Functional molecular marker of sorghum grain weight gene HGW4 and application

Abstract

The invention belongs to the technical field of molecular biology and molecular genetic identification, and particularly relates to a functional molecular marker of a sorghum grain weight gene HGW4 and application. The invention provides a molecular marker HGW4 for identifying the sorghum grain weight gene HGW4, and also provides a method for identifying the sorghum grain weight gene HGW4 by using the molecular marker HGW4, and the gene marker can be used for distinguishing a small grain homozygous genotype, a large grain homozygous genotype and a heterozygous genotype of sorghum.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and molecular genetic identification technology, specifically relating to a functional molecular marker of the sorghum grain weight gene HGW4 and its application. Background Technology

[0002] Sorghum yield per unit area is a complex trait, mainly determined by three factors: grain weight, number of grains per spike, and number of spikes. The number of grains per spike and the number of spikes are easily affected by factors such as planting density, soil fertility, temperature, moisture, and light, exhibiting low heritability (Yang et al., 2013; Liu et al., 2016; Liu et al., 2023; Yi et al., 1998; Zhang et al., 1976; Wang et al., 2023). In contrast, grain weight is mainly controlled by genetic factors such as grain size, grain filling rate, and physiological maturity time, exhibiting high heritability and stable transmission across generations (Lu et al., 1999; Gao et al., 1997; Gebeyehou et al., 1982; Bruckner and Frohberg, 1987; Darroch and Baker, 1990; Heiniger et al., 1993; Wang et al., 1999). In the domestication and improvement of sorghum, grain size is the most intuitive indicator for grain weight selection. Larger grains not only mean a larger sink capacity, allowing for more nutrients and increased developmental space, but also enhance resistance and adaptability, thus leading to higher yields (Austin et al. 1996; Tao et al. 2018). Furthermore, larger grains have a significant impact on seed vigor, emergence, early growth, and quality traits (Harlan et al. 1972; Jakobsson and Eriksson 2000; Lee et al. 2002; Kriegshauser et al. 2006). Developing large-grain varieties and improving grain quality are important goals in high-yield sorghum breeding.

[0003] Traditional breeding relies primarily on phenotypic selection for grain weight traits. Environmental conditions, gene interactions, and genotype-environment interactions all influence phenotypic selection efficiency, often requiring 7-8 years or even more than a decade to develop a superior variety. Improving selection efficiency is crucial for breeding efforts. With the rapid development of molecular biology, breeders have realized that early identification of breeding materials using gene functional markers can significantly improve breeding efficiency. This is because functional markers are molecular markers based on phenotypic variations caused by changes in gene sequences, and they are completely linked to traits. Compared to traditional linked molecular markers and other types, functional markers offer significant advantages. They can more accurately estimate genetic diversity and genetic distance, and can quickly and accurately detect superior genes or dominant alleles and their traits in germplasm resources, thus guiding the selection of hybrid parents. They also enable rapid large-scale genotyping of parental materials and / or early selection of offspring genotypes, thereby accelerating the breeding process and demonstrating significant advantages in targeted improvement of genetic materials. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a functional marker for the sorghum grain weight gene HGW4 and its application.

[0005] To address the aforementioned technical problems, this invention provides a sorghum grain weight gene HGW4, the nucleotide sequence of which is as described in SEQ ID NO: 1.

[0006] As an improvement to the sorghum grain weight gene HGW4 of the present invention: the encoding nucleotide sequence (CDS sequence) of gene HGW4 is shown in SEQ ID NO.2.

[0007] This invention also provides a molecular marker, HGW4, for identifying the sorghum grain weight gene HGW4, using sorghum as the species. The primers for the molecular marker are selected from the following primer pairs.

[0008] HGW4-F 5'-3': CGACGATCATCATTGGACAATT;

[0009] HGW4-R 5'-3': GGGGCTACAATTAGGATAGGA.

[0010] This invention also provides a method for identification (sorghum grain weight gene HGW4) using the aforementioned molecular marker HGW4, comprising the following steps:

[0011] 1) Extract genomic DNA from the sorghum variety to be tested;

[0012] 2) PCR amplification of sorghum genomic DNA using the molecular marker HGW4;

[0013] 3) Electrophoresis detection:

[0014] The amplification products obtained in step 2) were subjected to gel electrophoresis and then stained to obtain an electrophoresis pattern;

[0015] 4) Results Analysis:

[0016] Analyze the electrophoresis image obtained in step 3). If it contains a 348bp characteristic band, it is a small grain sorghum material. If it is missing a 384bp characteristic band, it is a large grain material.

[0017] As an improvement to the identification method of the present invention:

[0018] The PCR amplification system consisted of a 20 μL reaction mixture, including 1 μL DNA template, 1 μL forward primer, 1 μL reverse primer, 10 μL PCR Mix, and 7 μL ddH2O.

[0019] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min, 95℃ for 1 min, 55℃ for 30 sec, 72℃ for 1 min, 35 cycles, 72℃ extension for 5 min; store at 4℃.

[0020] This invention develops functional molecular markers that can distinguish between small and large sorghum grains by targeting mutation sites in the HGW4 gene promoter regulatory sequence, making the pairing of breeding parent materials for this gene locus more targeted.

[0021] This invention utilizes this gene marker to distinguish between homozygous genotypes of small grains, homozygous genotypes of large grains, and heterozygous genotypes of sorghum. This marker can be used for marker-assisted breeding of sorghum grain size, providing a molecular-assisted means for targeted improvement of sorghum grain size, thereby accelerating the breeding process.

[0022] The technical solution of this invention is as follows: a functional molecular marker for the sorghum grain weight gene HGW4, wherein the encoding nucleotide sequence (CDS sequence) of the gene HGW4 is shown in SEQ ID NO.2. The nucleotide sequence of the gene HGW4 (the promoter sequence of HGW4) is shown in SEQ ID NO.1. Primers (HGW4-F, HGW4-R) for the functional molecular marker of this gene were designed, and their nucleotide sequences are shown in SEQ ID NO.3 (large-grain variety LTR108) and SEQ ID NO.4 (small-grain variety 654), located at 51,304,820 bp on chromosome 4 of sorghum.

[0023] The design principle of the HGW4 gene functional marker of this invention:

[0024] Step 1: Obtain the functional mutation sites causing phenotypic variations in the HGW4 gene and their corresponding gene coding sequences. These functional nucleotide mutation sites may be located in promoter regulatory sequences or within the gene's coding sequence. This is because promoter regulatory sequences affect the transcriptional level of the gene, while changes in the coding region alter the amino acid types during translation, thus affecting protein structure and function. This invention demonstrates that the CDS sequences of the small-grain sorghum variety 654 and the large-grain variety LTR108 contain base substitutions at positions 89, 204, 207, 209, and 617 bp. After translation into protein, these substitutions result in only three amino acid differences, and it has been preliminarily confirmed that these mutation sites are not related to grain weight phenotype.

[0025] Step 2: The 2.5 kb promoter region sequence upstream of the HGW4 gene translation initiation site in the sorghum reference genome BTx623 was extracted (SEQ ID NO.1). Seven pairs of primers were designed, and amplification, sequencing, sequence assembly, and alignment were performed using DNA from the small-grain variety 654 and the large-grain variety LTR108 as templates. It was found that LTR108 had a 348 bp deletion in the promoter regulatory sequence 696 bp upstream of the coding region, while the promoter sequence of 654 was basically identical to that of the sorghum reference genome BTx623. Figure 2 As shown.

[0026] Step 3: Based on the 348 bp insertion / deletion in the promoter region of the small-grained variety 654 and the large-grained variety LTR108, a pair of specific functional molecular marker primers were designed to identify materials with different seed sizes on a 2% agarose gel. Figure 3 As shown.

[0027] In summary, this invention utilizes forward genetics to clone a gene, HGW4, affecting grain weight on chromosome 4. Sequence analysis revealed a 348 bp insertion / deletion in the promoter regulatory sequence 696 bp upstream of the coding region in both small- and large-grain varieties. Correlation analysis showed a significant association between this insertion / deletion and grain weight. Currently, there are no clear reports on this gene affecting grain weight or its variant sites, preventing its utilization in breeding.

[0028] The present invention has the following beneficial effects:

[0029] 1. Currently, there are no reported molecular markers closely linked to grain weight on sorghum chromosome 4, nor are there any reported gene markers for sorghum HGW4, and even fewer reports on using marker-assisted breeding methods to select large-grain sorghum varieties. Therefore, this invention develops a functional marker targeting the 348 bp insertion / deletion mutation site in the HGW4 gene promoter sequence to distinguish between homozygous genotypes of small-grain, homozygous, and heterozygous genotypes in sorghum. This marker can be used for marker-assisted breeding of sorghum grain weight, providing a molecular-assisted means for the targeted improvement of sorghum grain size, thereby accelerating the breeding process.

[0030] 2. Based on the insertion and deletion of the HGW4 gene sequence that causes sorghum grain size, this invention designs a functional marker, namely two primers: HGW4-F and HGW4-R, to amplify the DNA of the sorghum leaves to be tested. The amplified products can then be analyzed by electrophoresis to detect homozygous genotypes of small grains, large grains, and heterozygous genotypes. Therefore, the functional marker of the HGW4 gene in this invention can be used for marker-assisted breeding of sorghum, providing a molecular-assisted method for targeted improvement of sorghum grain size.

[0031] This invention also provides a sorghum grain weight gene. HGW4 Uses: To adjust the grain weight, grain width and grain length of sorghum.

[0032] According to the sorghum grain weight gene of the present invention HGW4 Improved applications: Overexpression increases thousand-grain weight, grain width, and grain length. Attached Figure Description

[0033] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0034] Figure 1 For fine mapping and candidate gene identification of QTL qHGW4;

[0035] Figure 1 middle:

[0036] A: High-resolution physical map of the qHGW4 fine-mapping region, with chromosome numbers indicating marker names. The table on the right shows the number of recombinant single plants and the thousand-grain weight for each group.

[0037] B: Six genes between INDEL2-1 and INDEL2-2.

[0038] Figure 2 Sequence alignment of the 654 and LTR108 promoter subregions.

[0039] The images show the alignments of the reference promoter sequence SEQ ID NO.1 for sorghum BTx623, the promoter sequence SEQ ID NO.3 for large-grain sorghum variety LTR108, and the promoter sequence SEQ ID NO.4 for small-grain sorghum 654. The red box indicates the missing 348bp sequence in LTR108.

[0040] Figure 3 To detect insertion and deletion molecular markers in the HGW4 promoter sequence and analyze the significant differences between them and the particle weight phenotype.

[0041] Figure 4 Identification of HGW4 overexpressing plants in the T1 generation.

[0042] Figure 5 The results of the T1 representative analysis of HGW4 overexpressing plants are shown. Detailed Implementation

[0043] The specific embodiments of the present invention will be described below with reference to the accompanying drawings and examples. However, the following examples are only used to illustrate the present invention in detail and do not limit the scope of the present invention in any way.

[0044] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents and test materials involved are all commercially available conventional reagents and test materials; unless otherwise specified, the test methods involved are all conventional methods.

[0045] Example 1: Localization and cloning of sorghum grain weight HGW4

[0046] Using small-grain sorghum variety 654 (female parent) and large-grain sorghum variety LTR108 (male parent) as parents, F1 was obtained by hybridization. F1 was then self-crossed to obtain F2, and single-grain lines were passed to F10 to obtain a recombinant inbred line population.

[0047] Using this population, a major-effect QTL affecting grain weight was repeatedly detected on chromosome 4. Fine mapping and cloning of this QTL were performed (e.g., ...). Figure 1 (As shown).

[0048] according to Figure 1 From this, we can conclude that:

[0049] The major QTL locus of this invention is located on a DNA segment of chromosome 4, named HGW4, with a genetic distance of 67.83-90.33 cM and a physical distance of 47.15-52.95 Mb. Using a high-generation backcross segregating population and a dense marker interval, this major QTL was located between INDEL2-1 and INDEL2-2, within a range of 63 kb. Six genes, Sobic.004G163300, Sobic.004G163350, Sobic.004G163400, Sobic.004G163500, Sobic.004G163600, and Sobic.004G163700, were found within this range. Differentially expressed genes within the 654 and LTR108 target intervals were analyzed, and Sobic.004G163700 was preliminarily identified as a possible candidate gene. Functional verification of this gene was then performed.

[0050] Example 2: Method for identifying the sorghum grain weight gene HGW4 using the molecular marker HGW4-1:

[0051] The primers for the molecular markers are selected from the following primer pairs:

[0052] HGW4-F 5'-3': CGACGATCATCATTGGACAATT

[0053] HGW4-R 5'-3': GGGGCTACAATTAGGATAGGA

[0054] Includes the following steps:

[0055] Step 1: Extract total DNA from leaves of the sorghum variety to be tested:

[0056] Total DNA was extracted from the leaves of the sorghum variety to be tested using CTAB. The specific steps are as follows:

[0057] (1) Take 100 mg of fresh leaves into a 1.5 mL centrifuge tube and grind them rapidly with liquid nitrogen;

[0058] (2) Add 600 μL of CTAB preheated at 65 °C and mix well. Place in a 65 °C oven for pyrolysis for 1 h, shaking and mixing 2-3 times during the process.

[0059] (3) Add 600 μL of chloroform and mix thoroughly.

[0060] (4) Centrifuge at 11,000 rpm for 10 min, and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0061] (5) Add an equal volume of isopropanol and mix well;

[0062] (6) Centrifuge at 1,000 rpm for 10 min and discard the supernatant;

[0063] (7) Wash the precipitate with 500 μL of 75% ethanol solution;

[0064] (8) Centrifuge at 11,000 rpm for 5 min, discard 75% ethanol, and air dry for 15~30 min.

[0065] (9) Dissolve the air-dried DNA in 300 μL of sterilized ddH2O and store it in a refrigerator at 4 ℃ for later use.

[0066] Step 2, PCR amplification:

[0067] Using the DNA obtained in step 1 as a template, PCR amplification was performed using the functional marker primer set of HGW4 to obtain the amplification product;

[0068] The PCR amplification system consisted of a 20 μL reaction volume, including 1 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 10 μL PCR Mix, and 7 μL ddH2O.

[0069] The PCR amplification program was as follows: 95 ℃ pre-denaturation for 5 min, 95 ℃ for 1 min, 55 ℃ for 30 s, 72 ℃ for 1 min, 35 cycles, 72 ℃ extension for 5 min; store at 4 ℃.

[0070] Step 3, Electrophoresis Detection:

[0071] The amplification products obtained in step 2 were subjected to gel electrophoresis and then stained to obtain an electrophoresis image;

[0072] Step 4, Result Analysis:

[0073] Analyze the electrophoresis pattern obtained in step 3. If the amplification product contains a 348bp characteristic band, it is a small-grain sorghum material. If the amplification product lacks a 384bp characteristic band, it is a large-grain material. If the amplification product contains both of these characteristic bands, it is an intermediate type material.

[0074] Experiment 1: Using 103 sorghum germplasm resources preserved in our laboratory as experimental materials, the methods described in Example 2 were used for testing, and the grain weight of these varieties was measured. The results are shown in Table 1 below:

[0075] Table 1. Genotypes and grain weight expression of 103 sorghum germplasm resources

[0076] Sorghum germplasm resource name The presence or absence of a 384bp feature band genotype The result obtained according to the determination criteria of this invention 1000 grains weight ICSH31 yes 1 Small particles 24.88 QR163 yes 1 Small particles 24.80 QR110 yes 1 Small particles 23.88 IS-4776 yes 1 Small particles 23.04 IS-7521 yes 1 Small particles 23.35 IS-5057 yes 1 Small particles 25.57 IS-9333 yes 1 Small particles 21.84 IS-10886 yes 1 Small particles 22.58 IS-642 yes 1 Small particles 19.91 ICSR151 yes 1 Small particles 20.87 ICSV-107 yes 1 Small particles 19.84 ICSV-133 yes 1 Small particles 25.57 ICSV-138 yes 1 Small particles 20.16 HAGEENDYRA yes 1 Small particles 24.16 IS-0114 yes 1 Small particles 25.07 IS-0135 yes 1 Small particles 22.29 IS-8330 yes 1 Small particles 25.06 IS-8337 yes 1 Small particles 24.18 Qingkeyang yes 1 Small particles 21.20 Qian Gao No. 9 yes 1 Small particles 19.46 Baiyun local sorghum yes 1 Small particles 18.86 Draft Snow Sorghum yes 1 Small particles 20.97 sorghum yes 1 Small particles 19.76 Sticky sorghum yes 1 Small particles 16.95 Local sorghum yes 1 Small particles 17.72 Tunpo sorghum yes 1 Small particles 21.83 Zhongzhai Sorghum yes 1 Small particles 24.30 Red sorghum yes 1 Small particles 21.54 sorghum yes 1 Small particles 21.78 Diji sorghum yes 1 Small particles 16.52 Daping Sorghum yes 1 Small particles 17.65 Tiger Leap Slope Dwarf Sorghum yes 1 Small particles 22.19 Glutinous sorghum yes 1 Small particles 24.37 R040 yes 1 Small particles 25.23 R047 yes 1 Small particles 22.84 R177 yes 1 Small particles 21.03 R183 yes 1 Small particles 20.66 R250 yes 1 Small particles 22.91 R355 yes 1 Small particles 21.33 R477 yes 1 Small particles 25.98 R555 yes 1 Small particles 24.88 A19528 no 2 Large grains 26.89 D71246 no 2 Large grains 26.77 Ze20 no 2 Large grains 28.69 ICSB40 no 2 Large grains 32.49 ICSR88002 no 2 Large grains 26.70 M-60338 no 2 Large grains 27.65 SPV472 no 2 Large grains 26.35 TAM-428 no 2 Large grains 26.38 R1791 no 2 Large grains 27.48 ICSB18 no 2 Large grains 27.31 ICSB37-1 no 2 Large grains 34.36 ICSB38 no 2 Large grains 30.26 ICSB40 no 2 Large grains 31.52 ICSB50 no 2 Large grains 28.65 CSH17 no 2 Large grains 27.51 ICSB70 no 2 Large grains 28.07 CSV-4 no 2 Large grains 38.17 ICSB75 no 2 Large grains 29.91 ICSB82 no 2 Large grains 30.27 ICSB83 no 2 Large grains 26.46 ICSB86 no 2 Large grains 42.52 ICSB87 no 2 Large grains 30.30 ICSB88 no 2 Large grains 32.58 ICSB89 no 2 Large grains 35.94 ICSB97 no 2 Large grains 29.21 ICSB98 no 2 Large grains 30.90 ICSB99 no 2 Large grains 27.18 ICSB100 no 2 Large grains 30.88 ICSB101 no 2 Large grains 28.04 ICSB102 no 2 Large grains 29.29 ICSH4 no 2 Large grains 26.34 ICSH6 no 2 Large grains 32.57 ICSH18 no 2 Large grains 28.57 ICSH19 no 2 Large grains 32.36 ICSV-108 no 2 Large grains 31.77 ICSV 111 no 2 Large grains 31.89 ICSV-126 no 2 Large grains 29.57 ICSV-137 no 2 Large grains 35.27 ICSV-155 no 2 Large grains 27.39 ICSV-189 no 2 Large grains 32.77 ICSV-191 no 2 Large grains 27.18 ICSV 210 no 2 Large grains 26.55 ICSV 219 no 2 Large grains 27.39 ICSB52 no 2 Large grains 39.60 ICSB54-1 no 2 Large grains 28.12 ICSB56 no 2 Large grains 26.82 ICSB73 no 2 Large grains 29.54 ICSV-120 no 2 Large grains 29.96 ICSV-149 no 2 Large grains 29.19 Drougt 11 no 2 Large grains 28.63 Drougt 14 no 2 Large grains 29.03 Dwarf Feterita no 2 Large grains 28.00 IS-0223 no 2 Large grains 27.99 IS-0416 no 2 Large grains 29.49 IS-0508 no 2 Large grains 28.63 IS-0835 no 2 Large grains 31.66 IS-1232 no 2 Large grains 28.93 IS-1291 no 2 Large grains 28.93 IS-2246C no 2 Large grains 39.58 IS-6418C no 2 Large grains 32.96 IS-6710C no 2 Large grains 36.23 IS-8309 no 2 Large grains 32.40

[0077] Note: In this industry, it is generally assumed that when the weight of 1000 grains is ≥26 grams, it is considered a large grain, and vice versa.

[0078] This invention performs correlation analysis between the detection results and particle weight, and the results show that the marker and particle weight are co-separated. For example... Figure 3 As shown.

[0079] Experiment 2: Application of the sorghum grain weight gene HGW4 (transgenic experiment):

[0080] To verify the effect of the HGW4 gene on sorghum grain weight, this invention constructed a p1301-GFP-HGW4 overexpression vector, which was then transformed into the recipient sorghum variety P184 using Agrobacterium-mediated transformation. In the T1 generation of overexpressing plants, we identified an overexpressing line HGW4-OE (… Figure 4 (A). RT-qPCR was used to detect the relative expression level of the HGW4 gene in the leaves of positive plants. The results showed that the expression level of the HGW4 gene in the leaves of the T1 generation overexpressing positive plant HGW4-OE was 107 times that in the negative control HGW4-CK. Figure 4 Data from the B) comparison of the positive overexpression line HGW4-OE and the negative control line HGW4-CK showed that, compared with the negative control, the thousand-grain weight, grain width, and grain length of the overexpression line HGW4-OE were significantly increased. Figure 5 ).

[0081] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. A sorghum grain weight gene HGW4 characterized in that: The nucleotide sequence of the gene HGW4 is shown as SEQ ID NO:

1.

2. The grain weight gene of sorghum of claim 1 HGW4 characterized in that The nucleotide sequence encoding the amino acid sequence of the gene HGW4 is shown as SEQ ID NO.

2.

3. Identification of a sorghum grain weight gene HGW4 with molecular markers HGW4 using sorghum as the species, characterized by: The molecular marker primer is selected from the following primer pairs, HGW4-F 5' -3': CGACGATCATCATTGGACAATT HGW4-R 5' - 3': GGGGCTACAATTAGGATAGGA.

4. Use of a molecular marker as claimed in claim 3 HGW4 The identification method performed, characterized in that The method comprises the following steps: 1) Extracting the genomic DNA of the to-be-tested sorghum variety; 2) using molecular markers HGW4 PCR amplification of sorghum genomic DNA; 3) Electrophoresis detection: The amplified product obtained in step 2) is subjected to gel electrophoresis, and then is dyed to obtain an electrophoretogram; 4) Result analysis: The electrophoretogram obtained in step 3) is analyzed, and if the characteristic band is contained, it is a small-grain sorghum, and if the characteristic band is missing, it is a large-grain sorghum.

5. The identification method according to claim 4, characterized in that: The PCR amplification system is 20 μL of reaction system, including 1 μL of DNA template, 1 μL of forward primer, 1 μL of reverse primer, 10 μL of PCR Mix, and 7 μL of ddH2O; The PCR amplification procedure is: 95℃ pre-denaturation for 5 min, 95℃ for 1 min, 55℃ for 30 sec, 72℃ for 1 min, 35 cycles, 72℃ extension for 5 min, and 4℃ storage.

6. Use of a sorghum grain weight gene HGW4 characterized in that Adjusting the grain weight, grain width and grain length of sorghum.

7. The grain weight gene of Sorghum bicolor of claim 6 HGW4 for use, characterized in that Overexpression increases the thousand-grain weight, grain width and grain length.

Images