A penaeus vannamei nitrite stress resistance related gene SNP marker, a detection primer and application thereof

Abstract

This invention discloses a SNP marker, detection primers, and applications for genes related to nitrite resistance in Litopenaeus vannamei. The SNP molecular marker is located at the 193bp site of the sequence shown in SEQ ID NO.2, with mutation types of A / A homozygous, G / G homozygous, and A / G heterozygous. Litopenaeus vannamei with the A / A homozygous SNP molecular marker exhibits significantly higher nitrite resistance than those with the G / G homozygous and A / G heterozygous genotypes. This invention accelerates the breeding process of superior nitrite-resistant Litopenaeus vannamei varieties by identifying SNP markers associated with nitrite resistance and applying these markers to establish a marker-assisted breeding method for nitrite resistance in Litopenaeus vannamei.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding of aquatic animals, specifically involving a SNP marker for a gene related to nitrite resistance in Litopenaeus vannamei, detection primers, and their applications. Background Technology

[0002] The Pacific white shrimp, scientifically known as *Litopenaeus vannamei*, is the world's most farmed shrimp. Native to the Pacific coast of the Western Hemisphere, stretching from southwestern Mexico to western Peru, it lacks native wild resources in my country. Although my country is not the country of origin for the Pacific white shrimp, it has, to date, developed 12 new varieties with variety rights, focusing on traits such as growth rate, low-temperature tolerance, and resistance to vibrio disease. Currently, my country is the world's largest producer of Pacific white shrimp. According to the *2023 China Fisheries Statistical Yearbook*, in 2022, the national production of farmed Pacific white shrimp reached 1.34 million tons, accounting for 81% of my country's total farmed shrimp production.

[0003] The demands of industrial and agricultural development, the discharge of industrial and domestic wastewater, the increasing use of chemical fertilizers, and the development of high-density aquaculture have exacerbated the accumulation of ammonia and nitrite in water bodies. When crustaceans are in abnormal environments, their bodies produce large amounts of reactive oxygen species (ROS). If the ROS content exceeds the range of the antioxidant system, it will cause oxidative damage to the organisms, leading to death and hindering the healthy development of shrimp farming. Therefore, breeding for high nitrite traits in Litopenaeus vannamei can provide theoretical support for stress-resistant breeding of Litopenaeus vannamei.

[0004] Traditional breeding methods are time-consuming and inefficient. With the rapid application of modern biotechnology and genetics in aquaculture, molecular marker technology based on trait-related functional genes has become one of the key technologies in aquatic genetic breeding. Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have a high distribution density in the genome. Due to their advantages such as rapid and large-scale screening, ease of genotyping, and high genetic stability, SNPs have been widely used in aquatic genetic breeding. Summary of the Invention

[0005] The present invention aims to accelerate the breeding process of superior stress-resistant varieties of Litopenaeus vannamei by mining SNP markers related to nitrite resistance in Litopenaeus vannamei and by applying these markers to establish a method for molecular marker-assisted stress resistance breeding of Litopenaeus vannamei.

[0006] The first objective of this invention is to provide an SNP molecular marker for a gene related to nitrite resistance in Litopenaeus vannamei, wherein the SNP molecular marker is located at the 193bp site of the sequence shown in SEQ ID NO.2, and the mutation types are A / A homozygous, G / G homozygous, and A / G heterozygous.

[0007] This invention discovers a polymorphism at a site in the Lv-Catalase gene (its nucleotide sequence is shown in SEQ ID NO. 2) of Litopenaeus vannamei. This site is located at 193 bp of the catalase gene, and the base is either A or G. Litopenaeus vannamei homozygous for A (A / A) at this site exhibits a significantly higher survival rate under nitrite stress than A / G heterozygous and G / G homozygous individuals. Litopenaeus vannamei individuals with the A / A genotype at this SNP site possess excellent stress resistance; therefore, the stress-resistant dominant genotype indicated by this SNP molecular marker is the A / A homozygous genotype.

[0008] Therefore, the present invention provides an SNP molecular marker for distinguishing the ability of Litopenaeus vannamei to resist nitrite, which is located at the 103bp site of the CDS region of the catalase gene of Litopenaeus vannamei (its nucleotide sequence is shown in SEQ ID NO.2), and the mutation types are A / A homozygous, G / G homozygous and A / G heterozygous.

[0009] The second objective of this invention is to provide a primer for detecting SNP molecular markers of genes related to nitrite resistance in Litopenaeus vannamei, comprising the following primers:

[0010] Lv-Cat-F: 5'-TTGTTTGTGCTAAGATGAGG-3';

[0011] Lv-Cat-R: 5'-GAATGAAAATGTAAGTGGCA-3'.

[0012] The detection primers described above provide stable and reproducible amplification. The nucleotide sequence of the amplified product is shown in SEQ ID NO.2. The SNP site is located at 193 bp of the amplified product sequence and represents an A to G mutation. The dominant genotype for nitrite resistance of this marker is the A / A homozygous genotype.

[0013] A third objective of this invention is to provide a detection kit comprising the aforementioned detection primers Lv-Cat-F and Lv-Cat-R.

[0014] A fourth objective of this invention is to provide the application of the aforementioned SNP molecular markers, the aforementioned detection primers, or the aforementioned detection kits in distinguishing the nitrite resistance of Litopenaeus vannamei.

[0015] Preferably, the SNP molecular markers of Litopenaeus vannamei with the A / A homozygous genotype have significantly higher resistance to nitrite than those with the G / G homozygous and A / G heterozygous genotypes.

[0016] The fifth objective of this invention is to provide the application of the above-mentioned SNP molecular markers, detection primers, or detection kits in the individual identification, population selection, or maintenance of highly resistant strains of Litopenaeus vannamei with nitrite resistance in broodstock shrimp.

[0017] The sixth object of the present invention is to provide a product for identifying the above-mentioned SNP molecular markers for use in the preparation of a reagent for distinguishing the ability of Litopenaeus vannamei to resist nitrite.

[0018] The seventh objective of this invention is to provide a method for breeding nitrite-resistant varieties of Litopenaeus vannamei, comprising the following steps:

[0019] a. Extract genomic DNA from the Litopenaeus vannamei shrimp to be tested;

[0020] b. PCR amplification of the genomic DNA of the Litopenaeus vannamei to be tested was performed using the above-mentioned detection primers Lv-Cat-F and Lv-Cat-R;

[0021] c. Sequencing the amplified products to determine the genotypes of the aforementioned molecular SNP markers, and selecting individuals with homozygous A / A genotypes as backup parents for breeding nitrite-resistant varieties of Litopenaeus vannamei.

[0022] Preferably, the PCR amplification reaction system comprises: 15 μL of 2×Taq PCR Master Mix, 2 μL of forward primer, 2 μL of reverse primer, 1 μL of DNA template, and the remainder is made up to 30 μL with sterile double-distilled water.

[0023] Preferably, the PCR amplification reaction program is as follows: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; and further extension at 72°C for 10 minutes.

[0024] Preferably, the PCR amplification products are sequenced using an ABI 3730xl DNAAnalyzer sequencer under Sanger sequencing.

[0025] Advantages of this invention:

[0026] This invention identifies SNP markers associated with nitrite resistance in Litopenaeus vannamei and establishes an effective method for marker-assisted genetic selection of nitrite resistance in Litopenaeus vannamei using these markers. This method is highly efficient, simple to operate, and accelerates the breeding process of superior nitrite-resistant Litopenaeus vannamei varieties. The selected individuals have stable genotypes and do not undergo genetic differentiation, which can significantly accelerate the progress of stress-resistant breeding and has important guiding significance for improving the stress-resistant aquaculture of Litopenaeus vannamei. Attached Figure Description

[0027] Figure 1 This is a gel image of DNA electrophoresis detection from Litopenaeus vannamei. M is StarMarker D2000 Plus Cat#M021 (Tianyi Huiyuan Biotechnology Co., Ltd.). The negative control template is a sterile water sample, proving that the extraction process was uncontaminated. The positive control template is verified fish fin DNA, proving that the extraction process was normal.

[0028] Figure 2 This is an electrophoresis image of a sample of PCR amplification products. M is DL2000 (Tianyi Huiyuan Biotechnology Co., Ltd.).

[0029] Figure 3 This is a peak diagram showing the A / A homozygous, G / G homozygous, and A / G heterozygous peaks at the 103bp position amplified by primer pairs Lv-Cat-F and Lv-Cat-R of the catalase gene in Litopenaeus vannamei. Detailed Implementation

[0030] The present invention will be further described below with reference to embodiments, but is not limited thereto.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods or performed according to the kit instructions. Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Cloning, sequencing, and primer synthesis were performed by Wuhan Tianyi Huayu Gene Technology Co., Ltd.

[0032] Example 1:

[0033] 1. Collection of Nitrite-Resistant Samples from Litopenaeus vannamei

[0034] 1.1 Stress Resistance Test

[0035] A shrimp farm in Maoming collected Litopenaeus vannamei shrimp with a body length of about 3 cm and subjected them to a nitrite stress experiment (using sodium nitrite to achieve a final NO2-N concentration of 100 mg / L (as nitrogen)). The number of surviving shrimp after 72 hours of stress treatment was recorded. The results are shown in Table 1 below:

[0036] Table 1 Results of Nitrite Resistance Test

[0037] Number of shrimp larvae in the experiment (tails) 118 (tail) 24-hour death count in resilience test 17 Number of deaths in 48 hours of resilience test 19 Number of deaths in 72-hour stress test 20 Number of survivors in the 72-hour stress test 62

[0038] 1.2 Collection of Nitrite-Resistant Samples from Litopenaeus vannamei

[0039] Litopenaeus vannamei that survived nitrite stress for 72 hours were used as nitrite-resistant samples, while Litopenaeus vannamei that died after 72 hours of stress (including before 72 hours) were used as non-nitrite-resistant samples. Forty-eight samples were taken from each of the nitrite-resistant and non-resistant samples for testing.

[0040] 2. Development of Resistant SNP Markers

[0041] 2.1 Extraction of genomic DNA from stress-resistant and non-stress-resistant Litopenaeus vannamei (North and South White Shrimp)

[0042] Forty-eight individuals were selected from both the stress-resistant and non-stress-resistant individuals, and their genomes were extracted using a magnetic bead-based tissue genome extraction kit (NMG0611-500, Wuhan Naci Biotechnology Co., Ltd.). Take 30-50 mg of sample, cut it into appropriate pieces, and place it in the corresponding well of the extraction plate. Add 400 μL of tissue lysis buffer and 5 μL of proteinase K to each well of the sample plate, vortex to mix, and incubate overnight at 65°C for digestion. In a new extraction plate, aliquot 100 μL of magnetic beads into each well and place them at station 2 of the extraction instrument. Aliquot 500 μL / well of 75% ethanol into three plates and place them at stations 3, 4, and 5 respectively. Aliquot 100 μL / 80 μL / 60 μL (according to the sample condition) of elution buffer into each well of the elution plate and place them at station 6. The next day, remove the extraction plate (sample plate) and place it at station 1 of the extraction instrument. Start the lysis program for 15 min. After lysis, add 280 μL of isopropanol to each well of the sample plate and place the sample plate at station 1 of the extraction instrument. Select the corresponding program, check the instrument status and extraction plate information, and then run the program. After the program is completed, remove the elution plate for DNA concentration and electrophoresis gel detection, and store it at 4°C. 2 μL of DNA stock solution was added to 2 μL of bromophenol blue for agarose gel electrophoresis. Gel concentration: 1%, Marker loading volume: 2 μL, voltage: 120 V, electrophoresis time: 20 min. The DNA electrophoresis gel image is shown below. Figure 1 As shown.

[0043] 2.2 PCR Primer Design

[0044] Based on the mRNA sequence of the catalase gene from Litopenaeus vannamei (GenBank: AY518322.1) obtained from NCBI (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), primers were designed to amplify the CDS region of the catalase gene. The primers were positioned upstream and downstream of the CDS region, and the design requirements were: primer length 18-22 bp, GC content 40-60%, Tm value 50-62℃, and the difference in Tm value between the upstream and downstream primers should not exceed 5. Primer dimers, hairpin structures, and mismatches were avoided as much as possible.

[0045] 2.3 Amplification Primers:

[0046] The primer sequences are as follows:

[0047] Lv-Cat-F(1-20):5'-TTGTTTGTGCTAAGATGAGG-3';

[0048] Lv-Cat-R(848-867): 5'-GAATGAAAATGTAAGTGGCA-3'.

[0049] The numbers in parentheses represent the positions of the nucleotides in the primers in the upstream and downstream sequences of the Catalase CDS region (the nucleotide sequences are shown in SEQ ID NO.2).

[0050] 2.4 PCR amplification system:

[0051] Table 2 PCR amplification system

[0052]

[0053] 2.5 PCR amplification reaction procedure:

[0054] Pre-denaturation at 95℃ for 2 minutes; denaturation at 95℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 30 seconds, for a total of 35 cycles; extension at 72℃ for another 10 minutes.

[0055] 2.6 PCR Product Analysis

[0056] Electrophoresis identification: To ensure the specificity of PCR amplification, after PCR amplification, 2 μL of PCR product is taken for agarose gel electrophoresis (1% concentration). The banding pattern of the PCR product is used to determine the specificity of the amplified product of each sample. This step is assumed to be random sampling. Figure 2 ).

[0057] Sanger sequencing: Based on the electrophoresis results of the PCR products, PCR products that meet the target fragment size were subjected to Sanger sequencing using an ABI 3730xLDNAAnalyzer sequencer.

[0058] 2.7 Screening of SNP loci and analysis of SNP genotypes

[0059] The sequencing peak diagrams of all amplified products were compared and analyzed to screen for SNP sites, and a total of 6 SNP sites were detected (see Table 3). The genotype frequencies of each SNP site in the nitrite stress resistant and non-resistant groups were tested using a non-parametric test (chi-square test) in SPSS 16.0, with a restriction threshold of P = 0.05. The results showed that the genotype of the SNP site at position 103 bp of the CDS region of the Lv-Cat F and Lv-Cat R primer amplification sequences differed significantly between the resistant and non-resistant Litopenaeus vannamei (P < 0.05). This SNP site is located at position 103 within the box starting from the 5' end of the sequence in SEQ ID NO.2. This SNP marker is a marker for Litopenaeus vannamei's resistance to nitrite. The boxed portion represents the CDS sequence (the SNP site is an underlined, bolded mixed base R, where R represents A or G), showing A / A homozygous, A / G heterozygous, and GG homozygous characteristics (peak diagrams are shown in Table 3). Figure 3 Three genotypes were identified, among which the A / A homozygous genotype was only detected in the resistance of Litopenaeus vannamei individuals under nitrite stress (Table 3), suggesting that the A / A homozygous genotype is the dominant genotype for resistance to nitrite stress. By applying this marker, a method for molecular marker-assisted breeding of Litopenaeus vannamei to resist nitrite was established, which can accelerate the breeding process of superior nitrite-resistant Litopenaeus vannamei varieties.

[0060] Table 3. SNP sites, genotypes, frequencies, and differential tests of SNP sites in Lv-Cat sequences.

[0061]

[0062] NR samples represent nitrite-resistant samples, NS samples represent samples not resistant to high nitrite stress, and the numbers in the second column represent SNPs.

[0063] Location of the site in the CDS region of the Lv-Cat sequence

[0064] SEQ ID NO.1 (nucleotide sequence of catalase gene in Litopenaeus vannamei)

[0065] TCCTTCTTCTGCAGCCTCAGTTGGACGTTCTAGGATATTTTACGTCTCTGTTTTCACCTCTAAATCTTCAAGATGCCGCGTGACAAGTGTGCAGAGCAATTGAATGACTTCAAGAAACAACAGACGGCTCCCGATAACCTGACCACGAGCCATGGGTGCCCACTTGCGGACAAGCTTAATTCCCTGACTGTAGGTCCAAGGGGCCCCATCCTCCTGCAGGACATTCA A

[0066] TTGTTTGTGCTAAGATGAGG GAATTTGTGCAGTGCTATTTACAGTATGCCATTCCAC AATGTCTCTA ATTCATCATGCTTGTTTTCTGCA

[0067] ACTAGTTGTTTAATTCTTATAACTTTTTTG

[0068] TTGGTATTGTCATATTACTATTATGATCATTATCACTGTCAACTTTATCTTTATCGTTATTGTT

[0069] ATTATTATTGTTATCTTTATCATTATCTTAATTTTTATTGCTGCCCTGACCAAGTGTATTAGA

[0070] ATTGGTATTATAAGTAGTGTTTATTARTCCGTGTTATCAATATTAGTATCGATATAATTATGAT

[0071] GATATATAGAGAGATGATACAAAGGCTAGAGAACTCAGGCTGTGTGAGTGGGATCAGGT

[0072] GGTATGaAACATGCAGATTGTTACTAATGAAATTCAATATATTTA

[0073] TAAGATATATGCAGTGGAAATTTTGAATGGGAATGAATTTGTAATTAAC

[0074] ATTTAGAATTTCATCTTTGTCAGAATCACACTAAGTGTTGTTCTGTGGAAAAAAATATTG

[0075] AAA TGCCACTTACATTTTCATTC ACTTACATTTTCATTCAACATCTCCTTACCGGGATGTG

[0076] TGAGGTGCT

[0077] The area enclosed in the box is the CDS region, R represents the SNP site, and the remaining sequences are the upstream and downstream sequences of the CDS.

Claims

1. The application of a SNP molecular marker of a gene related to nitrite resistance in Litopenaeus vannamei in distinguishing the nitrite resistance ability of Litopenaeus vannamei, characterized in that, The SNP molecular marker is located at the 193bp site of the sequence shown in SEQ ID NO.2, and the mutation types are A / A homozygous, G / G homozygous, and A / G heterozygous. The resistance to nitrite in Litopenaeus vannamei with the SNP molecular marker A / A homozygous genotype is significantly higher than that of G / G homozygous and A / G heterozygous genotypes.

2. The application of the detection primers for SNP molecular markers of nitrite resistance-related genes in Litopenaeus vannamei as described in claim 1 in distinguishing the nitrite resistance ability of Litopenaeus vannamei, characterized in that, Includes the following primers: Lv-Cat-F: 5'-TTGTTTGTGCTAAGATGAGG-3'; Lv-Cat-R: 5'-GAATGAAAATGTAAGTGGCA-3', The SNP molecular markers of Litopenaeus vannamei with the A / A homozygous genotype showed significantly higher resistance to nitrite than those with the G / G homozygous and A / G heterozygous genotypes.

3. The application of a detection kit in distinguishing the nitrite resistance of Litopenaeus vannamei, characterized in that, Primers for detecting SNP molecular markers of genes related to nitrite resistance in Litopenaeus vannamei as described in claim 2, wherein the SNP molecular markers are located at the 193bp site of the sequence shown in SEQ ID NO.2, and the mutation types are A / A homozygous, G / G homozygous, and A / G heterozygous. Litopenaeus vannamei with the A / A homozygous SNP molecular markers have significantly higher nitrite resistance than those with the G / G homozygous and A / G heterozygous genotypes.

4. The application of the SNP molecular marker described in claim 1, the detection primer described in claim 2, or the detection kit described in claim 3 in the individual identification, population selection, or maintenance of highly resistant strains of Litopenaeus vannamei with nitrite resistance in broodstock shrimp.

5. The use of the product with the SNP molecular marker described in claim 1 in the preparation of a reagent for distinguishing the ability of Litopenaeus vannamei to resist nitrite.

6. A method for breeding nitrite-resistant varieties of Litopenaeus vannamei, characterized in that, Includes the following steps: a. Extract genomic DNA from the Litopenaeus vannamei shrimp to be tested; b. Perform PCR amplification of the genomic DNA of the Litopenaeus vannamei to be tested using the detection primers Lv-Cat-F and Lv-Cat-R described in claim 2; c. Sequencing the amplified products to determine the genotype of the molecular SNP marker described in claim 1, and selecting individuals with A / A homozygous genotypes as backup parents for breeding nitrite-resistant varieties of Litopenaeus vannamei.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system includes: 15 μL of 2×TaqPCRMaster Mix, 2 μL of forward primer, 2 μL of reverse primer, 1 μL of DNA template, and the remainder is made up to 30 μL with sterile double-distilled water.

8. The method according to claim 6, characterized in that, The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 2 minutes; 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for a total of 35 cycles; 72℃ extension for 10 minutes.

Images