A kasp marker cc-1-kasp-147 closely linked to corn cob color and application thereof

Abstract

This invention relates to the field of plant molecular breeding technology, specifically to a Kasp marker CC-1-KASP-147 closely linked to maize cob color and its application. The SNP locus corresponding to the Kasp marker is located at position 47834083 on maize chromosome 1, with a polymorphism of C / A. The primer set includes forward primer 1, forward primer 2, and reverse primer. The identification method involves extracting maize genomic DNA, performing PCR amplification using this primer set, and performing KASP genotyping on the amplified products. Genotypes are determined by clustering relative fluorescence values: C / C homozygous genotype corresponds to a white cob, A / A homozygous genotype corresponds to a pink or red cob, and C / A heterozygous genotype corresponds to a white, pink, or red cob. This invention has been validated in multiple environments, and the genotyping results show 100% agreement with the cob color phenotype. It eliminates the need for gel electrophoresis, can be detected at the seedling stage, significantly shortening the breeding cycle. It provides an efficient molecular auxiliary tool for the directional improvement of maize cob color and the breeding of mechanized grain-harvesting varieties, and has significant practical value.

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding technology, and more specifically, to a Kasp marker CC-1-KASP-147 closely linked to the color of maize ears and cob, and its application. Background Technology

[0002] In recent years, the proportion of red-cob maize hybrids promoted in China has been steadily increasing (from 50% to over 80%), especially among new varieties suitable for mechanized grain harvesting, where it accounts for as much as 94%, indicating that red cob has become an important target for artificial selection. Maize cob color is an important and intuitive indicator affecting dehydration rate and adaptability to mechanized harvesting. Studies show that red-cob hybrids dehydrate faster and have significantly lower moisture content at harvest than white-cob varieties, making them more suitable for mechanized grain harvesting. This is mainly related to the shorter vegetative growth period, superior plant morphology (taller plant height, lower leaf area index), and stronger nitrogen absorption and distribution capacity of red-cob varieties. These characteristics collectively promote field ventilation and light penetration, as well as grain moisture loss. Cob color can serve as an effective indicator for breeding maize varieties suitable for mechanized harvesting.

[0003] Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation in the genome, characterized by their large number, wide distribution, and genetic stability, making them an ideal tool for marker-assisted breeding. With the rapid development of high-throughput sequencing technology and the significant reduction in cost, SNP sites can be efficiently and accurately identified by directly sequencing and comparing specific genes or fragments from different individuals. This provides technical support for large-scale screening of gene variations associated with target traits and promotes the widespread application of SNP markers in crop trait genetic research.

[0004] Competitive allele-specific PCR (KASP) is a PCR-based biallelic genotyping technique. Originally designed for SNP genotyping, its principles are equally applicable to genotyping of stable polymorphic markers such as insertions / deletions. This technique eliminates the need for gel electrophoresis, determining genotypes solely through fluorescence signals. It boasts significant advantages such as high throughput, high precision, and low cost, and is currently widely used in genetic mapping, gene localization, trait association analysis, and breeding material screening, becoming one of the core genotyping platforms for SNP-based genetic research.

[0005] Although SNP markers and KASP technology have been applied in crop breeding, no specific KASP marker closely linked to the key trait of maize cob color has yet been developed. Traditional screening for maize cob color relies on phenotypic observation at maturity, which suffers from problems such as long cycle time, low efficiency, and high subjectivity, making it difficult to meet the needs of targeted and rapid breeding. Therefore, developing specific molecular markers closely linked to maize cob color and establishing efficient and accurate identification methods are of great significance for accelerating the genetic improvement of maize cob color and breeding new maize varieties adapted to mechanized grain harvesting. Summary of the Invention

[0006] The purpose of this invention is to provide a Kasp marker CC-1-KASP-147 closely linked to maize cob color and its application, in order to solve the problems mentioned in the background art that traditional maize cob color screening relies on phenotypic observation at maturity, which has the problems of long cycle, low efficiency and strong subjectivity.

[0007] To achieve the above objectives, the present invention provides a Kasp marker CC-1-KASP-147 that is closely linked to the color of maize cob, including a specific SNP site and a corresponding KASP molecular marker primer set; The SNP site is located at position 47834083 on chromosome 1 of maize, and the polymorphism is C / A; The KASP is labeled CC-1-KASP-147, and the corresponding primer set includes forward primer 1, forward primer 2, and reverse primer; The sequence of forward primer 1 is GAAGGTGACCAAGTTCATGCTACAAGACCGTCTCAACACAACA, the sequence of forward primer 2 is GAAGGTCGGAGTCAACGGATTCAAGACCGTCTCAACACAACC, and the sequence of the reverse primer is AAGAGGAATCTCCTGCCATTAGT. The significance of the association between the KASP marker and the color of the maize ear cob is calculated using the following formula, and the marker effect value is determined using the following formula: ; ; In the above two formulas, This is the chi-square test statistic. This represents the number of actual observed ear cob color phenotypes corresponding to the i-th genotype. denoted as , where is the theoretical expected number of the rachis color phenotype corresponding to the i-th genotype, and i corresponds to A / A homozygous, C / A heterozygous, and C / C homozygous, respectively; ME is the marker effect value. The mean values ​​of cob color-related phenotypes in A / A homozygous maize are given. The mean values ​​of cob color-related phenotypes for C / C homozygous maize are given.

[0008] Preferably, the concentrations of forward primer 1 and forward primer 2 are independently 4 to 10 μmol / L, and the concentration of the reverse primer is 4 to 10 μmol / L. The concentration range is suitable for PCR reaction systems of different sizes, such as 10 μL, 20 μL, and 50 μL. When the reaction system is expanded or reduced by a factor of 1, the primer concentration is adjusted synchronously in proportion to ensure that the molar ratio of primer to template DNA is maintained between 1:5 and 1:10.

[0009] Preferably, the volume ratio of forward primer 1, forward primer 2, and reverse primer in the primer set is 2:2:5. The volume ratio is determined based on the difference in primer Tm values ​​and optimization of binding efficiency. The Tm values ​​of forward primer 1 and forward primer 2 are both 60℃ to 62℃, and the Tm value of the reverse primer is 58℃ to 60℃. This volume ratio can ensure the balance of competitive binding of the three primers in the PCR reaction. When preparing the primer mix, take 6μL of forward primer 1, 6μL of forward primer 2, and 15μL of reverse primer according to the above volume ratio, add 23μL of ddH2O and mix well to form a 50μL primer mix for later use.

[0010] Preferably, the effectiveness of the KASP marker is verified through multi-environment phenotypic effects, and the phenotypic contribution rate of the marker is calculated using the following formula during the verification process: ; In the formula, The phenotypic contribution rate is given by m, where m is the number of experimental environments and m ≥ 3, and p is the number of maize materials in each environment. The actual cob color phenotypic value of the k-th material in the j-th environment. The values ​​for ear color phenotype predicted based on KASP marker genotypes are as follows: The mean cob color phenotype of all materials in all environments, with the phenotype contributing no less than 85%.

[0011] On the other hand, the present invention also provides an application of the above-mentioned KASP marker CC-1-KASP-147 in screening corn with different cob colors. The method of using the KASP marker CC-1-KASP-147 to screen corn with different cob colors includes the following steps: Step 1: Extract genomic DNA from maize samples; Step 2: Using the genomic DNA as a template, perform PCR amplification using the primer set to obtain the amplification product; Step 3: Perform KASP genotyping on the amplified products, calculate the relative fluorescence value using the following formula, and perform clustering based on the relative fluorescence value to determine the genotype; Step 4: Identify the cob color of maize based on genotype and screen for maize with the target cob color; The formula for calculating the relative fluorescence value is: ; ; In the above two formulas, The relative fluorescence value of FAM. The measured fluorescence value is for the FAM channel. The fluorescence value of the ROX reference dye; The relative fluorescence value is HEX. The values ​​represent the measured fluorescence values ​​from the HEX channel. Genotype determination rules are as follows: a single FAM fluorescence signal indicates A / A homozygous genotype; a single HEX fluorescence signal indicates C / C homozygous genotype; and the coexistence of both fluorescence signals indicates C / A heterozygous genotype. The cob color identification rules are: A / A homozygous genotype corresponds to pink or red cob, C / C homozygous genotype corresponds to white cob, and C / A heterozygous genotype corresponds to white, pink, or red cob. The concordance between genotype and cob color phenotype during screening is verified using the following formula: ; In the formula, C represents the degree of fit. This represents the number of samples whose genotype determination results match the actual ear color phenotype. For the total number of samples tested, the conformity rate shall not be less than 99%.

[0012] Preferably, the PCR amplification reaction system in step 2, in 10 μL increments, includes 2 μL of maize genomic DNA, 0.14 μL of primer set, 5 μL of 2x Probe Mix A solution, and the remainder ddH2O; the concentration of the maize genomic DNA is 50 to 100 ng / μL, and the DNA purity must meet the requirements of an OD260 / OD280 ratio between 1.8 and 2.0, and an OD260 / OD230 ratio not less than 1.5; the 2x Probe Mix A solution contains hot-start Taq enzyme, dNTPs, and Mg... 2+ FAM fluorescently labeled probe, HEX fluorescently labeled probe and PCR buffer, wherein Mg 2+ The concentration of the active ingredient was 2.0 to 2.5 mmol / L, and the concentration of dNTPs was 0.2 to 0.3 mmol / L; the balance ddH2O was enzyme-free sterile water, which was filtered through a 0.22 μm filter membrane to avoid nuclease contamination.

[0013] Preferably, the PCR amplification reaction program in step 2 is as follows: First stage: pre-denaturation at 95℃ for 10 min, used to activate the hot-start Taq enzyme and completely unwind the maize genomic DNA; Second stage: denaturation at 95℃ for 20 s, annealing at 61℃ for 40 s, for a total of 10 cycles, with the annealing temperature gradually decreasing to 56℃ in a 0.5℃ gradient per cycle; Third stage: denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 31 cycles, with the annealing temperature matching the Tm value range of the primer set to ensure specific primer binding; Fourth stage: holding at 25℃ for 10 min, used to terminate the reaction and stabilize the product; After the reaction, the amplified product can be stored at 4℃ for a short period, not exceeding 72 hours.

[0014] Preferably, the genomic DNA extraction in step 1 is performed using the CTAB method. The specific steps are as follows: Weigh 1.0g of fresh corn leaves, cut them into small pieces, grind them into powder using liquid nitrogen, add 3mL of 1.5×CTAB and grind into a homogenate, transfer to a 15mL centrifuge tube, rinse the mortar with 1mL of 1.5×CTAB and transfer to the same centrifuge tube, incubate at 65℃ for 30min while gently shaking occasionally; after cooling to room temperature, add an equal volume of chloroform-isoamyl alcohol mixture (chloroform to isoamyl alcohol volume ratio 24:1), gently invert the centrifuge tube to mix until the lower layer turns dark green; centrifuge at 4200rpm for 10min, transfer the upper aqueous phase to a new 15mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, gently mix and let stand for 5min, then place in a -20℃ freezer for 30min to precipitate the DNA; centrifuge at 4200rpm for 10min, discard the supernatant, and add 1mL of... Wash the precipitate once with 75% ethanol, invert the centrifuge tube to air dry the DNA at room temperature, and add 50 μL of TE buffer to dissolve the DNA. The pH of the TE buffer is 8.0.

[0015] As a preferred option, after screening for maize with the target cob color in step 4, a breeding step is also included: selecting the screened target maize as parents, where red or pink cob parents are selected from individuals with the A / A homozygous genotype, and white cob parents are selected from individuals with the C / C homozygous genotype; artificial pollination is performed using conventional hybridization techniques to obtain F1 generation seeds and plant them; genomic DNA is extracted from the leaves during the F1 generation seedling stage, and the detection and screening in steps 1 to 4 are repeated to retain individuals with the C / A heterozygous genotype; the F1 generation heterozygous individuals are used as female parents and backcrossed with the target cob color parents to obtain BC1F1 generation seeds; genotyping is performed on the BC1F1 generation seeds after planting, and individuals carrying the target allele are retained. After 3 to 5 generations of backcrossing and self-pollination purification, a stable genetically inherited target cob color maize inbred line is cultivated.

[0016] Preferably, the maize samples include one or more of maize inbred lines, maize hybrids, and maize DH lines; maize inbred line samples are suitable for homozygous genotype screening and breeding material purification, maize hybrid samples are suitable for F1 generation ear cob color prediction and seed purity detection, and maize DH line samples are suitable for genetic stability verification and marker effect analysis; the sample collection site is fresh leaves from the maize seedling stage to maturity, with a sample size of not less than 0.5g, and after sampling, it needs to be frozen at -80℃ or DNA extraction should be performed immediately to avoid nucleic acid degradation; the application covers maize samples from different planting seasons such as spring sowing, summer sowing, and autumn sowing, and is suitable for the ecological environment of different major maize producing areas such as Heilongjiang, Jilin, Shandong, and Henan.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention, for the first time, clearly establishes the close linkage between the SNP locus at position 47834083 on maize chromosome 1 and cob color. The developed KASP marker CC-1-KASP-147 and its specific primer set exhibit strong targeting, accurately distinguishing between the A / A, C / C, and C / A genotypes. The chi-square test is used to quantify the significance of the association between the marker and cob color, and Euclidean distance clustering is employed to achieve objective genotype determination. Combined with relative fluorescence value standardization, the consistency of the genotyping results reaches 100%, significantly improving the accuracy and reliability of cob color identification. Compared to traditional phenotypic observation methods, this technology eliminates the need to wait for maize maturity; detection can be completed at the seedling stage through DNA extraction and PCR amplification. Furthermore, it eliminates the need for gel electrophoresis, relying on fluorescence signals for high-throughput genotyping, significantly reducing detection costs and operational complexity, and solving the problems of long cycles, high subjectivity, and low efficiency associated with traditional methods.

[0018] 2. The technical solution of this invention provides a powerful molecular-assisted tool for directional breeding of maize cob color. By combining conventional hybridization, backcrossing, and KASP marker screening, individuals with the target genotype can be rapidly preserved. Stable maize inbred lines with the target cob color can be cultivated in 3 to 5 generations, significantly shortening the breeding cycle and improving germplasm selection efficiency. This marker and its application are compatible with various material types, including maize inbred lines, hybrids, and DH lines, meeting diverse breeding needs such as homozygous genotype screening, F1 generation cob color prediction, and seed purity detection. It also covers different planting seasons, including spring, summer, and autumn sowing, and is suitable for the ecological environments of several major maize-producing areas, such as Heilongjiang, Jilin, Shandong, and Henan, demonstrating broad applicability. Furthermore, the primer concentration, reaction system, and amplification program have been systematically optimized to flexibly adapt to different reaction system specifications, such as 10μL, 20μL, and 50μL, facilitating application by different breeding units according to their actual needs.

[0019] 3. This invention precisely aligns with the current industrial development trend of mechanized corn grain harvesting. The characteristics of red-cob corn—rapid dehydration and low harvest moisture content—have become core breeding objectives. This invention can selectively breed red-cob or white-cob corn varieties, providing key technical support for cultivating new corn varieties adapted to mechanized harvesting, and is of great significance for promoting the large-scale and efficient development of the corn industry. From a theoretical perspective, the localization of this SNP locus and the development of the KASP marker enrich the molecular genetic marker resources related to corn cob color, providing important evidence for in-depth research on the genetic mechanism of corn cob color. From a practical perspective, the phenotypic contribution rate of the marker is no less than 85%, and it has been validated in three locations and multiple environments, demonstrating strong stability and reproducibility. It can be directly applied to breeding practices and germplasm resource screening, reducing the blind spots in breeding. Furthermore, the industrial application of this technology can provide corn breeding units with efficient and precise technical solutions, possessing broad technology transfer and commercialization prospects, and contributing to the upgrading and iteration of corn breeding technology. Attached Figure Description

[0020] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are explained in detail together with the embodiments of the invention, but do not constitute a limitation thereof.

[0021] Figure 1 This is a normal distribution diagram of the maize ear cob color trait according to an embodiment of the present invention; Figure 2 This is a chromosome distribution diagram of SNP markers according to an embodiment of the present invention; Figure 3 The Manhattan plot and QQ plot are shown in the genome-wide association analysis of maize cob color in this embodiment of the invention. Figure 4 This invention provides an embodiment based on resequencing data analysis of the phenotypic effect of allelic variation at the SNP site Chr1:47834083 on the ear cob color. Figure 5 The results of KASP molecular marker typing for maize cob color in Example 465 of this invention; Figure 6 This invention provides an embodiment based on KASP data analysis of the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 on the ear axis color. Detailed Implementation

[0022] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] The purpose of this invention is to provide a SNP locus for identifying maize cob color, a KASP molecular marker primer set, and their applications, enabling rapid screening and identification of maize cob color traits and improving the breeding efficiency of maize germplasm with different cob colors. The invention provides an SNP locus for identifying maize cob color traits, located on maize chromosome 1 at 47834083, with a polymorphism of A / C. Furthermore, it provides a KASP molecular marker primer set for identifying the aforementioned SNP locus, including forward primer 1 with the sequence CC-1-KASP-147F1, forward primer 2 with the sequence CC-1-KASP-147F2, and reverse primer with the sequence CC-1-KASP-147R.

[0024] The SNP locus provided by this invention is located at position 47834083 on chromosome 1 of maize, with a polymorphism of C / A. When the base is C / C, the maize cob color is white; when the base is A / A, the maize cob color is pink or red; and when the base is C / A, the maize cob color is white, pink, or red. This SNP locus can be used to distinguish different maize cob colors.

[0025] This invention uses a KASP molecular marker primer set to select for maize cob color traits. The identification of samples can be completed simply by DNA extraction, PCR-specific amplification, and KASP genotyping detection, yielding maize with pink or red cobs. This molecular marker is effective in identifying maize cob color. Using the molecular marker-assisted selection of this invention can improve the efficiency of red maize germplasm breeding, provide a basis for utilizing superior allelic variations related to maize cob color, and accelerate the breeding process.

[0026] This invention utilizes 465 phenotypically diverse and representative DH lines, planted in 2025 in experimental fields at Guangxing Village, Yangshu Street, Acheng District, Harbin City (126°53′8.73″E, 45°29′39.88″N), Huojian Town, Wangkui County, Suihua City, Harbin City (126°20′23″E, 46°35′34″N), and Changfu Village, Liming Town, Zhaodong City, Harbin City (125°22′28″E, 45°11′24″N). Each material was planted in two rows, 2.5m long. The 21 main agronomic and yield traits were investigated according to standards, and data on traits such as cob color were recorded and compiled. After 5* genome resequencing of each material, the genome was assembled by comparison with a reference genome to obtain SNP polymorphic markers. GWAS association analysis of multi-site cob color trait data identified major SNPs. Candidate genes with the same location in three different locations were screened, and major SNPs were found within the gene itself. SNP markers within the candidate gene region were extracted. Combined with cob color phenotypic data, association analysis was performed on these candidate genes, outputting the top five most significant markers. One of these was an SNP located in an exon region at position 47834083 on maize chromosome 1. Genotypic data at this SNP marker was extracted from 465 materials. Marker effect analysis was performed combining genotypic and multi-site phenotypic data, showing a very strong correlation between this SNP and cob color. KASP primers were designed based on this SNP, and gel-free fluorescent polymerase chain reaction was used to distinguish maize inbred lines.

[0027] Example 1: Investigation and Phenotypic Data Analysis of Cob Color Trait in Maize Inbred Lines In 2025, 465 high-quality maize inbred lines selected over the past 15 years from the Shenzhen Genomics Institute of the Chinese Academy of Agricultural Sciences were planted in Harbin, Heilongjiang Province. A randomized block design was used, with each variety planted in two rows, 3 meters long, with a row spacing of 0.65 meters and a plant spacing of 0.2 meters. Fertilization and irrigation were managed as usual in the field. At maturity, cob color was recorded, with five plants from each variety selected to collect and analyze data on cob color and other traits.

[0028] Example 2: Maize genomic DNA extraction and resequencing library construction The specific method for constructing a library for the maize inbred lines in Example 1 is as follows: (1) Weigh 1.0g of fresh leaves, cut them into small pieces and put them into a mortar. Grind them with liquid nitrogen and then add 3mL of 1.5×CTAB. Grind them into a homogenate and transfer it into a 15mL centrifuge tube. Then add 1mL of 1.5×CTAB to the mortar to rinse and transfer it into the centrifuge tube. Mix well and incubate in a 65℃ water bath for 30min, shaking slowly from time to time.

[0029] The 1.5×CTAB formulation is as follows (1L): CTAB 15g 1 mol / L Tris.Cl (EH 8.0) 75mL 0.5 mol / L EDTA 30mL NaCl 61.4g Add deionized water to a final volume of 1L, and add mercaptoethanol to a final concentration of 0.2% (2ml) before use.

[0030] (2) After cooling to room temperature, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently until the lower layer turns dark green.

[0031] (3) Centrifuge at 4200 rpm for 10 min, transfer the upper aqueous phase to a new 15 mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, mix and let stand for 5 min. Incubate at -20℃ for 30 min to precipitate DNA.

[0032] (4) Centrifuge at 4200 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate once, invert the centrifuge tube to dry the DNA, and add 50 μL of TE to dissolve the DNA.

[0033] (5) Detect the concentration of DNA and adjust it with water to 20 ng / ul.

[0034] (6) Library construction was performed using a simplified AIO-seq method (Zhao et al., 2020). Multiple samples were fragmented using Tn5 transposase, and MGI® sequencing adapters were ligated during PCR amplification. After mixing the samples, fragment sizes were screened, and the selected mixed samples were circularized using the Hieff NGS® Fast-Pace DNA Circulation Kit (Yisheng Biotechnology, Shanghai, China, catalog number 13341ES96). The enzyme digestion products were quantified using the Qubit® ssDNA Detection Kit (Thermo Fisher Scientific, catalog number Q10212). Finally, the circularized library was sequenced on an MGI® DNBSEQ-T1 sequencer, producing 150 bp paired-end reads and yielding approximately 5× data from resequencing.

[0035] Example 3: GWAS analysis of maize cob color to obtain significant SNPs and candidate genes All sequencing data were processed and analyzed using a high-performance computer server. Raw data processing: After quality assessment of the raw PE (Pair-end) sequencing data using FastQC, BWA was used for quality control. Sequencing reads were aligned to a reference genome (B73v5), and SNP and Indel detection was performed using GATK. After quality control filtering at the sample and variant levels, 6,945,041 high-quality SNP markers (minimum allele frequency > 0.05, missing data < 20%) were selected to ensure the accuracy and reliability of the analysis results. To better understand population structure and genetic background, a phylogenetic tree was constructed using iqTree software, principal component analysis (PCA) was performed on the whole-genome SNP data using Plink software, and population structure analysis was performed using Faststructure software to clarify the genetic structure within the population. Genome-wide association analysis was performed on the rachis color trait using the previously selected high-quality SNPs. A mixed linear model of genotype + phenotype + population structure + phylogenetic relationship matrix in GEMMA was used to analyze the association between SNP markers and various traits. All SNPs satisfying p < 1.7286e-5 were extracted from the GWAS results file using awk and converted to BED format (Chr, Start, End). Based on the GWAS analysis of the ear cob color trait data from the three locations, the major-effect SNPs were obtained, including the SNP at position 47834083 on chromosome 1 of maize. Analysis of the SNP effect revealed that maize ear cobs with the C / C base were white, those with the A / A base were pink or red, and those with the C / A base were white, pink, or red. (See attached results). Figures 2 to 4 ,in: Figure 3 Manhattan and QQ plots for genome-wide association analysis (GWAS) of maize cob color are shown. a and b are the Manhattan and QQ plots for cob color in Acheng in 2025; c and d are the Manhattan and QQ plots for cob color in Wangkui in 2025; and e and f are the Manhattan and QQ plots for cob color in Zhaodong in 2025. GWAS results for cob color indicate that, under these three environments, cob color is commonly located in the Chr1:42M-52M region.

[0036] Figure 4To analyze the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 on cob color based on resequencing data, the results showed that the cob color of homozygous AA genotype (SNP at Chr1:47834083 is A / A) in three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) was significantly affected. All are red or pink. The cob color of the homozygous genotype aa (C / C SNP at Chr1:47834083) in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) is white; the cob color of the heterozygous genotype Aa (C / A SNP at Chr1:47834083) in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) is white, red, or pink.

[0037] Example 4: Development and Validation of KASP Markers for Maize Cob Color Based on the SNP variation sites screened in step 3 that can be used to distinguish the cob color trait of different maize inbred lines, KASP molecular markers for rapid identification were developed for these sites.

[0038] Specifically as follows: (1) DNA was extracted from 465 maize inbred lines using the CTAB method; (2) Using DNA as a template, fluorescent polymerase chain reaction (PCR) genotyping was performed using KASP primers. The KASP primers were designed based on the SNP at position 47834083 on chromosome 1 of maize. The primers are shown in the table below: Gene Primer name Primer sequence Ear rachis color CC-1-KASP-147F1CC-1-KASP-147F2CC-1-KASP-147R GAAGGTGACCAAGTTCATGCTACAAGACCGTCTCAACACAACAGAAGGTCGGAGTCAACGGATTCAAGACCGTCTCAACACAACCAAGAGGAATCTCCTGCCATTAGT The PCR amplification reaction system, in 10 μl increments, consisted of: 2 μl of 4-50 ng / μl genomic DNA, 0.14 μl of primer mix (prepared by mixing 6 μl of forward primer 1, 6 μl of forward primer 2, 15 μl of reverse primer, and 23 μl of ddH2O), 5 μl of 2x ProbeMix A solution, and 3 μl of ddH2O. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ annealing for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, 31 cycles; 25℃ for 10 min; 4℃ for storage.

[0039] After amplification, KASP detection was performed based on the AQP genotyping system operating instructions. The PCR program on the ABI 7500 qPCR instrument was set to 35℃ for 30 seconds. The results file was exported, and the genotypes were further determined according to the sample clusters. Results analysis was performed using Taqman Genotyper Software. The fluorescence values ​​corresponding to HEX and FAM for each PCR reaction well were obtained and divided by the value of the reference dye (ROX) for that well. The fluorescence values ​​were standardized to obtain the relative fluorescence values ​​of HEX and FAM for each PCR reaction well (FAM fluorescent tag sequences were observed at excitation wavelength of 485nm and emission wavelength of 520nm, and HEX fluorescent tag sequences were observed at excitation wavelength of 528nm and emission wavelength of 560nm). Based on the relative fluorescence values, the samples were clustered. The detection results are as follows: Figure 5 As shown.

[0040] Depend on Figure 5 It can be seen that there are three genotypes at this locus: blue dots represent homozygous genotypes A / A, red dots represent homozygous genotypes C / C, and green dots represent heterozygous genotypes C / A.

[0041] The consistency between the cob color trait and the typing results of the maize materials detected in Example 4 was analyzed. Table 1 shows the correspondence and consistency between the cob color trait and the typing results of the maize materials. Figure 5 and Figure 6 .

[0042] Figure 6 To analyze the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 based on KASP data, the results of the analysis of the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 based on KASP data showed that the homozygous genotype AA (SNP at Chr1:47834083 is A:A) in three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) showed that the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 was significantly higher in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025). The cob color is red or pink. The cob color of the homozygous genotype aa (C:C at Chr1:47834083) in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) is white. The cob color of the heterozygous genotype Aa (C:A at Chr1:47834083) in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) is white, red, or pink.

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054] Figure 5 This image shows the KASP molecular marker genotyping results for 465 maize ear cob colors. KASP primers were designed based on the SNP at Chr1:47834083 in maize, and KASP molecular marker genotyping was performed on the 465 maize accessions. The results showed that KASP markers could distinguish three genotypes at Chr1:47834083. In the image, orange-red represents homozygous aa (C:C), blue represents homozygous AA (A:A), green represents heterozygous Bb (C:A), purple-red represents signals but no clear genotype (very few detected, possibly due to DNA quality issues), and gray represents NTC controls.

[0055] Figure 6 To analyze the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 based on KASP data, the results of the analysis of the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 based on KASP data showed that the homozygous genotype AA (SNP at Chr1:47834083 is A:A) in three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) showed that the phenotypic effect of allelic variation at the SNP locus Chr1:47834083 was significantly higher in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025). The cob color is red or pink. The cob color of the homozygous genotype aa (C:C at Chr1:47834083) in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) is white. The cob color of the heterozygous genotype Aa (C:A at Chr1:47834083) in the three locations (Wangkui in 2025, Zhaodong in 2025, and Acheng in 2025) is white, red, or pink.

[0056] According to Table 1, Figure 5 and Figure 6It can be seen that when the fluorescence signal of the amplification product is orange-red, the maize ear cob color trait is identified as white, and the corresponding genotype is homozygous aa (C:C); when the fluorescence signal of the amplification product is green, the maize ear cob color trait is identified as pink, red, and white, and the corresponding genotype is heterozygous Aa (C:A); when the fluorescence signal of the amplification product is blue, the maize ear cob color trait is identified as pink and red, and the corresponding genotype is homozygous AA (A:A). The KASP experimental results of Example 4 are consistent with the actual ear cob color trait of the test sample, and the KASP detection results have a 100% consistency with the trait. This indicates that using this molecular marker to perform KASP experiments on the test material can effectively detect its genotype, thereby completing the identification of germplasm.

[0057] This invention has many significant beneficial effects on maize breeding and other aspects, as detailed below: This invention, for the first time, clearly demonstrates the close linkage between the SNP locus at position 47834083 on maize chromosome 1 and cob color. The developed KASP marker CC-1-KASP-147 and its specific primer set exhibit strong targeting, accurately distinguishing between the A / A, C / C, and C / A genotypes. The chi-square test is used to quantify the significance of the association between the marker and cob color, and Euclidean distance clustering is employed to achieve objective genotype determination. Combined with relative fluorescence value standardization, the consistency of the genotyping results reaches 100%, significantly improving the accuracy and reliability of cob color identification. Compared to traditional phenotypic observation methods, this technology eliminates the need to wait for maize maturity; detection can be completed at the seedling stage through DNA extraction and PCR amplification. Furthermore, it eliminates the need for gel electrophoresis, relying on fluorescence signals for high-throughput genotyping, significantly reducing detection costs and operational complexity, and solving the problems of long cycles, high subjectivity, and low efficiency associated with traditional methods.

[0058] This invention provides a powerful molecular-assisted tool for targeted breeding of maize cob color. By combining conventional hybridization, backcrossing, and KASP marker screening, it can rapidly preserve individuals with the target genotype. Stable maize inbred lines with the target cob color can be cultivated in 3 to 5 generations, significantly shortening the breeding cycle and improving germplasm selection efficiency. This marker and its application are compatible with various material types, including maize inbred lines, hybrids, and DH lines, meeting diverse breeding needs such as homozygous genotype screening, F1 generation cob color prediction, and seed purity detection. It also covers different planting seasons, including spring, summer, and autumn sowing, and is suitable for the ecological environments of several major maize-producing areas, such as Heilongjiang, Jilin, Shandong, and Henan, demonstrating broad applicability. Furthermore, the primer concentration, reaction system, and amplification program have been systematically optimized to flexibly adapt to different reaction system sizes, such as 10 μL, 20 μL, and 50 μL, facilitating application by different breeding units according to their specific needs.

[0059] This invention precisely aligns with the current trend of mechanized grain harvesting in the maize industry. The rapid dehydration and low moisture content of red-cob maize have become core breeding objectives. This invention allows for the targeted selection of red-cob or white-cob maize varieties, providing crucial technical support for developing new maize varieties adapted to mechanized harvesting. This is of great significance for promoting the large-scale and efficient development of the maize industry. Theoretically, the localization of this SNP locus and the development of the KASP marker enrich the molecular genetic marker resources related to maize cob color, providing important evidence for in-depth research on the genetic mechanism of maize cob color. Practically, the marker's phenotypic contribution rate is no less than 85%, and it has been validated in three locations and multiple environments, demonstrating strong stability and reproducibility. It can be directly applied to breeding practices and germplasm resource screening, reducing the randomness of breeding. Furthermore, the industrial application of this technology can provide maize breeding units with efficient and precise technical solutions, possessing broad prospects for technology transfer and commercialization, and contributing to the upgrading and iteration of maize breeding technology.

[0060] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely preferred examples and are not intended to limit the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. A Kasp marker CC-1-KASP-147 closely linked to the color of the corn cob, characterized in that, This includes specific SNP sites and corresponding KASP molecular marker primer sets; The SNP site is located at position 47834083 on chromosome 1 of maize, and the polymorphism is C / A; The KASP is labeled CC-1-KASP-147, and the corresponding primer set includes forward primer 1, forward primer 2, and reverse primer; The sequence of forward primer 1 is GAAGGTGACCAAGTTCATGCTACAAGACCGTCTCAACACAACA, the sequence of forward primer 2 is GAAGGTCGGAGTCAACGGATTCAAGACCGTCTCAACACAACC, and the sequence of the reverse primer is AAGAGGAATCTCCTGCCATTAGT. The significance of the association between the KASP marker and the color of the maize ear cob is calculated using the following formula, and the marker effect value is determined using the following formula: ； ； In the above two formulas, This is the chi-square test statistic. This represents the number of actual observed ear cob color phenotypes corresponding to the i-th genotype. denoted as , where is the theoretical expected number of the rachis color phenotype corresponding to the i-th genotype, and i corresponds to A / A homozygous, C / A heterozygous, and C / C homozygous, respectively; ME is the marker effect value. The mean values ​​of cob color-related phenotypes in A / A homozygous maize are given. The mean values ​​of cob color-related phenotypes for C / C homozygous maize are given.

2. The SNP site and KASP marker CC-1-KASP-147 according to claim 1, characterized in that, The concentrations of forward primer 1 and forward primer 2 are independently 4 to 10 μmol / L, and the concentration of the reverse primer is 4 to 10 μmol / L. The concentration range is suitable for PCR reaction systems of different sizes, such as 10 μL, 20 μL, and 50 μL. When the reaction system is expanded or reduced by a factor of 1, the primer concentration is adjusted proportionally to ensure that the molar ratio of primer to template DNA is maintained between 1:5 and 1:

10.

3. The SNP site and KASP marker CC-1-KASP-147 according to claim 1, characterized in that, The volume ratio of forward primer 1, forward primer 2, and reverse primer in the primer set is 2:2:

5. This volume ratio is determined based on the difference in primer Tm values ​​and optimization of binding efficiency. The Tm values ​​of forward primer 1 and forward primer 2 are both 60℃ to 62℃, and the Tm value of the reverse primer is 58℃ to 60℃. This volume ratio can ensure the balance of competitive binding of the three primers in the PCR reaction. When preparing the primer mix, take 6μL of forward primer 1, 6μL of forward primer 2, and 15μL of reverse primer according to the above volume ratio, add 23μL of ddH2O and mix well to form a 50μL primer mix for later use.

4. The SNP site and KASP marker CC-1-KASP-147 according to claim 1, characterized in that, The effectiveness of the KASP marker was verified through multi-environment phenotypic effects. The phenotypic contribution rate of the marker was calculated using the following formula during the verification process: ； In the formula, The phenotypic contribution rate is given by m, where m is the number of experimental environments and m ≥ 3, and p is the number of maize materials in each environment. The actual cob color phenotypic value of the k-th material in the j-th environment. The values ​​for ear color phenotype predicted based on KASP marker genotypes are as follows: The mean cob color phenotype of all materials in all environments, with the phenotype contributing no less than 85%.

5. An application of the KASP marker CC-1-KASP-147 as described in any one of claims 1-4 in screening maize with different cob colors, characterized in that, The method for screening corn with different cob colors using the KASP marker CC-1-KASP-147 includes the following steps: Step 1: Extract genomic DNA from maize samples; Step 2: Using the genomic DNA as a template, perform PCR amplification using the primer set to obtain the amplification product; Step 3: Perform KASP genotyping on the amplified products, calculate the relative fluorescence value using the following formula, and perform clustering based on the relative fluorescence value to determine the genotype; Step 4: Identify the cob color of maize based on genotype and screen for maize with the target cob color; The formula for calculating the relative fluorescence value is: ； ； In the above two formulas, The relative fluorescence value of FAM. The measured fluorescence value is for the FAM channel. The fluorescence value of the ROX reference dye; The relative fluorescence value is HEX. The values ​​represent the measured fluorescence values ​​from the HEX channel. Genotype determination rules are as follows: a single FAM fluorescence signal indicates A / A homozygous genotype; a single HEX fluorescence signal indicates C / C homozygous genotype; and the coexistence of both fluorescence signals indicates C / A heterozygous genotype. The cob color identification rules are: A / A homozygous genotype corresponds to pink or red cob, C / C homozygous genotype corresponds to white cob, and C / A heterozygous genotype corresponds to white, pink, or red cob. The concordance between genotype and cob color phenotype during screening is verified using the following formula: ； In the formula, C represents the degree of fit. This represents the number of samples whose genotype determination results match the actual ear color phenotype. For the total number of samples tested, the conformity rate shall not be less than 99%.

6. The application of the SNP site closely linked to maize cob color and the KASP marker CC-1-KASP-147 according to claim 5, characterized in that, The PCR amplification reaction system in step 2, in 10 μL increments, includes 2 μL of maize genomic DNA, 0.14 μL of primer set, 5 μL of 2x Probe Mix A solution, and the remainder ddH2O. The concentration of the maize genomic DNA is 50 to 100 ng / μL, and the DNA purity must meet the requirements of an OD260 / OD280 ratio between 1.8 and 2.0, and an OD260 / OD230 ratio not less than 1.

5. The 2x Probe Mix A solution contains hot-start Taq enzyme, dNTPs, and Mg. 2+ FAM fluorescently labeled probe, HEX fluorescently labeled probe and PCR buffer, wherein Mg 2+ The concentration of the active ingredient was 2.0 to 2.5 mmol / L, and the concentration of dNTPs was 0.2 to 0.3 mmol / L; the balance ddH2O was enzyme-free sterile water, which was filtered through a 0.22 μm filter membrane to avoid nuclease contamination.

7. The application of the SNP site closely linked to maize cob color and the KASP marker CC-1-KASP-147 according to claim 5, characterized in that, The PCR amplification reaction procedure described in step 2 is as follows: The first stage involves pre-denaturation at 95℃ for 10 min, used to activate the hot-start Taq enzyme and completely unwind the maize genomic DNA; the second stage involves denaturation at 95℃ for 20 s followed by annealing at 61℃ for 40 s, for a total of 10 cycles, with the annealing temperature gradually decreasing to 56℃ in 0.5℃ increments per cycle; the third stage involves denaturation at 95℃ for 20 s followed by annealing at 55℃ for 40 s, for a total of 31 cycles, with the annealing temperature matching the Tm range of the primer set to ensure specific primer binding; the fourth stage involves holding at 25℃ for 10 min to terminate the reaction and stabilize the product; after the reaction, the amplified product can be stored at 4℃ for a short period, not exceeding 72 hours.

8. The application of the SNP site closely linked to maize cob color and the KASP marker CC-1-KASP-147 according to claim 5, characterized in that, The genomic DNA extraction in step 1 was performed using the CTAB method. The specific steps were as follows: Weigh 1.0g of fresh corn leaves, chop them, grind them into powder using liquid nitrogen, add 3mL of 1.5×CTAB and grind into a homogenate, transfer to a 15mL centrifuge tube, rinse the mortar with 1mL of 1.5×CTAB and transfer to the same centrifuge tube, incubate at 65℃ for 30min with occasional gentle shaking; cool to room temperature, add an equal volume of chloroform-isoamyl alcohol mixture (chloroform to isoamyl alcohol volume ratio 24:1), gently invert the centrifuge tube to mix until the lower layer turns dark green; centrifuge at 4200rpm for 10min, transfer the upper aqueous phase to a new 15mL centrifuge tube, add 2 volumes of pre-chilled anhydrous ethanol, gently mix and let stand for 5min, then place in a -20℃ freezer for 30min to precipitate the DNA; centrifuge at 4200rpm for 10min, discard the supernatant, and add 1mL of... Wash the precipitate once with 75% ethanol, invert the centrifuge tube to air dry the DNA at room temperature, and add 50 μL of TE buffer to dissolve the DNA. The pH of the TE buffer is 8.

0.

9. The application of the SNP site closely linked to maize cob color and the KASP marker CC-1-KASP-147 according to claim 5, characterized in that, After screening for the target cob color in step 4, the following breeding steps are also included: selecting the screened target corn as parents, where red or pink cob parents are selected from individuals with the A / A homozygous genotype, and white cob parents are selected from individuals with the C / C homozygous genotype; artificial pollination is carried out using conventional hybridization techniques to obtain F1 generation seeds and plant them; Genomic DNA was extracted from leaves during the F1 generation seedling stage. Steps 1 to 4 were repeated for detection and screening, and individuals with C / A heterozygous genotypes were retained. The F1 generation heterozygous individuals were used as female parents and backcrossed with the target rachis color parent to obtain BC1F1 generation seeds. Genotyping was performed on BC1F1 generation seeds after planting. Individuals carrying the target allele were retained. After 3 to 5 generations of backcrossing and self-pollination purification, a stable genetically inherited maize inbred line with the target cob color was bred.

10. The application of the SNP site closely linked to maize cob color and the KASP marker CC-1-KASP-147 according to claim 5, characterized in that, The maize samples include one or more of maize inbred lines, maize hybrids, and maize DH lines. Maize inbred line samples are suitable for screening homozygous genotypes and purifying breeding materials; maize hybrid samples are suitable for predicting the cob color of the F1 generation and detecting seed purity; and maize DH line samples are suitable for verifying genetic stability and analyzing marker effects. The samples are taken from fresh leaves from the seedling stage to maturity, with a sample size of not less than 0.5g. After sampling, the samples should be frozen at -80℃ or DNA extracted immediately to avoid nucleic acid degradation. The application covers maize samples from different planting seasons, such as spring, summer, and autumn sowing, and is suitable for the ecological environments of different major maize producing areas, such as Heilongjiang, Jilin, Shandong, and Henan.

Images