Development and Application of KASP Markers for Identification of Wheat Tolerance to Mesosulfuron-methyl

By developing a KASP marker for the C101G SNP site and utilizing specific primers and fluorescent tags, we achieved efficient screening of wheat tolerance to mesosulfuron-methyl, solving the problem of herbicide damage in wheat breeding and improving breeding efficiency and safety.

CN121575142BActive Publication Date: 2026-05-26INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511954766.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-05-26
Estimated Expiration
2045-12-23

AI Technical Summary

Technical Problem

Existing technologies reveal that differences in wheat's sensitivity to mesosulfuron-methyl lead to severe phytotoxicity. Traditional screening methods are time-consuming and susceptible to environmental interference, resulting in long breeding cycles and limited application areas for resistant varieties.

Method used

A KASP marker based on the C101G SNP site was developed. By designing specific KASP primers Primer1 and Primer2 and combining them with a fluorescent tag, it was used to rapidly identify wheat tolerance to mesosulfuron-methyl. A KASP kit and screening method were provided.

Benefits of technology

This technology enables high-throughput, precise typing of wheat tolerance to mesosulfuron-methyl, shortening the breeding cycle, improving screening efficiency, and ensuring safe wheat production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575142B_ABST
    Figure CN121575142B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of a KASP molecular marker Kasp_qPDRL-5A in identifying the trait of wheat resistance to mesosulfuron-methyl, belonging to the technical field of molecular marker breeding. The aim is to accelerate the process of assisted breeding of wheat varieties resistant to mesosulfuron-methyl through this KASP molecular marker. The present invention locates a SNP locus related to the trait of common wheat tolerance to mesosulfuron-methyl, and the molecular locus is the 101st base from the 5' end of the sequence shown in SEQ ID NO.1, with a polymorphism of C / G. Through a large number of wheat material experiments, it is verified that the mesosulfuron-methyl tolerance trait of wheat material with the CC homozygous genotype at this SNP locus is significantly higher than that of wheat material with the GG homozygous genotype. It can effectively predict the resistance of wheat to mesosulfuron-methyl and accelerate the breeding process of new wheat varieties resistant to the herbicide mesosulfuron-methyl.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding technology, and in particular to the development and application of a KASP marker for identifying wheat tolerance to mesosulfuron-methyl. Background Technology

[0002] Mesosulfuron-methyl, a sulfonylurea herbicide, inhibits the activity of acetolactate synthase in sensitive plants, leading to the inhibition of branched-chain amino acid synthesis, thereby suppressing cell division and causing the death of sensitive plants. It is highly effective against grassy weeds such as Alopecurus aequalis and Jointed Goatgrass. However, the varying sensitivities of wheat to mesosulfuron-methyl is a key factor restricting safe application—some wheat varieties exhibit phytotoxic symptoms such as leaf yellowing and growth retardation at recommended dosages, resulting in yield reductions of 20%-30% in severe cases. Current phytotoxicity assessments rely on the fresh weight inhibition rate or leaf yellowing index 21 days after field application, a period of up to one month that is easily affected by environmental factors, leading to poor repeatability of screening results.

[0003] KASP (Kompetitive Allele Specific PCR) markers, as a high-throughput genotyping technology based on single nucleotide polymorphisms (SNPs), have shown significant advantages in crop genetic improvement, especially in resistance breeding, quality optimization, and efficiency enhancement, where they are irreplaceable. However, research on KASP-specific markers for mesosulfuron-methyl resistance is still in its early stages, resulting in a breeding cycle of resistant varieties that is as long as 8-10 years, and the planting area of ​​resistant varieties is far lower than in Europe and North America. Therefore, developing KASP markers to assist in the screening of mesosulfuron-methyl resistant wheat germplasm can achieve early and precise selection of resistance genes, overcome the efficiency bottleneck of traditional phenotypic screening, and provide key technical support for ensuring safe wheat production in my country. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide the development and application of a KASP marker for the identification of wheat tolerance to mesosulfuron-methyl.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0006] A SNP molecular marker associated with wheat tolerance to mesosulfuron-methyl, the nucleotide sequence of which is shown in SEQ ID NO.1, has a C / G polymorphism at the 101st base of the 5' end of the sequence, named the C101G SNP site. At this site, wheat genotypes show significant differences in tolerance to mesosulfuron-methyl, specifically: CC homozygous wheat has significantly higher tolerance to mesosulfuron-methyl than GG homozygous wheat.

[0007] On the other hand, the present invention also includes a KASP primer for detecting the genotype of the above-mentioned locus, wherein the KASP primer includes a specific upstream primer Primer1, a specific upstream primer Primer2, and a universal downstream primer Primer_Common;

[0008] Primer1 is shown as SEQ ID NO.2;

[0009] Primer2 is shown in SEQ ID NO.3;

[0010] Primer1 and Primer2 are two specific primers, each linked to a different fluorescent sequence;

[0011] Primer_Common is shown in SEQ ID NO.4.

[0012] As a preferred embodiment of the present invention, the 5' end of Primer1 is connected to the fluorescent tag sequence FAM, and the 5' end of Primer2 is connected to the fluorescent tag sequence HEX.

[0013] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in the identification of wheat mesosulfuron-methyl tolerance traits, the reagent or kit being used to detect the above-mentioned C101G SNP genotype, and containing at least the above-mentioned KASP primers.

[0014] On the other hand, the present invention also includes the application of the above-mentioned KASP primers, reagents or kits in detecting wheat mesosulfuron-methyl tolerance traits.

[0015] On the other hand, the present invention also includes a product, wherein the product prepared based on the above application is any one of the following:

[0016] 1) Products that detect the polymorphism or genotype of the above C101G SNP sites in wheat;

[0017] 2) Products used to identify or assist in the identification of wheat's tolerance to mesosulfuron-methyl;

[0018] 3) Products used for breeding and / or assisting breeding of wheat resistant to mesosulfuron-methyl.

[0019] Finally, the present invention also includes a method for screening or assisting in the screening of wheat varieties with high tolerance to mesosulfuron-methyl, the method specifically comprising the following steps:

[0020] S1. Extract genomic DNA from wheat plant samples;

[0021] S2. Using wheat plant sample genomic DNA as a template, KASP reaction detection was performed using the above-mentioned KASP primers. The fluorescence signal of the KASP reaction detection was read to determine the genotype of the above-mentioned C101G SNP site.

[0022] S3. Select or assist in screening wheat varieties resistant to mesosulfuron-methyl based on the C101G SNP locus genotype.

[0023] As a preferred embodiment of the present invention, in step S2, if the genomic DNA of the wheat plant sample shows FAM fluorescence linked to Primer1, distributed near the x-axis, then the genotype of the C101G SNP site of the wheat sample is CC homozygous; if the genomic DNA of the wheat plant sample shows HEX fluorescence linked to Primer2, distributed near the y-axis, then the genotype of the C101G SNP site of the wheat sample is determined to be GG homozygous.

[0024] As a preferred technical solution of the present invention, step S3 specifically involves: the wheat variety with the CC homozygous genotype at the C101G SNP site is a wheat variety resistant to mesosulfuron-methyl.

[0025] As a preferred embodiment of the present invention, the PCR amplification system for the KASP reaction is as follows: 1.5 μl template DNA, 0.0417 μl primer working solution, 0.75 μl 2×KASP Master Mix, and sterile ultrapure water to make up to 3 μl. The PCR reaction program is as follows: 94 °C pre-denaturation for 15 min; 94 °C denaturation for 20 s, annealing for 20 s, the first annealing temperature is 61 °C, the temperature is reduced by 0.6 °C for each cycle, for a total of 10 cycles; 94 °C denaturation for 20 s, 55 °C annealing for 1 min, for a total of 26 cycles; 72 °C extension for 3 min, and storage at 4 °C.

[0026] The beneficial effects of adopting the above technical solution are as follows: The KASP molecular marker primer combination provided by this invention can effectively distinguish the genotype of the C101G SNP locus associated with wheat tolerance to mesosulfuron-methyl. Experiments have shown that in a population of 177 wheat varieties, wheat varieties with the CC homozygous C101G SNP locus exhibited significantly higher resistance to mesosulfuron-methyl than those with the GG homozygous GG SNP locus. The KASP molecular marker primer combination provided by this invention can be used for screening or assisted screening of wheat varieties with high tolerance to mesosulfuron-methyl, and can be used for marker-assisted breeding of wheat, as well as the selection and cultivation of wheat with mesosulfuron-methyl. Attached Figure Description

[0027] Figure 1This diagram illustrates the sequence of common wheat SEQ ID NO.1, the two allelic types of the anti-methyldisulfuron-related C101G SNP site, and the position of the KASP primer. The box represents the 101st base from the 5' end of the sequence shown in SEQ ID NO.1. The upstream primer position of the KASP marker is indicated by double underscores, and the downstream primer position is indicated by wavy lines.

[0028] Figure 2 This is a schematic diagram of agarose gel electrophoresis for DNA quality detection.

[0029] Figure 3 This is a schematic diagram of the DNA concentration measurement results.

[0030] Figure 4 This is a schematic diagram of the KASP reaction test results for wheat varieties / lines.

[0031] Figure 5 This diagram illustrates the association between different genotypes of the C101G SNP locus and herbicide resistance in different wheat varieties / lines under different environments. "*" indicates P < 0.05, meaning the difference is statistically significant; "**" indicates P < 0.01, meaning the difference is highly significant; BLUE represents the herbicide damage level BLUE value over three years, which is the optimal linear unbiased estimator after excluding environmental interference and experimental errors. Detailed Implementation

[0032] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, as used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0033] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.

[0034] Example 1: Localization of the C101G SNP site and acquisition of its KASP molecular marker

[0035] This invention, through analysis of a large number of wheat varieties (all common wheat varieties / lines were preserved by the Wheat Research Center of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences), discovered a SNP site associated with wheat resistance to mesosulfuron-methyl, corresponding to the 101st base from the 5' end of SEQ ID NO.1, denoted as the C101G SNP site, exhibiting C / G polymorphism. The sequence of SEQ ID NO.1 is shown below:

[0036] 5'-GCCGCGGCCTAGGAATGATGACTGATCAGCACCAATTACCGAATGACCCGCAAAATTTTGTTCTTACCGATTTTAAAGTGGACACTTCATCATGTTTTCASGTGATTCCGTGCACAATGTCAACCGCGAACGAATAACCGCACACGTCCTCCAGTCCTCCTAGACAGCCTCTAATCCAACGGCTTAATTTACACGAGCAAG-3'

[0037] In this case, the 101st 'S' is either 'C' or 'G'.

[0038] KASP primers were designed based on the C101G SNP site sequence associated with wheat resistance to mesosulfuron-methyl. This SNP site exhibits C / G polymorphism. The primer sequences are shown in Table 1.

[0039] Table 1. Primer sequences for the KASP marker Kap_qPDRL-5A used to detect wheat herb resistance.

[0040]

[0041] Example 2: Application of the KASP marker Kasp_qPDRL-5A in detecting different allelic types of C101G SNP sites associated with wheat resistance to mesosulfuron-methyl.

[0042] I. Genotyping

[0043] 1. Wheat DNA Sample Collection

[0044] Genomic DNA was extracted from wheat leaves using the TPS method. After pretreatment, the DNA samples were extracted and dissolved in 100 μL of ultrapure water.

[0045] DNA quality testing: Prepare a 1% agarose gel. Mix the DNA sample with the loading buffer and spot the sample. Add the DNA marker. After electrophoresis, observe the bands using a gel imaging system. Discard any substandard samples. The extracted DNA should be free of obvious impurities, with clear bands and no degradation. (See attached image) Figure 2 As shown.

[0046] After determining the DNA concentration, the DNA was uniformly diluted to 28.3 ng / μL and used as a template for PCR amplification. The DNA concentration determination results are attached. Figure 3 As shown.

[0047] 2. PCR amplification

[0048] Using the genomic DNA from step 1 as a template, PCR amplification was performed. The PCR amplification system is as follows:

[0049] Take 12 μL each of the two upstream primers Primer1 and Primer2 (100 μM) and 30 μL of the downstream primer Primer_Common (100 μM), add sterile ultrapure water to make up to 100 μL, mix well and use as the working solution for KASP-labeled primers, and store at 4 ℃ for later use.

[0050] The PCR amplification system consisted of: 1.5 μl template DNA, 0.0417 μl primer working solution, 0.75 μl 2× KASP Master Mix (LGC, product number: KBS-1050-112), and sterile ultrapure water to a final volume of 3 μl.

[0051] The PCR reaction program was as follows: 94 °C pre-denaturation for 15 min; 94 °C denaturation for 20 s, annealing for 20 s (the first annealing temperature was 61 °C, and the temperature was reduced by 0.6 °C for each cycle) for a total of 10 cycles; 94 °C denaturation for 20 s, 55 °C annealing for 1 min for a total of 26 cycles; 72 °C extension for 3 min, and storage at 4 °C.

[0052] After the PCR reaction, a fluorescence signal reader (Omega, BMG LABTECH, Germany) and a fluorescence detection system (Araya) were used to convert the fluorescence signals into analyzable numerical values ​​for fluorescence data reading of the reaction products. The fluorescence scanning results were graphically displayed using the ggplot package in R software. C-base types exhibited FAM fluorescence and were distributed near the x-axis; G-base types exhibited HEX fluorescence and were distributed near the y-axis; samples with no detected signal were distributed near the origin, as shown in the attached figure. Figure 4 As shown.

[0053] 3. C101G SNP locus genotyping

[0054] The C101G SNP gene in 177 common wheat varieties or germplasms was detected using the KASP marker Kasp_qPDRL-5A. Of these, 113 varieties / lines showed the qPDRL-5Aa allele (CC homozygous genotype at the C101G SNP), and 64 varieties / lines showed the qPDRL-5Ab allele (GG homozygous genotype at the C101G SNP). Details are shown in Table 2.

[0055] Table 2. Genotyping results of the KASP molecular marker Kap_qPDRL-5A locus.

[0056]

[0057]

[0058]

[0059] Note: qPDRL-5Aa indicates that the genotype at the locus is CC homozygous, and qPDRL-5Ab indicates that the genotype is GG homozygous.

[0060] These results indicate that the KASP marker Kasp_qPDRL-5A can effectively detect different allelic types at C101G SNP sites associated with wheat resistance to mesosulfuron-methyl.

[0061] Example 3: Association analysis of C101G SNP locus genotype with mesosulfuron-methyl tolerance trait in wheat varieties or germplasm

[0062] The 177 wheat varieties / lines from Example 2 were sown in Shijiazhuang City, Hebei Province, in 2022-2023, 2023-2024, and 2024-2025. Row lengths of 1.5 meters and 2 meters were set up for the control group and the herbicide-treated group for each variety. A randomized complete block design was used, with 90 seeds sown per row in the control group and 120 seeds per row in the herbicide-treated group. Fertilizer management and pest and disease control were implemented throughout the experimental fields.

[0063] The optimal application period for mesosulfuron-methyl is during the 3-6 leaf stage of wheat (before winter), when weeds are at the 2-5 leaf stage, maximizing their absorption and translocation capacity for the herbicide. This invention utilizes a commercially available mesosulfuron-methyl dispersible oil suspension (Hebei Rongwei Biopharmaceutical Co., Ltd.). The application dosage is as follows: after dilution with deionized water, the herbicide treatment group is applied at a dose of 15.75 g ai / ha.

[0064] To accurately assess the degree of pesticide hazard, a 1-4 level grading standard is adopted, with specific grading details as follows:

[0065] Level 1 (Mild Damage): Mortality rate of treated plants is less than 10%, surviving samples show only slight chlorosis at the leaf tips, and the height of treated plants is only slightly reduced (5%-10%) compared to the untreated control group; Level 2 (Moderate Damage): Mortality rate is approximately 40%, affected plants show extensive chlorosis, covering nearly 50% of the leaf area. Plant height inhibition is significant in some wheat materials, with the average height of treated plants of susceptible genotypes being 50% lower than the control group; Level 3 (Severe Damage): Mortality rate is close to 70%, surviving plants show severe chlorosis, affecting more than two-thirds of the leaf area. Plant height inhibition is extremely significant in some wheat materials, with the height of treated plants being only 50% or less of the control group; Level 4 (Extreme Damage): Mortality rate of treated plants is ≥95%, almost all plants die, and the survival rate is negligible.

[0066] To improve data recording accuracy, we added "+" and "-" symbols to each level for further subdivision. For example, "2+" indicates a higher degree of herbicide damage than "2", while "2-" indicates a lower degree of herbicide damage than "2". In statistical analysis, the herbicide damage levels 1-, 1, 1+, 2-, 2, 2+, 3-, 3, 3+, 4-, and 4 were converted to numbers from 1 to 11, with higher values ​​indicating more severe herbicide damage to wheat, greater sensitivity to mesosulfuron-methyl, and weaker resistance. Table 3 shows the herbicide damage levels for wheat in different years.

[0067] Table 3. Data on herbicide damage levels of 177 wheat varieties in different years.

[0068]

[0069]

[0070]

[0071] Note: BLUE represents the BLUE value of the phytotoxicity level over three years, i.e., the best linear unbiased estimator after excluding environmental interference and experimental errors.

[0072] Combined with the C101G SNP genotype detection results in Example 2, it was shown that the average herbicide damage severity of wheat varieties / lines carrying the qPDRL-5Aa allele was lower than that of wheat varieties / lines carrying the qPDRL-5Ab allele in different years, with significant or highly significant differences between the two, as shown in the appendix. Figure 5 As shown in Table 4.

[0073] Table 4. Statistical table of the relationship between genotypes of common wheat sites resistant to the herbicide mesosulfuron-methyl and phytotoxicity severity.

[0074]

[0075] Note: The statistical analysis used a two-tailed t-test.

[0076] The results showed that in a natural population of 177 wheat varieties, the qPDRL-5Aa genotype wheat exhibited higher resistance to the herbicide mesosulfuron-methyl than the qPDRL-5Ab genotype wheat. Studies of the natural population also indicated that the qPDRL-5Aa genotype at the C101G SNP locus is the superior genotype for enhancing wheat resistance to mesosulfuron-methyl. The KASP molecular marker developed in this invention enables high-throughput and precise genotyping of loci associated with mesosulfuron-methyl tolerance in wheat. The implementation of this technology not only ensures the sustainable and safe application of mesosulfuron-methyl in wheat fields in my country but also provides a solution for the rapid breeding of herbicide-resistant wheat varieties in the context of global climate change.

[0077] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. A method for screening or assisting in the screening of wheat varieties with high tolerance to mesosulfuron-methyl, characterized in that: The method specifically includes the following steps: S1. Extract genomic DNA from wheat plant samples; S2. Using wheat plant sample genomic DNA as a template, KASP primers were used to perform KASP reaction detection, and the fluorescence signal of the KASP reaction detection was read to determine the SNP locus genotype. The SNP site is located at the 101st base at the 5' end of the nucleotide sequence SEQ ID NO.

1. This site exhibits C / G polymorphism and is named the C101G SNP site. The KASP primers include a specific upstream primer Primer1, a specific upstream primer Primer2, and a universal downstream primer Primer_Common; wherein the 5' end of Primer1 is connected to the fluorescent tag sequence FAM, and the 5' end of Primer2 is connected to the fluorescent tag sequence HEX. The primer sequences are as follows: Primer1 is shown as SEQ ID NO.2; Primer2 is shown in SEQ ID NO.3; Primer_Common is shown in SEQ ID NO.4; S3. Based on the C101G SNP locus genotype screening or auxiliary screening, wheat varieties resistant to mesosulfuron-methyl were identified. Among them, the CC homozygous wheat showed significantly higher tolerance to mesosulfuron-methyl than the GG homozygous wheat.

2. The method for screening or assisting in screening wheat varieties with high tolerance to mesosulfuron-methyl according to claim 1, characterized in that: In step S2, if the KASP reaction fluorescence signal shows that the FAM fluorescence connected to Primer1 is distributed near the x-axis, then the genotype of the wheat C101G SNP site in this sample is determined to be CC homozygous; if the KASP reaction fluorescence signal shows that the HEX fluorescence connected to Primer2 is distributed near the y-axis, then the genotype of the wheat C101G SNP site in this sample is determined to be GG homozygous.

3. A method for screening or assisting in the screening of wheat varieties with high tolerance to mesosulfuron-methyl according to any one of claims 1-2, characterized in that: Step S3 specifically involves: wheat varieties with the CC homozygous genotype at the C101G SNP site are resistant to mesosulfuron-methyl.

4. The use of the KASP primers as described in claim 1, and the reagents or kits containing the KASP primers, in detecting the wheat mesosulfuron-methyl tolerance trait.

Citation Information

Patent Citations

  • Enzymes and formulations for broad-specificity decontamination of chemical and biological warfare agents

    CA2602185A1

  • Polynucleotide and polypeptide sequences associated with herbicide tolerance

    US20110185444A1