP sites;

[0021] (3) The chi-square test of SPSS24.0 software was used to conduct a correlation analysis between the high ammonia nitrogen tolerance of Litopenaeus vannamei and its genotype.

[0022] In the step 2, the amplified fragments are sequenced and the SNP markers are detected using a direct sequencing method.

[0023] The beneficial effects of the present invention are:

[0024] (1) Statistics show that the genotype of the SNP marker site of the present invention is GA, and the tolerance to high ammonia nitrogen of the shrimp is significantly higher than that of the genotype of the shrimp GG. Furthermore, by detecting the above-mentioned SNP site of the shrimp, its high ammonia nitrogen tolerance can be effectively determined. The SNP marker of the present invention is closely related to the high ammonia nitrogen tolerance trait of the shrimp and can be effectively used in molecular marker-assisted breeding of the shrimp.

[0025] (2) The technical solution of the present invention can be used to select early-stage Penaeus vannamei breeding materials according to actual breeding needs, effectively improving breeding efficiency and accuracy, and improving the performance of Penaeus vannamei breeding populations, thereby accurately and efficiently breeding Penaeus vannamei varieties with strong stress resistance;

[0026] (3) The method is highly practical, has no specific requirements for genomic DNA extraction, sequencing methods, and individual markers, and has wide applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the solutions in this application, a brief introduction will be given below to the drawings required for use in the description of the embodiments of this application. Obviously, the drawings described below are some embodiments of this application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0028] Figure 1 Average survival time of two genotypes of SNP loci in gene γ-BBD in the experimental population DETAILED DESCRIPTION

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this application belongs. The terms used in the specification of the application are for the purpose of describing specific embodiments only and are not intended to limit this application. The terms "including" and "having" and any variations thereof in the specification and claims of this application and the above-mentioned drawings are intended to cover non-exclusive inclusions. The terms "first", "second", etc. in the specification and claims of this application or the above-mentioned drawings are used to distinguish different objects, not to describe a specific order.

[0030] References herein to "embodiments" mean that a particular feature, structure, or characteristic described in connection with the embodiments may be included in at least one embodiment of the present application. The appearance of this phrase in various places in the specification does not necessarily refer to the same embodiment, nor does it constitute an independent or alternative embodiment that is mutually exclusive of other embodiments. It is understood, both explicitly and implicitly, by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0031] In order to enable those skilled in the art to better understand the solution of the present application, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings.

[0032] Example: This example, through genome-wide association analysis of high ammonia nitrogen tolerance in the shrimp Litopenaeus vannamei, identified a locus associated with high ammonia nitrogen tolerance. This locus, located within the γ-BBD gene, exhibits a G / A mutation, and individuals with the G / A genotype exhibit significantly higher tolerance to high ammonia nitrogen than those with the G / G genotype. This SNP can be detected for polymorphism in a population of Litopenaeus vannamei using direct sequencing, and the correlation between genotype frequency and high ammonia nitrogen tolerance in the shrimp can be analyzed. In selective breeding for stress tolerance in Litopenaeus vannamei, this SNP can be used to prioritize G / A individuals as breeding parents, avoiding individuals with the G / G genotype, thereby improving selection efficiency.

[0033] The correlation analysis between the SNP site 828G>A in the γ-BBD gene of Litopenaeus vannamei and high ammonia nitrogen tolerance was carried out according to the following steps:

[0034] (A) Experimental sample preparation;

[0035] (B) Extraction of genomic DNA from Litopenaeus vannamei: In this example, a DNA nucleic acid extraction kit was used for rapid extraction;

[0036] (C) SNP site screening of the γ-BBD gene in Litopenaeus vannamei, typing of site 828G>A;

[0037] (D) Correlation analysis between 828G>A genotype and high ammonia nitrogen tolerance and support for the breeding of high ammonia nitrogen tolerance varieties;

[0038] The specific operations are as follows:

[0039] (A) Experimental sample preparation

[0040] 120 shrimp from different families, reared together in a 1×1.5 m test pond, were selected and placed in a 48-hour high-ammonia nitrogen stress experiment. Throughout the experiment, the stress water was changed and the concentration adjusted daily. Deaths were observed hourly, and the survival time of each shrimp was recorded. Muscle tissue from the first 30 shrimp to die and the last 30 shrimp to die was preserved in anhydrous ethanol for subsequent DNA extraction. Shrimp were considered dead if they lay on their side and did not respond to touch. The high-ammonia nitrogen stress experiment continued until all shrimp had died.

[0041] (B) Extraction of genomic DNA from Litopenaeus vannamei

[0042] 30 mg of preserved shrimp muscle tissue was excised and placed in a sterile centrifuge tube. 200 μl of GA buffer and two sterile steel balls were added, and the sample was ground using a tissue grinder for 2 minutes. After grinding, 20 μl of Proteinase K (20 mg / ml) solution was added to the sample, and the sample was incubated at 56°C for 1 hour, with the sample shaken every 20 minutes for 15 seconds. 200 μl of Buffer GB was added, the sample was thoroughly inverted, and the sample was incubated at 70°C for 10 minutes. 20 μl of RNase A (10 mg / ml) was added, and the sample was allowed to stand at room temperature for 5 minutes. 200 μl of anhydrous ethanol was added, the sample was thoroughly inverted, and the solution was aspirated into an adsorption column. Centrifuged at 12,000 rpm for 30 seconds, the waste liquid was discarded, and the adsorption column was returned to the collection tube. 500 μl of Buffer GD was added to the adsorption column, and the sample was centrifuged at 12,000 rpm for 30 seconds. The waste liquid was discarded, and the adsorption column was returned to the collection tube. Add 600 μl of rinse buffer PW to the adsorption column and centrifuge at 12,000 rpm for 30 seconds. Discard the waste liquid in the collection tube and return the adsorption column to the collection tube. Repeat this step once. Return the adsorption column to the collection tube and centrifuge at 12,000 rpm for 2 minutes. Discard the waste liquid in the collection tube. Uncap the adsorption column and let it sit at room temperature for 5 minutes. Place the adsorption column in a sterile centrifuge tube and add 60 μl of elution buffer TE to the center of the adsorption membrane. Let it sit at room temperature for 5 minutes and then centrifuge at 12,000 rpm for 2 minutes. Aspirate the solution from the centrifuge tube and return it to the adsorption column. Let it sit at room temperature for 2 minutes and then centrifuge at 12,000 rpm for 2 minutes. Discard the adsorption column and retain the centrifuge tube and the solution within. This is the extracted DNA.

[0043] DNA integrity was analyzed using 1% agarose gel electrophoresis. The purity and concentration of the DNA solution were determined using a NanoDrop ND-2000 nucleic acid quantifier. DNA samples that passed the test were stored at -20°C for subsequent use. Acceptable DNA samples were characterized by a single, intact electrophoresis band with no tailing, a sample concentration greater than 100 ng / μl, and a sample purity (OD 260 / 280) between 1.6 and 2.0.

[0044] (C) SNP site screening and sequence site 828G>A typing of γ-BBD gene in Litopenaeus vannamei;

[0045] The sequence of the γ-BBD gene of Litopenaeus vannamei (Gen Bank Accession No. XM_027370330.1) was obtained from the NCBI website, and specific primer pairs γ-BBD-F and γ-BBD-R were designed using Primer 5.0 software. PCR amplification was performed using these primers using genomic DNA of shrimp subjected to high ammonia nitrogen stress as a template. The PCR reaction system consisted of 50 μL: 25 μL Premix Taq™ (LATaq™ Version 2.0, TaKaRa), 17.5 μL deionized water, 2.5 μL forward primer, 2.5 μL reverse primer, and 2.5 μL genomic DNA template. The PCR amplification reaction procedure was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 45 s, repeated 32 times; after extension at 72°C for 5 min, the PCR product was subjected to agarose gel electrophoresis to confirm that the fragment length was correct and unique, and then refrigerated and transported to Guangzhou Sangon Biotechnology Co., Ltd. for sequencing.

[0046] (D) Correlation analysis between G>A genotype and high ammonia nitrogen tolerance

[0047] According to the sequencing results, the number and average survival time of each genotype of Penaeus vannamei at the 828G>A site in the high ammonia nitrogen stress experiment were counted. The chi-square test method of SPSS24.0 software was used to analyze the correlation between the site 828G>A and the high ammonia nitrogen tolerance of Penaeus vannamei. The statistical results are shown in Table 1.

[0048] The results showed that at site 828G>A, the distribution of two different genotypes, GG and GA, was significantly associated with high ammonia nitrogen tolerance (χ 2 =9.357, P=0.002). This suggests that the genotypic polymorphism at this locus significantly affects the tolerance of Litopenaeus vannamei to high ammonia nitrogen, with individuals with the GA genotype exhibiting better tolerance than those with the GG genotype. During breeding and aquaculture, individuals with the GA genotype at the 828G>A locus should be prioritized, and individuals with the GG genotype at the 828G>A locus should be avoided.

[0049] Table 1 Association analysis results of single nucleotide polymorphisms of gene γ-BBD

[0050]

[0051] Obviously, the embodiments described above are only some of the embodiments of the present application, rather than all of the embodiments. The preferred embodiments of the present application are given in the accompanying drawings, but they do not limit the patent scope of the present application. The present application can be implemented in many different forms. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive. Although the present application has been described in detail with reference to the aforementioned embodiments, for those skilled in the art, it is still possible to modify the technical solutions described in the aforementioned specific embodiments, or to make equivalent replacements for some of the technical features therein. Any equivalent structure made using the contents of the present application specification and the accompanying drawings, directly or indirectly used in other related technical fields, is also within the scope of patent protection of the present application.

Claims

1. A molecular marker associated with high ammonia nitrogen tolerance in Litopenaeus vannamei, characterized by: A SNP molecular marker was cloned from the γ-BBD gene. The SNP marker was a G or A at the 828th base from the 5' end of the first nucleotide sequence shown in the sequence table.

2. A primer pair for molecular markers related to high ammonia nitrogen tolerance in Litopenaeus vannamei as claimed in claim 1, characterized in that: The primer pair is primers γ-BBD-F and γ-BBD-R, and the nucleotide sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2: (1) SEQ ID NO.1: GCCAACAGAGGTCAACAAG; (2) SEQ ID NO. 2: TGAAGCCGTCGGCGAAGAAG.

3. The primer pair according to claim 2, wherein: The primers γ-BBD-F and γ-BBD-R were designed using Primer 5.0 software with the sequence of the γ-BBD gene mRNA (Gen Bank Accession: NO. XM_027361716.2) of Litopenaeus vannamei as a template.

4. A method for detecting the primer pair according to claim 2 or 3, characterized in that: The primer pair is used to perform PCR amplification on the segment where the SNP marker is located, and then the SNP marker is detected by sequencing, thereby determining the genotype of the SNP marker site of the tested Litopenaeus vannamei.

5. The molecular marker-assisted selection breeding method for high ammonia nitrogen tolerance of Litopenaeus vannamei according to claim 2 or 3, characterized in that: (1) Sampling candidate populations of Litopenaeus vannamei, with the antennae or feet being the preferred sampling sites, and individual shrimp being marked using eye stalk collars or fluorescent markers; (2) Direct sequencing of PCR products of the samples using the above primers to obtain SNP locus typing information; (3) Combined with the typing information of other sites related to stress resistance, individuals with the GA genotype at the 828th SNP site in the γ-BBD gene were selected as breeding parents for high-ammonia nitrogen-tolerant Litopenaeus vannamei for large-scale farming.

6. A screening method using the marker associated with high ammonia nitrogen tolerance of Litopenaeus vannamei according to claim 2 or 3, characterized in that: The following steps are involved: (1) Using the genomic DNA of the shrimp Litopenaeus vannamei after the high ammonia nitrogen stress experiment as a template, PCR amplification was performed using the above-mentioned primer pair, namely primer γ-BBD-F and primer γ-BBD-R, to obtain an amplified fragment with a length of 328 bp; (2) sequencing the amplified fragment obtained in step (1) to obtain a partial sequence of the γ-BBD gene, performing BLAST comparison on the sequence results to screen out base mutation sites, i.e., SNP sites; (3) The chi-square test of SPSS24.0 software was used to conduct a correlation analysis between the high ammonia nitrogen tolerance of Litopenaeus vannamei and its genotype.

7. The method for screening markers related to high ammonia nitrogen tolerance of Litopenaeus vannamei according to claim 6, characterized in that: In the step 2, the amplified fragments are sequenced and the SNP markers are detected using a direct sequencing method.

Citation Information

Cited By

  • SNP molecular marker related to high ammonia nitrogen resistance character of Litopenaeus vannamei LvInx2 gene and application of SNP molecular marker

    CN121320575A