A molecular marker related to arabinoxylan content in wheat and its application

By designing KASP markers on wheat chromosome 7B and utilizing the differences in A or G nucleotides at SNP sites, a low-cost and efficient method for identifying the content of water-soluble arabinoxylan was achieved. This method solves the problems of high detection costs and strong environmental dependence in existing technologies and improves breeding efficiency.

CN122256555APending Publication Date: 2026-06-23INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610593046.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-30
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies for detecting water-soluble arabinoxylan content in wheat are costly, platform-dependent, and difficult to promote and apply in large-scale breeding populations. They are also greatly affected by the environment and lack stable and effective molecular markers.

Method used

We developed a PCR-based KASP marker technology, designed primer combinations based on the A or G nucleotide differences at the SNP site at 711067660 bp on wheat chromosome 7B, identified the content of water-soluble arabinoxylan in wheat by fluorescence detection, and performed rapid screening using a KASP kit and a high-throughput PCR instrument.

Benefits of technology

This method enables low-cost and efficient identification of water-soluble arabinoxylan content, improves the selection efficiency of early-generation breeding materials, reduces reliance on high-cost phenotypic determination, and enhances the efficiency of wheat dietary fiber-related quality improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
Patent Text Reader

Abstract

The application discloses a wheat arabinoxylan content related molecular marker and application thereof. The application belongs to the technical field of biology, and provides a wheat genome SNP molecular marker and a substance for detecting the molecular marker, which are applied to any one of the following: (1) identifying or assisting in identifying wheat water-soluble arabinoxylan content; (2) wheat breeding; (3) preparing a product for identifying or assisting in identifying wheat water-soluble arabinoxylan content; and (4) preparing a wheat breeding product. The substance for detecting polymorphism and genotype of the above-mentioned SNP can be combined with other substances (such as a substance for detecting single nucleotide polymorphism or genotype of other wheat water-soluble arabinoxylan content related molecular markers) to prepare a product for identifying a wheat variety with wheat water-soluble arabinoxylan content, to perform early and efficient auxiliary screening on WE-AX content, and to improve breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker related to the content of wheat arabinoxylan and its application. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is one of my country's major grain crops. Besides providing carbohydrates and protein, its grains are also an important source of dietary fiber. With the increasing demand for healthy diets, the consumption of whole wheat and functional foods rich in dietary fiber is growing, making the improvement of dietary fiber content and quality in wheat grains an important direction for wheat quality breeding and processing industries. Arabicinoxylans (AX) is the main component of dietary fiber in wheat grains, mainly distributed in the aleurone layer and endosperm cell walls. Based on its water solubility, AX is generally divided into water-extractable arabinoxylans (WE-AX) and water-unextractable arabinoxylans (WU-AX), collectively referred to as total arabinoxylans (TOT-AX).

[0003] In terms of processing quality, AX, especially WE-AX, has strong water-retention and high viscosity properties, which can significantly affect key indicators such as flour water absorption, dough formation and stability, rheological properties, bread volume, and storage aging. In whole wheat or bran-fortified products, changes in AX content and its water-soluble ratio can more easily cause changes in system viscosity and moisture distribution, thus affecting processing suitability and product quality stability. In terms of nutrition and physiological function, WE-AX and its degradation products can be utilized by intestinal microorganisms, exhibiting certain prebiotic effects, and can influence glucose absorption rate by altering chyme viscosity, thus being related to metabolic health. Therefore, increasing the WE-AX content in grains and optimizing its related properties is of great significance for balancing wheat processing quality and health attributes.

[0004] Existing research indicates that the WE-AX content in wheat grains varies significantly among different varieties (lines), is significantly influenced by genotype, and is a quantitative trait controlled by multiple genes. It is also easily regulated by environmental conditions and genotype-environment interactions. To elucidate its genetic basis and serve breeding applications, linkage analysis of parental populations and genome-wide association studies are commonly used to locate QTLs or associated loci related to WE-AX. With the development of high-density SNP microarrays and next-generation sequencing technologies, several genetic loci affecting grain WE-AX content have been reported, providing candidate information for molecular breeding.

[0005] However, existing SNP marker information is mostly derived from microarrays or resequencing platforms, which are costly and platform-dependent, making them difficult to directly apply in large-scale breeding populations. In contrast, PCR-based allele-specific markers such as KASP (Kompetitive Allele-Specific PCR) offer advantages such as low cost, high throughput, ease of operation, and easy implementation in breeding systems. Converting SNP sites closely linked to target traits obtained from QTL mapping or genome-wide association analysis into KASP markers enables rapid screening of superior WE-AX-related allelic variations, improving the selection efficiency of early-generation breeding materials and reducing reliance on costly phenotypic determination. Especially for WE-AX traits, which are highly influenced by the environment, developing stable and effective markers under different environmental or genetic backgrounds for marker-assisted selection is of practical necessity for improving the efficiency of wheat dietary fiber-related quality improvement. Summary of the Invention

[0006] The main problem this invention aims to solve is how to efficiently identify or assist in the identification of water-soluble arabinoxylan content in wheat.

[0007] To address the above problems, this invention provides an application of SNP molecular markers in the wheat genome in any of the following: (1) To identify or assist in the identification of the water-soluble arabinoxylan content in wheat; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of the content of water-soluble arabinoxylan in wheat; (4) Prepare products for wheat breeding; The reference genome sequence of the wheat variety Chinese Spring RefSeq v1.0 (https: / / urgi.versailles.inra.fr / blast_iwgsc / ) was used as the reference genome. The SNP site was located at 711067660 bp on wheat chromosome 7B, and its nucleotide type was A or G. It was the 61st nucleotide of SEQ ID No:4. In SEQ ID No.4, r represents A or G.

[0008] This invention also provides the use of a substance for detecting the polymorphism or genotype of the SNPs described above in any of the following: (1) To identify or assist in the identification of the water-soluble arabinoxylan content in wheat; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of the content of water-soluble arabinoxylan in wheat; (4) Prepare wheat breeding products.

[0009] Furthermore, the substance may be D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0010] In this document, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0011] Furthermore, the primer composition consists of primer A, primer B, and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:1 or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of SEQ ID No:1; Primer B is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:2 or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of SEQ ID No:2; Primer C is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3; The present invention also provides a method for identifying or assisting in the identification of water-soluble arabinoxylan content in wheat, comprising detecting the genotype of an SNP site in the genome of the wheat to be tested, and identifying or assisting in the identification of water-soluble arabinoxylan content in wheat based on the genotype, wherein the SNP site is a site on wheat chromosome 7B, and its nucleotide type is A or G, and is the 61st nucleotide of SEQ ID No:4.

[0012] In this paper, the genotype of the SNP locus is AA or GG, where AA is the homozygous type of the SNP being A, and GG is the homozygous type of the SNP being G; the water-soluble arabinoxylan content of the wheat tested with the SNP genotype AA is higher than that of the wheat tested with the SNP genotype GG.

[0013] In one specific embodiment, the method for identifying or assisting in the identification of wheat water-soluble arabinoxylan content may include the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, KASP labeling detection was performed using a primer composition; the primer composition consisted of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:1 or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of SEQ ID No:1; Primer B is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:2 or a single-stranded DNA molecule whose nucleotide sequence is positions 22-41 of SEQ ID No:2; Primer C is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the wheat to be tested; (3) Identify the water-soluble arabinoxylan content of the wheat to be tested based on the genotype results: The water-soluble arabinoxylan content of the wheat to be tested with the SNP genotype GG is better than that of the wheat to be tested with the SNP genotype AA.

[0014] In the above method, the primer dissolution and preparation method can be as follows: First, dilute the three primers to 100 μM with ddH2O, and then prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. This solution is used as the KASP-labeled primer working solution and stored at -20 ℃ for later use.

[0015] In the above method, the PCR reaction system consisted of: 2.0 µl KASP 2×Master Mix (XGenread™), 0.048 µl KASP primers (a mixture of 3 primers with a total concentration of 50 µM, wherein the molar ratio of the two upstream primers A and B to the downstream primer C was 2:2:5), and 1.952 µl template DNA (50 ng / µl). The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0016] PCR amplification can be performed on a high-throughput PCR instrument. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler).

[0017] In the above method, the PCR reaction procedure is as follows: Step 1: Pre-denaturation at 94 ℃ for 15 min; Step 2: Denaturation at 94 ℃ for 20 s, annealing for 20 s (the first annealing temperature is 65 ℃, and the temperature is reduced by 1 ℃ for each cycle) for a total of 10 cycles; Step 3: Denaturation at 94 ℃ for 20 s, annealing at 57 ℃ for 1 min, for a total of 35 cycles.

[0018] After the PCR reaction was completed, the fluorescence signal was detected using an automated focusing fluorescence multi-functional microplate reader (PHERAstar Plus, BMGLabtech GmbH, Germany), and genotyping was performed using Klustercaller v3.4 (LGC, Hoddesdon, UK).

[0019] The results are as follows: For the KASP marker K_94839775, the G base type exhibits FAM fluorescence, distributed near the x-axis; the A base type exhibits HEX fluorescence, distributed near the y-axis; samples with no detected signal are distributed near the origin. Alleles carrying only FAM fluorescence and distributed near the x-axis are classified as the GG genotype; alleles carrying only HEX fluorescence and distributed near the y-axis are classified as the AA genotype.

[0020] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0021] The present invention also provides a method for wheat breeding, comprising detecting the genotype of the SNP mentioned above in the wheat genome, selecting wheat with the genotype of the SNP being AA as a parent for breeding, wherein AA is a homozygous type of the SNP being A.

[0022] This invention also provides the application of the methods described above in wheat breeding.

[0023] In this document, the purpose of the breeding may include developing high-yielding wheat. The wheat may be a pure line or an inbred line.

[0024] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to the content of water-soluble arabinoxylan in wheat) to prepare a product for identifying the content of water-soluble arabinoxylan in wheat.

[0025] This invention discovered a QTL and its linked molecular marker that affect wheat WE-AX content. The QTL is named... QgWE- AX.caas-7B Located on chromosome 7B, flanked by markers. AX_111008463 and AX_110085644 The physical range is 708.1–713.3 Mb. Under the four environmental conditions tested, it can explain 9.0–11.9% of the phenotypic variation. Early-stage screening of WE-AX content can be achieved by designing KASP-specific primer compositions targeting this SNP, thus improving breeding efficiency. Attached Figure Description

[0026] Figure 1 KASP tag K_94839775 Genotyping results of 161 wheat varieties. AA represents the SNP locus AX- in the wheat material. 94839775 The genotype is AA, and GG indicates that the wheat material has the SNP site AX- 94839775 The genotype was GG, and CK was a blank control in the reaction system without the addition of template DNA. Detailed Implementation

[0027] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0030] The RIL population (273 families) of Linmai 2 / Zhong 892 in the following examples has been described in: Liu, J., He, Z., Wu, L. et al., 2016. Genome-wide linkage mapping of QTL for black pointreaction in bread wheat (Triticum aestivum L.). Theor Appl Genet 129, 2179–2190. https: / / doi.org / 10.1007 / s00122-016-2766-3. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0031] The 161 wheat varieties described in the following examples are documented in: Chen, T., Gong, X., Zhi, L., et al., 2024. Arabinoxylan profiles in Chinese winter wheat: Novel QTL and molecular marker. Journal of Cereal Science 120, 10402. https: / / doi.org / 10.1016 / j.jcs.2024.104021. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0032] The following examples use statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0033] Example 1: Discovery of QTLs related to wheat WE-AX content and acquisition of its linked KASP markers I. Phenotypic and Genotypic Data Acquisition The Linmai 2 / Zhong 892 RIL population (273 families) was planted in Xinxiang, Henan (34°53′N, 113°23′E) and Gaoyi, Hebei in 2020-2021, and in Xinxiang, Henan and Gaoyi, Hebei (37°33′N, 114°26′E) in 2021-2022. All environments were set up with three replicates, using a randomized block design, with a row length of 1m, 30 seeds per row, and a row spacing of 20cm. Other field management measures were carried out in accordance with local wheat field management standards.

[0034] The WE-AX content of each sample strain was derived from the phloroglucinol-colorimetric method described by HERNANDEZ-ESPINOSA et al. of the CIMMYT laboratory (Hernández-Espinosa, N., Posadas-Romano, G., Dreisigacker, S., et al., 2024. Efficientarabinoxylan assay for wheat: Exploring variability and molecular marker associations in Wholemeal and refined flour. Journal of Cereal Science 117, 103897. https: / / doi.org / 10.1016 / j.jcs.2024.103897), with modifications made to the sample weighing section. The specific determination steps are as follows: Weigh 20 mg of whole wheat flour into a 2 ml centrifuge tube (Safe-lock Eppendorf), repeating twice. Extract WE-AX from the sample using distilled water, then mix the dissolved solution with the extraction solution (110 mL glacial acetic acid, 2.3 mL concentrated hydrochloric acid, 5.4 mL 10% (w / v) phloroglucinol-ethanol solution, 1.0 mL 1.75% (w / v) glucose solution), and react at 99°C and 700 rρm for 23 min. After the reaction, quickly cool on ice for 3-5 min. Quickly pipette 300 μL of the reaction solution into an ELISA 96-well plate (Corning, Lot: 02418001), and measure the absorbance at 552 nm and 510 nm respectively. To eliminate the influence of hexose, the difference between the two (△Asample) is used as the absorbance value. Calculate the WE-AX content according to the xylose standard curve and formula (1): WE-AX content (mg) = (△ Asample-b)×V1×1000÷(a×F×A1); △ Asample = The difference in absorbance of the sample at 552 nm and 510 nm (A552 - A510) used for analysis. a = The slope of the xylose standard curve. This value varies depending on the curve. b = Intercept of the xylose standard curve. This value varies depending on the curve. F = the mass of whole wheat flour used for analysis (20 mg); V1 = Volume used for extracting arabinoxylan (1000 µL). A1 = Volume (75 µL) used to extract the sample for the colorimetric reaction. Genomic DNA was extracted from young leaves of 273 families using a high-low salt pH method. DNA concentration was determined using a NanoDrop 2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / µl. DNA quality was then assessed using 0.8% agarose gel electrophoresis, and qualified DNA samples were used for SNP genotyping. SNP analysis was performed using a 90K SNP chip developed in collaboration between the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and Affymetrix Axiom.

[0035] II. Linkage Graph Construction Genotyping was performed on 273 families and two parents using the CapitalBio Corporation (http: / / www.capitalbio.com) wheat 90K SNP chip, which contained 2243 backbone markers representing 6793 polymorphic SNP markers. The genotypes of the population lines were divided into three categories: AA (homozygous), BB (homozygous), and AB (heterozygous). SNP markers that could not effectively distinguish these three genotypes were deleted. After obtaining accurate genotype data, quality control was performed on the markers. The quality control standards were as follows: (1) Filtering out markers that were indistinguishable between parents; (2) Treating heterozygous genotypes as deletions by default; (3) Filtering out markers with a deletion rate greater than 20%; (4) Filtering out markers with significant segregation. The remaining high-quality SNP markers after quality control were used to construct a genetic linkage map. The map length was 2918.4 cM, the average length of a single chromosome was 138.9 cM, the average inter-locus distance was 1.30 cM, and the average inter-marker distance was 0.43 cM.

[0036] III. QTL Analysis QTLs were detected using the complete interval mapping method in IciMapping v4.2, with a LOD threshold of 3.0. A stable QTL affecting WE-AX content was located on chromosome 7B and named [QTL name missing]. QgWE-AX.caas-7B ( Figure 1 ). Flanking markings AX_ 111008463 and AX_110085644 The physical location is 708.1–713.3 Mb. In the three environments, it explains 9.0–11.9% of the phenotypic variation (Table 1). The physical location of wheat chromosome 7B is at 711067660 bp. AX_94839775The labeled SNP site showed a significant correlation with wheat WE-AX content. This SNP site is located at position 61 of SEQ ID No:4, and its nucleotide type is either A or G. The nucleotide sequence of SEQ ID No:4 is the sequence located at physical positions 711067600 bp to 7110677720 bp on wheat chromosome 7B. In SEQ ID No:4, r represents A or G.

[0037] Table 1. QTL of WE-AX content in the RIL population of Linmai 2 × Zhong 892 using the complete interval plotting method

[0038] Note: a LOD, the logarithm of the ratio of the maximum likelihood function; b PVE, which explains the rate of phenotypic variation; c Add, additive effect, positive value indicates superior allelic variation from Linmai 2, negative value indicates superior allelic variation from Zhong 892.

[0039] IV. KASP Markup K_94839775 Obtaining specific primer sets and establishing genotyping methods Mark AX_94839775 Convert to KASP tags K_94839775 They also tested the genotypes of 161 wheat varieties.

[0040] 1. KASP tag K_94839775 Specific primer set design Design of KASP markers for detecting SNP polymorphic sites based on KASP technology. K_94839775 The primer set, abbreviated as KASP primer set, consists of two upstream primers (primer A and primer B) and one downstream primer (primer C). The specific sequences are as follows: Primer A: 5'- GAAGGTGACCAAGTTCATGCT ATGTCAACCAAGGCCACAAG-3' (SEQ ID No: 1); Primer B: 5'- GAAGGTCGGAGTCAACGGATT ATGTCAACCAAGGCCACAAA-3' (SEQ ID No: 2); Primer C: 5'-TCGGTTTGGGCATGGATGT-3' (SEQ ID No:3).

[0041] Note: GAAGGTGACCAAGTTCATGCT is the FAM tag sequence, and GAAGGTCGGAGTCAACGGATT is the HEX tag sequence.

[0042] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site G. The fluorescent signal of the FAM group can be read using an ELISA reader or a real-time PCR instrument. Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site A. The fluorescent signal of the HEX group can be read using an ELISA reader or a real-time PCR instrument.

[0043] A specific primer set designed using the KASP marker K_94839775 was used to detect the wheat arabinoxylan content-related QTL QgWE-AX.caas-7B at the physical location 711067660 bp (SNP site) on chromosome 7B. AX_94839775 Different allele types at this SNP locus. AX_94839775 Due to the A / G base difference, these two allele types are named AA genotype and GG genotype, respectively. The allele type carrying FAM fluorescence and distributed near the x-axis is the GG genotype, and the nucleotide at this SNP site is G; the allele type carrying HEX fluorescence and distributed near the y-axis is the AA genotype, and the nucleotide at this SNP site is A.

[0044] 2. KASP reaction for identifying SNP sites AX_94839775 genotype The KASP identification process is as follows: Primer dissolution and preparation method: First, dilute the three primers to 100 μM with ddH2O, and then prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. This is the working solution for KASP-labeled primers. Store at -20 ℃ for later use.

[0045] The PCR reaction system consisted of 2.0 µl KASP 2×Master Mix (XGenread™), 0.048 µl KASP primers (a mixture of 3 primers with a total concentration of 50 µM, wherein the molar ratio of the two upstream primers A and B to the downstream primer C was 2:2:5), and 1.952 µl template DNA (50 ng / µl). The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0046] PCR amplification can be performed on a high-throughput PCR instrument. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler).

[0047] In the above method, the PCR reaction procedure is as follows: Step 1: Pre-denaturation at 94 ℃ for 15 min; Step 2: Denaturation at 94 ℃ for 20 s, annealing for 20 s (the first annealing temperature is 65 ℃, and the temperature is reduced by 1 ℃ for each cycle) for a total of 10 cycles; Step 3: Denaturation at 94 ℃ for 20 s, annealing at 57 ℃ for 1 min, for a total of 35 cycles.

[0048] After the PCR reaction was completed, the fluorescence signal was detected using an automated focusing fluorescence multi-functional microplate reader (PHERAstar Plus, BMGLabtech GmbH, Germany), and genotyping was performed using Klustercaller v3.4 (LGC, Hoddesdon, UK).

[0049] The results are as follows: For the KASP marker K_94839775, the G base type exhibits FAM fluorescence, distributed near the x-axis; the A base type exhibits HEX fluorescence, distributed near the y-axis; samples with no detected signal are distributed near the origin. Alleles carrying only FAM fluorescence and distributed near the x-axis are classified as the GG genotype; alleles carrying only HEX fluorescence and distributed near the y-axis are classified as the AA genotype.

[0050] Example 2: Application of KASP marker K_94839775 and its primer set in the identification of wheat arabinoxylan content Test samples: The experimental materials consisted of 161 wheat varieties, including 139 main varieties promoted in the Huang-Huai wheat region and 22 foreign varieties, as detailed in Table 2.

[0051] 1. Sixty-one wheat varieties were planted in four environments in Xinxiang, Henan (34°53′N, 113°23′E) and Gaoyi, Hebei (37°33′N, 114°26′E) during the 2020-2021 and 2021-2022 seasons, respectively. A randomized block design was used, with 1m row length, 40 seeds per row, and 20cm row spacing. Two biological replicates were set for each variety. Field management was carried out according to local routine management procedures.

[0052] After normal harvesting and threshing, whole wheat flour was ground using a CT293 Cyclotec™ mill (Foss Tecator, Denmark) with a 0.5 mm sieve and stored at -20°C. The WE-AX content of whole wheat flour from 161 wheat varieties was determined by the phloroglucinol-colorimetric method.

[0053] 2. Utilize K_94839775 All experimental materials were labeled and tested. See Example 1 for specific steps.

[0054] The results are shown in Tables 2 and 3. Figure 1Of the 161 wheat varieties, 80 families had the Linmai 2 genotype (GG), and 81 families had the Zhong892 genotype (AA). QgWE-AX.caas-7B The WE-AX content differed significantly between the two genotypes at the 0.05 level, with families carrying the superior allele having an average content 16.2% higher than those without the superior allele.

[0055] Table 2. Genotyping results of 161 wheat varieties

[0056] Note: The material name for number 3 is HK1 / 6 / NVSR3 / 5 / BEZ / TVR / 5 / CFN / BEZ / / SU92 / CI13645 / 3NAI60.

[0057] Table 3. Statistical results of genotypes and WE-AX content of 161 wheat varieties.

[0058] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of SNP molecular markers in the wheat genome in any of the following: (1) To identify or assist in the identification of the water-soluble arabinoxylan content in wheat; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of the content of water-soluble arabinoxylan in wheat; (4) Prepare products for wheat breeding; The SNP molecular marker is a site on wheat chromosome 7B, specifically the 61st nucleotide of SEQ ID No:4, and its nucleotide type is either A or G.

2. The use of a substance for detecting the polymorphism or genotype of the SNP described in claim 1 in any of the following: (1) To identify or assist in the identification of the water-soluble arabinoxylan content in wheat; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of the content of water-soluble arabinoxylan in wheat; (4) Prepare wheat breeding products.

3. The application according to claim 2, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

4. The application according to claim 3, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-41 of sequence 2 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-41 of sequence 3 in the sequence listing. The primer C nucleotide sequence is the single-stranded DNA molecule of sequence 4 in the sequence listing.

5. A method for identifying or assisting in the identification of water-soluble arabinoxylan content in wheat, characterized in that: This includes detecting the genotype of the SNP site in the wheat genome, and identifying or assisting in the identification of the water-soluble arabinoxylan content in wheat based on the genotype. The SNP site is a site on wheat chromosome 7B, and its nucleotide type is A or G, which is the 61st nucleotide of SEQ ID No:

4.

6. The application according to any one of claims 1-4 or the method according to claim 5, characterized in that: The genotype of the SNP locus is AA or GG, where AA is the homozygous type of the SNP being A, and GG is the homozygous type of the SNP being G; the water-soluble arabinoxylan content of the wheat tested with the SNP genotype AA is higher than that of the wheat tested with the SNP genotype GG.

7. A method for wheat breeding, characterized by: The method includes detecting the genotype of the SNP in claim 1 in the wheat genome, selecting wheat with the genotype AA of the SNP as a parent for breeding, wherein AA is a homozygous type of the SNP being A.

8. The application of the method according to any one of claims 5-7 in wheat breeding.