Application of molecular marker for breast circumference character breeding of grassland short-tailed sheep
By detecting specific SNP sites in the genome of grassland short-tailed sheep, the problems of slow breeding progress and low efficiency in traditional phenotypic selection have been solved, enabling early and precise selection of chest girth traits in grassland short-tailed sheep and improvement of chest girth in offspring.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-03-17
AI Technical Summary
In existing technologies, the selection of chest girth traits in grassland short-tailed sheep relies on traditional phenotypic selection, which has problems such as slow breeding progress, susceptibility to environmental factors, low genetic efficiency, and inability to predict and select early.
Develop molecular markers for the chest girth trait in grassland short-tailed sheep, and achieve early and precise breeding and increase the chest girth of offspring by detecting specific SNP sites (such as SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5) in the grassland short-tailed sheep genome.
Molecular marker technology enables early selection and breeding of grassland short-tailed sheep at the juvenile or embryonic stage, significantly shortening the breeding cycle, increasing the chest circumference of offspring, and providing a precise genetic improvement tool.
Smart Images

Figure CN121674584A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic breeding, in particular to an application of a molecular marker for breeding grassland short-tail sheep chest circumference traits. BACKGROUND
[0002] Grassland short-tail sheep is a new breed of mutton sheep, which has the advantages of short tail, cold tolerance and coarse feed tolerance, and its breeding survival rate and feed conversion efficiency are significantly better than those of local breed Mongolian sheep. Grassland short-tail sheep has become an excellent parent for crossbreeding mutton sheep and has shown great potential in improving the production performance of offspring. Chest circumference, as a key trait for measuring the body development and meat production potential of mutton sheep, is an important way to improve the economic value of grassland short-tail sheep. At present, the breeding of sheep chest circumference traits still mainly relies on traditional phenotype selection method, that is, the chest circumference size of adult individuals is measured in the field, and the selection is carried out combined with pedigree information. This method has the following obvious defects: 1) the chest circumference trait needs to be accurately measured when the sheep grow to a certain stage, usually after adulthood, resulting in long generation interval and slow breeding progress. 2) The chest circumference is easily affected by environmental factors such as feeding management level, nutritional status and measurement error, which reduces the accuracy and reliability of phenotype-based selection. 3) For chest circumference, a quantitative trait controlled by multiple genes, its heritability is usually only at a moderate level, and the genetic gain of phenotype selection is limited, resulting in low breeding efficiency. 4) It is not possible to effectively predict and select the chest circumference genetic potential of young or pre-birth sheep, which limits early breeding and rapid expansion of high-quality breeding stock. Therefore, developing an application technology for detecting the chest circumference traits of grassland short-tail sheep has become a key technical problem to be solved in the field. SUMMARY
[0003] The present application provides an application of a molecular marker for breeding grassland short-tail sheep chest circumference traits, which can be used for identifying the chest circumference traits of grassland short-tail sheep and breeding grassland short-tail sheep with large chest circumference.
[0004] The present application is realized by the following technical solutions: The present application provides an application of a molecular marker for breeding grassland short-tail sheep chest circumference traits, and the molecular marker is at least one of the following ①-③: ① the nucleotide sequence shown in SEQ ID NO. 1, the nucleotide at position 101 is A or G; ② the nucleotide sequence shown in SEQ ID NO. 3, the nucleotide at position 101 is C or A; ③ the nucleotide sequence shown in SEQ ID NO. 5, the nucleotide at position 101 is T or C; The application refers to any one of the following (1) and (2): (1) identifying the chest circumference of grassland short-tail sheep; (2) Increase the chest circumference of offspring of grassland short-tailed sheep.
[0005] Preferably, the method for determining the chest circumference of grassland short-tailed sheep is as follows: Genomic DNA was extracted from the short-tailed sheep of the grassland and sequenced. Determine the genotype of the grassland short-tailed sheep at position 101 bp of SEQ ID NO.1, SEQ ID NO.3, or SEQ ID NO.5; If the genotype is at least one of A) to C), then the grassland short-tailed sheep is large-chested, and large-chested means a chest circumference greater than 99.685 cm; A) The genotype at 101bp of SEQ ID NO.1 is GG; B) The genotype at 101bp of SEQ ID NO.3 is AA; C) The genotype at 101bp of SEQ ID NO.5 is CC.
[0006] Preferably, the method for increasing the chest circumference of offspring of grassland short-tailed sheep is as follows: Genomic DNA was extracted from the short-tailed sheep of the grassland and sequenced. Determine the genotype of the grassland short-tailed sheep at position 101 bp of SEQ ID NO.1, SEQ ID NO.3, or SEQ ID NO.5; By selecting grassland short-tailed sheep individuals carrying at least one of the genotypes shown in a) to c) as parents for breeding, the chest circumference of grassland short-tailed sheep offspring can be increased. a) The genotype at 101bp of SEQ ID NO.1 is GG; b) The genotype at 101bp of SEQ ID NO.3 is AA; c) The genotype at 101bp of SEQ ID NO.5 is CC.
[0007] Preferably, the genomic DNA is derived from the blood of a steppe short-tailed sheep.
[0008] Preferably, the genomic DNA is extracted using the phenol-chloroform method.
[0009] Preferably, the chest circumference refers to the length around the chest of a short-tailed sheep, measured from the rear end of the scapula.
[0010] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides an application of molecular markers for the selection of chest girth traits in grassland short-tailed sheep. The molecular markers are at least one of the following ①~③: ① the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101bp site is A or G; ② the nucleotide sequence shown in SEQ ID NO.3, where the nucleotide at the 101bp site is C or A; ③ the nucleotide sequence shown in SEQ ID NO.5, where the nucleotide at the 101bp site is T or C. The application refers to any one of the following (1) and (2): (1) identifying the chest girth of grassland short-tailed sheep; (2) improving the chest girth of offspring of grassland short-tailed sheep. This invention, for the first time, screened three SNP molecular markers that are stably associated with chest girth traits in a grassland short-tailed sheep population. These molecular markers effectively overcome the shortcomings of traditional phenotypic selection methods, such as long breeding cycles, low efficiency, and susceptibility to environmental interference. By detecting the genotypes of corresponding molecular markers, early and precise selection can be achieved in the young or embryonic stages of grassland short-tailed sheep, significantly shortening the breeding cycle. Furthermore, by selecting individuals with superior genotypes as parents, the average chest circumference of offspring can be directly and efficiently increased, providing a reliable tool for molecular-assisted breeding and precise genetic improvement of chest circumference traits in grassland short-tailed sheep. Attached Figure Description
[0011] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0012] Figure 1 This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.
[0013] Figure 2 This is a visualization of the genomic kinship matrix of the grassland short-tailed sheep population of this invention.
[0014] Figure 3 This is a Manhattan plot representing the genome-wide association analysis (GWA) of the chest girth trait in grassland short-tailed sheep according to this invention. A: Analysis results from the GCTA-fastGWA model, where red dots represent SNPs that have reached genomic significance. B: Analysis results from the rMVP-FarmCPU model, where red dots represent SNPs that have reached genomic significance. C: Analysis results from the Fast3VmrMLM model, where purple dots represent SNPs that have reached genomic significance. Detailed Implementation
[0015] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0016] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in the specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0017] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0018] The following is a list of abbreviations related to this invention: LD: Linkage Disequilibrium; SNP: Single nucleotide polymorphism; GWAS: Genome-wide association analysis.
[0019] Example 1 The application of a molecular marker for the selection of chest girth traits in grassland short-tailed sheep is as follows: 1. Experimental animals and phenotypic sources.
[0020] The subjects of this study were 300 adult steppe short-tailed sheep. Chest circumference of each sheep was measured in the morning on an empty stomach using a soft measuring tape. Detailed phenotypic records are shown in Table 1.
[0021] Blood samples were collected from 300 individual grassland short-tailed sheep. All samples were immediately stored at -80°C after collection and transported to the laboratory on dry ice for long-term storage at -80°C.
[0022] Table 1. Description of chest circumference traits in grassland short-tailed sheep
[0023] 2. Genomic DNA extraction and quality control.
[0024] DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration was measured using a NanoDrop2000 spectrophotometer. The absorption wavelength ratio of the highest absorption peak at 260 nm to 280 nm was calculated to measure the content of DNA, protein, and phenolic substances. The absorption wavelength ratio of the highest absorption peak at 260 nm to 230 nm was calculated to measure the content of DNA and carbohydrates. DNA quality was then assessed using 1% (w / v) agarose gel electrophoresis.
[0025] 3. Library construction and sequencing.
[0026] Genomic DNA that passed quality control was randomly fragmented into approximately 350 bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly A addition, sequencing adapter addition, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality control, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.
[0027] 4. Identification, screening, and annotation of variant sites.
[0028] The raw sequencing data was quality controlled using FASTP software to obtain Clean reads. A genome index was built on the reference genome. The quality-controlled Clean reads were aligned with the reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted into BAM files using SAMtools software version 1.8-20, and the BAM files were sorted. The MarkDuplicates program in Genome Analysis Toolkit software version 3.8 was used to remove duplicate data from the sorted BAM files to obtain the final BAM files. An index was built on the final BAM files, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. After obtaining the VCF file, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on detected gene variations. Based on the location of the variant site on the reference genome and the gene location information on the reference genome, the region in which the variant site occurs in the genome, such as intergenic regions, intronic regions, or CDS regions, can be determined; as well as the impact of the variant, such as synonymous mutations or non-synonymous mutations.
[0029] 5. Group stratification correction.
[0030] Whole-genome resequencing was performed on 300 individuals of Steppe Short-tailed Sheep, generating a total of 15768.1 Gb of raw reads and identifying 56,632,165 SNPs. The genotyping data were quality controlled using Plink software version 1.90, removing individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and SNPs with a Hardy-Weinberg equilibrium p-value of less than 10.-6 SNPs. A total of 23,751,522 high-quality SNPs were identified in the grassland short-tailed sheep population. These loci are evenly distributed across the 26 pairs of autosomes in grassland short-tailed sheep, such as... Figure 1 As shown.
[0031] The first three principal components were calculated using the "--pc3" parameter in Plink software version 1.90. These three principal components were then used as covariates to correct for population stratification in the steppe short-tailed sheep. Genomic phylogenetic analysis based on the G-matrix was performed on this population using Plink v1.90, and the results are as follows: Figure 2 As shown, Figure 2 Each square in the grid represents the kinship value between two samples. The smaller the value, the closer it is to light green, meaning the more distant the kinship between the two individuals, and vice versa. Figure 2 The results showed that the average kinship among individuals of grassland short-tailed sheep was relatively distant.
[0032] 6. Genome-wide association analysis.
[0033] The association analysis between SNP and chest circumference traits was performed using the fastGWA-mlm model in GCTA software version V1.94.0beta. The formula is as follows: .
[0034] in, y It is a phenotypic vector; X snp It is a genotype vector, and its effect is β snp ; X c It is an association matrix with gender, age, and the first three principal components as fixed covariates, and its corresponding coefficients are... β c ; g It is a vector of total genetic effects captured by the genetic relationship matrix derived from SNPs. g ~ N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e It is the residual vector. e ~ N(0, ).
[0035] To avoid false negatives caused by the overly strict Bonferroni correction method of 0.05 / SNP, this invention adjusts the threshold for genome-wide significant association to P=1×10⁻⁶. -6The genome expansion factor λ of the test statistic was calculated using R software version V3.6.0. λ is the slope of the linear regression between the observed quantile and the theoretical quantile. The λ value for the chest circumference trait in this invention was 0.969, indicating that there is no significant genome expansion.
[0036] Based on resequencing data from 300 grassland short-tailed sheep, this invention detected three significant SNP loci associated with chest girth traits. These loci are located on chromosomes 3 and 8, as shown in Table 2. Figure 3 As shown in A.
[0037] Table 2. Significant SNPs associated with chest circumference traits obtained based on the GCTA-fastGWA model.
[0038] Association analysis between SNPs and chest girth traits was performed using the FarmCPU model integrated in the rMVP package of R software. Based on resequencing data from 300 grassland short-tailed sheep, a total of 9 SNP loci significantly associated with chest girth traits were detected. These significant loci were distributed on chromosomes 3, 7, and 8. (See Table 3 and...) Figure 3 As shown in B, this model effectively controlled the false positive rate by iteratively optimizing the fixed and random effects, further validating the complexity of the genetic structure of chest circumference traits.
[0039] Table 3. Significant SNPs associated with chest circumference traits obtained based on the rMVP-FarmCPU model.
[0040] Association analysis between SNPs and chest girth traits was performed using the Fast3VmrMLM model. Based on resequencing data from 300 grassland short-tailed sheep, 28 SNP loci significantly associated with chest girth were detected. These significant loci were located on chromosomes 1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 15, 16, 18, 21, 24, and 26. (See Table 4). Figure 3 As shown in C. This multi-locus association analysis model can simultaneously detect multiple QTNs, improving the detection efficiency for complex trait genetic loci and revealing a wider range of chromosomal regions associated with the formation of chest girth in steppe short-tailed sheep.
[0041] Table 4. Significant SNPs associated with chest circumference traits obtained based on the Fast3VmrMLM model.
[0042] In summary, by employing three different association analysis models, this invention systematically identified SNP loci significantly associated with chest girth traits in grassland short-tailed sheep. The loci revealed by the different models overlap in both number and distribution, yet each model has its own emphasis, collectively outlining a complex genetic network controlling chest girth traits in grassland short-tailed sheep. This provides a solid data foundation and diverse candidate targets for subsequent molecular marker development and breeding applications.
[0043] A comprehensive analysis of the results from the three models revealed three stable SNPs associated with chest circumference traits, specifically: (1) A SNP locus located on chromosome 3, chr3_83563006, showed significant results in both GCTA-fastGWA and rMVP-FarmCPU, and was stably associated with chest circumference.
[0044] (2) A SNP locus located on chromosome 3, chr3_141991751, showed significant results in both GCTA-fastGWA and rMVP-FarmCPU, and was stably associated with chest circumference.
[0045] (3) A SNP locus located on chromosome 8, chr8_70348591, showed significant results in both GCTA-fastGWA and rMVP-FarmCPU, and was stably associated with chest circumference.
[0046] 7. Validation and effect analysis of key SNP sites.
[0047] (1) Genotyping and phenotype association analysis was performed on the chr3_83563006 locus, and the results are shown in Table 5.
[0048] Table 5. Association analysis between different genotypes at the chr3_83563006 locus and chest circumference.
[0049] Note: In Table 5, different lowercase letters in the chest circumference column indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.
[0050] As shown in Table 5, individuals with the GG genotype have the largest chest circumference, which can serve as a genetic marker for higher chest circumference; individuals with the AA genotype have the smallest chest circumference. The allele frequencies and genotype frequencies at this locus are shown in Table 6.
[0051] Table 6. Allele frequencies and genotype frequencies at the chr3_83563006 locus.
[0052] The nucleotide sequence containing the chr3_83563006 site is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0053] SEQ ID NO.1: GTGTTATATTTATAAATATATGTATTTGCACTTCTAATGAGCTTTAGTGTTGTTTTGCTTCAACACCACAGTAAAAAAGGACCTCAAATTCCAGGCCTGCACCATGTGTCCCCACAACTGAAACAGGACTCACTTGAACACATTCCCACTTCACCTCAGACCTGTACCCTGGATAAATATATGTTACAAATTTTTAAAAAA.
[0054] SEQ ID NO.2: GTGTTATATTTATAAATATATGTATTTGCACTTCTAATGAGCTTTAGTGTTGTTTTGCTTCAACACCACAGTAAAAAAGGACCTCAAATTCCAGGCCTGCGCCATGTGTCCCCACAACTGAAACAGGACTCACTTGAACACATTCCCACTTCACCTCAGACCTGTACCCTGGATAAATATATGTTACAAATTTTTAAAAAA.
[0055] (2) Genotyping and phenotype association analysis was performed on the chr3_141991751 locus, and the results are shown in Table 7.
[0056] Table 7. Association analysis between different genotypes at the chr3_141991751 locus and chest circumference.
[0057] Note: In Table 7, different lowercase letters in the chest circumference column indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.
[0058] As shown in Table 7, individuals with the AA genotype have the largest chest circumference, which can serve as a genetic marker for a higher chest circumference; individuals with the CC genotype have the smallest chest circumference. The allele frequencies and genotype frequencies at this locus are shown in Table 8.
[0059] Table 8. Allele and genotype frequencies at the chr3_141991751 locus
[0060] The nucleotide sequence containing the chr3_141991751 site is shown in SEQ ID NO.3 and SEQ ID NO.4.
[0061] SEQ ID NO.3: CAGGGGGAATGCTTTCAGTTTTTCACCATTGAGAATAATGTTTGCTGTAGGCTTATCATATATGATCTTTACTATGTTGAGGTAGGTTCCTTCTATACCCCTATTTGAAGAGTTTTAATCATAAACTGGTACTGAATTTTGTCAAAGACTTTTTCTGCATCTACTGAAATTATCATATAGTTTTTCAGTTTGTTAATATG.
[0062] SEQ ID NO.4: CAGGGGGAATGCTTTCAGTTTTTCACCATTGAGAATAATGTTTGCTGTAGGCTTATCATATATGATCTTTACTATGTTGAGGTAGGTTCCTTCTATACCCATTATTTGAAGAGTTTTAATCATAAACTGGTACTGAATTTTGTCAAAGACTTTTTCTGCATCTACTGAAATTATCATATAGTTTTTCAGTTTGTTAATATG.
[0063] (3) Genotyping and phenotype association analysis was performed on the chr8_70348591 locus, and the results are shown in Table 9.
[0064] Table 9. Association analysis between different genotypes at the chr8_70348591 locus and chest circumference.
[0065] Note: In Table 9, different lowercase letters in the chest circumference column indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.
[0066] As shown in Table 9, individuals with the CC genotype have the largest chest circumference, which can serve as a genetic marker for higher chest circumference; individuals with the TT genotype have the smallest chest circumference. The allele frequencies and genotype frequencies at this locus are shown in Table 10.
[0067] Table 10 Allelic and Genotype Frequencies of Key SNP Loci
[0068] The nucleotide sequence containing the chr8_70348591 site is shown in SEQ ID NO.5 and SEQ ID NO.6.
[0069] SEQ ID NO.5: TTAGAAATTCATAGATTGATTAAAAATGTCATTGTAGGTCAAGCTGCCAGTTTCTCTCTGGAACCAATAGCAAGAAGAGTAGTTTTTCCTTGCCCCTTCTTTGTCAAATGTGCTATGAACTGAATGTCTGAATCTGGTAACAGGTGAAAAGAGGAGGTGGGTAAATATGGGTCAGAATGTTTGGCAATAATAATCAAT.
[0070] SEQ ID NO.6: TTAGAAATTCATAGATTGATTAAAAATGTCATTGTAGGTCAAGCTGCCAGTTTCTCTCTGGAACCAATAGCAAGAAGAGTAGTTTTTCCTTGCCCCTTCTTTGTCAAATGTGCTATGAACTGAATGTCTGAATCTGGTAACAGGTGAAAAGAGGAGGTGGGTAAATATGGGTCAGAATGTTTGGCAATAATAATCAAT.
[0071] The above results indicate that when the nucleotide sequences at the corresponding sites are as shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, they are significantly associated with the large chest girth trait of the steppe short-tailed sheep. Therefore, using: (1) A→G mutation at position 83563006 on chromosome 3 of grassland short-tailed sheep is used to breed large-breast-circumference grassland short-tailed sheep. Individuals with the GG genotype are selected as the father or mother to improve the chest circumference of the offspring of grassland short-tailed sheep.
[0072] (2) The C→A mutation at position 141991751 on chromosome 3 of the grassland short-tailed sheep is used to breed large-breast-circumference grassland short-tailed sheep. Individuals with the AA genotype are selected as the father or mother to improve the chest circumference of the offspring of the grassland short-tailed sheep.
[0073] (3) The T→C mutation at position 70348591 on chromosome 8 of the grassland short-tailed sheep is used to breed grassland short-tailed sheep with large chest circumference. Individuals with CC genotype are selected as the father or mother to improve the chest circumference of the offspring of grassland short-tailed sheep.
[0074] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0075] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0076] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention should be determined by the appended claims.
Claims
1. The use of a molecular marker for breeding a short-tail sheep chest circumference trait in a grassland, characterized in that, The molecular marker is at least one of the following ①-③: ① the nucleotide sequence shown in SEQ ID NO. 1, the nucleotide at position 101bp is A or G; ② the nucleotide sequence shown in SEQ ID NO. 3, the nucleotide at position 101bp is C or A; ③ the nucleotide sequence shown in SEQ ID NO. 5, the nucleotide at position 101bp is T or C; The application refers to any one of the following (1) and (2): (1) identifying the chest circumference of grassland short-tail sheep; (2) improving the chest circumference of the offspring of grassland short-tail sheep.
2. Use according to claim 1, wherein The method for identifying the chest circumference of grassland short-tail sheep is as follows: extracting the genomic DNA of the grassland short-tail sheep to be tested for sequencing; determining the genotype of the grassland short-tail sheep at position 101bp of SEQ ID NO. 1, SEQ ID NO. 3 or SEQ ID NO. 5; if the genotype is at least one of the following A)-C), the grassland short-tail sheep is large chest circumference, which refers to the chest circumference value greater than 99.685cm; A) the genotype at position 101bp of SEQ ID NO. 1 is GG; B) the genotype at position 101bp of SEQ ID NO. 3 is AA; C) the genotype at position 101bp of SEQ ID NO. 5 is CC.
3. The use according to claim 1, wherein The method for improving the chest circumference of the offspring of grassland short-tail sheep is as follows: extracting the genomic DNA of the grassland short-tail sheep to be tested for sequencing; determining the genotype of the grassland short-tail sheep at position 101bp of SEQ ID NO. 1, SEQ ID NO. 3 or SEQ ID NO. 5; selecting the grassland short-tail sheep individual carrying at least one of the genotypes shown in a)-c) as the parent for breeding, which can improve the chest circumference of the offspring of grassland short-tail sheep; a) the genotype at position 101bp of SEQ ID NO. 1 is GG; b) the genotype at position 101bp of SEQ ID NO. 3 is AA; c) the genotype at position 101bp of SEQ ID NO. 5 is CC.
4. Use according to claim 2 or claim 3, wherein the compound is of formula (I) ###0001### (I) or a pharmaceutically acceptable salt thereof. The genomic DNA is derived from the blood of grassland short-tail sheep.
5. The use as claimed in claim 2 or claim 3, wherein, The extraction method of the genomic DNA is phenol-chloroform method.
6. The use according to claim 1, wherein The chest circumference refers to: the length of the grassland short-tail sheep around the chest circumference.
Citation Information
Patent Citations
Application of g.44057663G > A site of CYP19A1 gene in goat growth traits
CN118979111A
Application of SNP (Single Nucleotide Polymorphism) molecular marker in identification or auxiliary identification of goat chest circumference
CN120366475A
AU2020203675A1
Cited By
Application of a molecular marker affecting chest circumference traits of duomun sheep
CN122235327A
Application of a molecular marker affecting chest circumference traits of duomun sheep
CN122235327B
Application of a molecular marker related to chest width trait of mutton sheep
CN122279057A