Method for detecting three pathogenic vibrios of penaeus vannamei

Abstract

The invention provides a method for detecting three pathogenic vibrios of penaeus vannamei. According to the method, specific primers are designed by using toxR genes of vibrio fluvialis, flaA genes of vibrio anguillarum and pyrH genes of vibrio alginolyticus, and sensitivity test is carried out. The lowest detectable concentrations of the three vibrios are 5.21 * 10 < 2 > cfu / mL, 2.70 * 10 < 4 > cfu / mL and 2.48 * 10 < 2 > cfu / mL, and the sensitivity is high. The three vibrios are accurately and simultaneously identified through a multiple PCR method, and the identification efficiency is improved. Meanwhile, the lowest detection concentrations of the DNA of the three vibrios identified and extracted by using a real-time fluorescent quantitative PCR (qRT-PCR) technology are 1.0 * 10 <-6 > nmol / L, 1.0 * 10 <-7 > nmol / L and 1.0 * 10 <-8 > nmol / L respectively. Compared with the two methods, the common PCR technology has lower requirements on instruments and operation, so that the common PCR technology is more suitable for the diagnosis of the vibrio infection of the penaeus vannamei. The qRT-PCR technology is more suitable for detection cases with higher sensitivity requirements. By using the method, an efficient and reliable means is provided for diagnosing the bacterial diseases of the penaeus vannamei boone.

Description

Technical Field

[0001] The present invention belongs to the field of detection of aquatic animal pathogens, and specifically relates to a method for detecting three pathogenic vibrios of Penaeus vannamei. Background Art

[0002] Penaeus vannamei, native to the Pacific coast of South America, is one of the shrimp species with the highest aquaculture production in the world. It has the advantages of delicious meat, strong adaptability, strong disease resistance, and rapid growth, and is an ideal variety for intensive high-yield aquaculture. However, with the expansion of aquaculture scale and the improvement of intensification level, aquaculture diseases break out frequently, especially bacterial diseases have caused huge losses to the aquaculture industry, and vibriosis is particularly prominent.

[0003] Vibriosis of Penaeus vannamei is one of its main bacterial diseases, often caused by pathogenic bacteria such as Vibrio anguillarum, V. alginolyticus, and V. fluvialis. When the water environment deteriorates, these vibrios are likely to invade the shrimp body, causing dysfunction or tissue damage of the body, thereby reducing the resistance to pathogens and leading to the occurrence of serious diseases, resulting in great economic losses.

[0004] With the progress of technology, the PCR technique has been gradually applied to bacterial detection. Due to its advantages of rapidity, accuracy, and strong specificity, it has become the first choice of many researchers. As an improved method of single-PCR, multiplex PCR can use multiple pairs of primers in the same reaction system to simultaneously amplify multiple genes, thereby improving the detection efficiency and saving time and cost. In addition, the qRT-PCR technique is also widely used in bacterial identification, with higher accuracy, but it has more stringent requirements for instruments and reagents.

[0005] In this study, multiplex PCR technique was used to simultaneously detect multiple vibrios and compared with the qRT-PCR technique, and a more efficient detection method was proposed, providing a more reliable basis for the diagnosis of aquaculture diseases. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to overcome the deficiencies of the prior art and provide a PCR detection method for identifying three vibrios infecting Penaeus vannamei, so as to solve the problems of low detection efficiency and poor accuracy of vibriosis in the prior art. Through this method, the diseases of Penaeus vannamei can be diagnosed more efficiently and accurately, providing a more reliable disease prevention and control means for the aquaculture industry.

[0007] To achieve the above purpose, the present invention provides a method for detecting three pathogenic vibrios of Penaeus vannamei, and the three vibrios and the PCR method include:

[0008] Vibrio fluvialis, Vibrio anguillarum, Vibrio parahaemolyticus, conventional PCR, qRT-PCR.

[0009] Furthermore, the genes detected for the three bacteria include:

[0010] The toxR gene encoding the toxin expression regulatory protein of Vibrio fluvialis, the flaA gene encoding the flagellin of Vibrio anguillarum, and the pyrH gene of Vibrio alginolyticus.

[0011] Furthermore, the lowest concentrations of the three vibrios detected by conventional PCR include:

[0012] Vibrio fluvialis 5.21×10 2 cfu / mL, Vibrio anguillarum 2.70×10 4 cfu / mL, Vibrio alginolyticus 2.48×10 2 cfu / mL.

[0013] Furthermore, the lowest concentrations of the three vibrios detected by qRT-PCR include:

[0014] Vibrio fluvialis 1.0×10 -6 nmol / L, Vibrio anguillarum 1.0×10 -7 nmol / L, Vibrio alginolyticus 1.0×10 -8 nmol / L.

[0015] Furthermore, the gene primers include:

[0016] Primer 1 for the toxR gene: forward primer TGCAAGTAAAGATCCTGATG, reverse primer GTCGTAAACAAAATGACACAA; Primer 2 for the flaA gene: forward primer TTACGCAGAAGCGGTGAT, reverse primer GCTGTTGGATGAAGGGTC; Primer 3: forward primer TAGCGGATTTAGCAAGTTCAC, reverse primer TGGTCATAGTTTGCTCTCCT; Primer 4 for the pyrH gene: forward primer AAAGAACTGGTTGAACTGGGTG, reverse primer CCATCAACTTTCGTCGCTTT;

[0017] Among them, Primer 2 is used for conventional PCR, and Primer 3 is used for qRT-PCR.

[0018] The beneficial effects that can be achieved by the present invention adopting the above technical solutions include:

[0019] The present invention provides a method for detecting three pathogenic vibrios in Litopenaeus vannamei. The multiplex PCR technology is used to accurately identify the three vibrios, improving the identification efficiency. In addition, the qRT-PCR method is also used to identify the three vibrios. Comparing the two methods, the requirements of the ordinary PCR technology are lower. Therefore, in the diagnosis of bacterial diseases of Litopenaeus vannamei, it is more appropriate to use the ordinary PCR technology. This method provides an efficient and reliable means for the diagnosis of bacterial diseases of Litopenaeus vannamei. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : Sensitivity detection and multiplex PCR amplification diagram; A, Sensitivity detection results of Vibrio fluvialis, M is 2000bp makermolecular maker (2000bp), 1: 5.21×10 6 cfu / mL, 2: 5.21×10 5 cfu / mL, 3: 5.21×10 4 cfu / mL, 4: 5.21×10 3 cfu / mL, 5: 5.21×10 2 cfu / mL, 6: 5.21×10 1 cfu / mL, 7: 5.21 cfu / mL, 8 is the negative control; B, Sensitivity detection results of Vibrio anguillarum, M is 2000bp makermolecular maker (2000bp), 1: 2.70×10 7 cfu / mL, 2: 2.70×10 6 cfu / mL, 3: 2.70×10 5 cfu / mL, 4: 2.70×10 4 cfu / mL, 5: 2.70×10 3 cfu / mL, 6: 2.70×10 2 cfu / mL, 7 is the negative control; C, Sensitivity detection results of Vibrio alginolyticus, M is 2000bp makermolecular maker (2000bp), 1: 2.48×10 7 cfu / mL, 2: 2.48×10 6 cfu / mL, 3: 2.48×10 5 cfu / mL, 4: 2.48×10 4 cfu / mL, 5: 2.48×10 3 cfu / mL, 6: 2.48×10 2 cfu / mL, 7: 2.48×10 1cfu / mL, 8 is the negative control; D, multiplex PCR amplification results of three vibrios, M is 2000bp maker molecular maker (2000bp), 1 is multiplex PCR of flaA gene of Vibrio anguillarum, toxR gene of Vibrio fluvialis and pyrH gene of Vibrio alginolyticus, 2 is duplex PCR of flaA gene of Vibrio anguillarum and toxR of Vibrio fluvialis, 3 is duplex PCR of pyrH gene of Vibrio alginolyticus and toxR of Vibrio fluvialis, 4 is duplex PCR of flaA gene of Vibrio anguillarum and pyrH gene of Vibrio alginolyticus, 5 is the negative control

[0021] Figure 2 : RT-PCR diagrams of 3 vibrios; A, RT-PCR results of Vibrio fluvialis; B, RT-PCR results of Vibrio alginolyticus; C, RT-PCR results of Vibrio anguillarum

[0022] Figure 3 : RT-PCR standard curves and melting curves of 3 vibrios; A, RT-PCR standard curve and melting curve results of Vibrio fluvialis; B, RT-PCR standard curve and melting curve results of Vibrio alginolyticus; C, RT-PCR standard curve and melting curve results of Vibrio anguillarum Detailed implementation manners

[0023] The following will elaborate on the implementation manners of the present invention with the aid of specific examples. However, those skilled in the art should clearly understand that the listed examples are only intended to illustrate the present invention and do not constitute a limitation on the scope of the present invention. For the specific conditions not clearly mentioned in the examples, they should all be understood as being carried out according to industry conventions or the conditions recommended by the manufacturer. In addition, for the reagents or instruments involved, if the manufacturer is not specifically indicated, they all refer to commercially available conventional products and are easily obtainable.

[0024] The following introduces the specific method for identifying three vibrios of Litopenaeus vannamei provided in the embodiments of the present application.

[0025] The method for detecting three pathogenic vibrios of Litopenaeus vannamei provided in the embodiments of the present application, the three vibrios and the PCR method include:

[0026] Vibrio fluvialis, Vibrio anguillarum, Vibrio parahaemolyticus, conventional PCR, RT-PCR.

[0027] In the examples, the genes detected for the 3 bacteria include:

[0028] toxR gene of the toxin expression regulatory protein of Vibrio fluvialis, flaA gene of the flagellin of Vibrio anguillarum, pyrH gene of Vibrio alginolyticus.

[0029] In the examples, the lowest concentrations at which the three vibrios are detected by the conventional PCR include:

[0030] Vibrio fluvialis 5.21×102 cfu / mL, Vibrio anguillarum 2.70×10 4 cfu / mL, Vibrio alginolyticus 2.48×10 2 cfu / mL.

[0031] The lowest concentrations of the three vibrios detected by the RT-PCR include:

[0032] Vibrio fluvialis 1.0×10 -6 nmol / L, Vibrio anguillarum 1.0×10 -7 nmol / L, Vibrio alginolyticus 1.0×10 -8 nmol / L.

[0033] In the examples, the gene primers include:

[0034] toxR gene primer 1 forward primer TGCAAGTAAAGATCCTGATG reverse primer GTCGTAAACAAAATGACACAA, flaA gene primer 2 forward primer TTACGCAGAAGCGGTGAT reverse primer GCTGTTGGATGAAGGGTC primer 3 forward primer TAGCGGATTTAGCAAGTTCAC reverse primer TGGTCATAGTTTGCTCTCCT, pyrH gene primer 4 forward primer AAAGAACTGGTTGAACTGGGTG reverse primer CCATCAACTTTCGTCGCTTT;

[0035] Among them, primer 2 is used for ordinary PCR, and primer 3 is used for RT-PCR.

[0036] Specific experimental procedures

[0037] a. Activation culture and purification of bacteria

[0038] Vibrio fluvialis, Vibrio anguillarum and Vibrio alginolyticus were respectively inoculated into 5 mL of LB culture medium in a sterile environment and shaken overnight in an incubator at 28°C - 37°C and 200 rmp. After the culture medium became turbid, 20 μL was taken and spread on LB agar plates and cultured in an incubator at 28°C - 37°C for 12 h - 24 h. Observe the growth of the above strains, select the colonies that are mostly raised, smooth, moist and round, and inoculate them on LB or TSA agar plates by streaking method, and culture them in an incubator at 28°C - 37°C for 18 - 24 h, and store them for standby in a 4°C environment.

[0039] b. Primer design and synthesis

[0040] Download the specific genes of three Vibrio species from NCBI: the toxin expression regulatory protein gene toxR of Vibrio fluvialis (GenBank: AF170885.1), the flagellin flaA gene of Vibrio anguillarum (GenBank: L47122.1; GenBank: L47122.1), and the pyrH gene of Vibrio alginolyticus (GenBank: KC954181.1). The primer sequences were designed using Primer Premier 5.0 and synthesized by Tsingke Biotechnology Co., Ltd. The primer sequences are shown in Table 1, where the primer 2 of Vibrio anguillarum is used for ordinary PCR and the primer 3 is used for qRT-PCR.

[0041] Table 1 PCR primer sequences

[0042]

[0043] c. Bacterial culture and template acquisition

[0044] Pick single colonies of Vibrio fluvialis, Vibrio anguillarum, and Vibrio alginolyticus according to the requirements of aseptic operation and inoculate them into 5 mL of LB culture medium respectively. Incubate at 37 °C with shaking at 200 rpm for 12 - 24 h until the bacterial solution becomes turbid. Take out 1.5 mL of the cultured bacterial solution and place it in a 1.5 mL EP tube. Centrifuge at 12000 rpm for 1 min to collect the bacterial cells, and dilute the live bacteria with 150 μL of sterile water as the PCR template.

[0045] d. Establishment of PCR amplification system

[0046] (i) Establishment of single - PCR amplification system

[0047] Use a 25 μL reaction system: 1 μL of template, 1 μL each of upstream and downstream primers (50 mmol·L -1 ), among which the upstream and downstream primers of Vibrio anguillarum are 1 μL of primer 2 (50 mmol·L -1 ), 2.5 μL of dNTP (2.5 mM each), 2.5 μL of 10×buffer (without Mg 2+ ), 2 μL of MgCl 2 , 0.25 μL of rTaq enzyme, and finally make up the remaining volume with sterile double - distilled water. After mixing the samples, perform PCR amplification. The amplification program is pre - denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min 30 s, for a total of 35 cycles, and finally continue to extend at 72 °C for 10 min and store at 4 °C. Take 5 μL of the PCR amplification product and detect it by 1.5% agarose gel electrophoresis, and then place it in an ultraviolet gel imaging system to observe the results and take pictures. The reaction system is shown in Table 2.

[0048] Table 2 Single - PCR reaction system

[0049]

[0050] (ii) Sensitivity detection

[0051] The sensitivity of three Vibrio species was detected. Vibrio fluvialis, Vibrio anguillarum, and Vibrio alginolyticus were inoculated into 5 mL of LB culture medium and incubated overnight at 37 °C with shaking at 200 rpm until the bacterial suspension became turbid. Then, 1.5 mL of the cultured bacterial suspension was taken and placed in a 1.5 mL EP tube, and the cells were collected by centrifugation at 12,000 rpm for 1 min. The cells were diluted with sterilized ultrapure water in a 10-fold dilution gradient to 10 -8 ~10 -9 . PCR amplification was performed using 4 μL of the bacterial suspension at different dilution factors as templates, and sterile water was used as a negative control. Additionally, 10 -5 ~10 -7 of the three dilution gradients were spread on LB agar plates and incubated at 37 °C for 12 h, after which the colonies were counted.

[0052] (iii) Establishment of a duplex PCR reaction system between toxR of Vibrio fluvialis, flaA of Vibrio anguillarum, and pyrH of Vibrio alginolyticus

[0053] A 25 μL reaction system was used: 0.5 μL of the live bacterial dilutions of Vibrio fluvialis and Vibrio anguillarum, 0.5 μL of the live bacterial dilutions of Vibrio fluvialis and Vibrio alginolyticus, and 0.5 μL of the live bacterial dilutions of Vibrio alginolyticus and Vibrio anguillarum were used as templates, and 0.5 μL of the corresponding upstream and downstream primers were added. After mixing the samples, PCR amplification was carried out. The amplification program was as follows: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min 30 s, for a total of 35 cycles. Finally, extension was continued at 72 °C for 10 min, and the samples were stored at 4 °C. 5 μL of the PCR amplification product was detected by 1.5% agarose gel electrophoresis, and then the result was observed and photographed using a UV gel imaging system.

[0054] (iv) Establishment of a multiplex PCR reaction system for toxR of Vibrio fluvialis, flaA of Vibrio anguillarum, and pyrH of Vibrio alginolyticus

[0055] A 25 μL reaction system was used: the live bacterial dilutions of the three Vibrio species were 0.5 μL / 0.5 μL / 0.5 μL respectively, the upstream and downstream primers were 0.5 μL each, dNTP was 2.5 μL (2.5 mmol·L -1 ), 10× buffer was 2.5 μL (without Mg -1 ), 10× buffer was 2.5 μL (without Mg 2 + ), MgCl 22 μL, 0.25 μL of rTaq enzyme, and finally make up the remaining volume with sterilized distilled water. After mixing, perform PCR amplification, and at the same time use sterile water as a negative control. The amplification program is pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing temperature at 58 °C for 30 s, and the remaining amplification program is operated according to (i).

[0056] e. Detection of 3 kinds of bacteria by qRT-PCR

[0057] Extract the DNA of 3 kinds of vibrios according to the instructions of the bacterial genomic DNA extraction kit, and measure its nucleic acid concentration. Calculate the amount of reagent TE to be added for dilution as template Ref according to the formula 0.66×N / C (N is the length of the primer, C is the measured nucleic acid concentration). 0 , dilute by 10-fold gradient dilution to 10 -8 ~10 -10 , adopt a 20 μL reaction system: 0.5 μL of each upstream and downstream primer, among which the upstream and downstream primers of Vibrio anguillarum are 0.5 μL of primer 3 each (50 mmol·L -1 ), 10 μL of GreenMix, 4 μL of template DNA, and make up the volume with 5 μL of sterile water. The PCR program is: pre-denaturation at 95 °C for 3 min; 95 °C for 3 s, 60 °C for 30 s, a total of 40 cycles; after the reaction, measure the melting curve at 95.0 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s to detect the reaction specificity.

[0058] f. Experimental results

[0059] (i) Sensitivity detection and multiplex PCR amplification results

[0060] Dilute the cultured Vibrio fluvialis, Vibrio anguillarum and Vibrio alginolyticus by 10-fold gradient dilution to 10 -8 , and measure the lowest template concentration at which the bacterial amplification band can be detected. The results show that the lowest template concentration that can be identified for Vibrio fluvialis is 5.21×10 2 cfu / mL, the lowest template concentration that can be identified for Vibrio anguillarum is 2.70×10 4 cfu / mL, and the lowest template concentration that can be identified for Vibrio alginolyticus is 2.48×10 2 cfu / mL( Figure 1 ).

[0061] (ii) Results of qRT-PCR detection of 3 kinds of vibrios

[0062] In the fluorescence quantitative determination of DNA templates of three kinds of vibrios with different concentration gradients, the lowest concentration that can be detected for Vibrio fluvialis is 1.0×10 -6 nmol / L, and the lowest concentration that can be detected for Vibrio alginolyticus is 1.0×10-8 The lowest concentration that can be detected by 1.0×10 -7 nmol / L Vibrio anguillarum is 1.0×10 Figure 2 A and Figure 3 As shown in A, it can be comprehensively known that the lowest concentration that can be detected by Vibrio fluvialis is Ref 6 , that is, 1.0×10 -6 nmol / L. The results of Vibrio alginolyticus are as Figure 2 B and Figure 3 B shown. It can be comprehensively known that the lowest concentration that can be detected by Vibrio alginolyticus is Ref 8 , that is, 1.0×10 -8 nmol / L. The results of Vibrio anguillarum are as Figure 2 C and Figure 3 C shown. It can be comprehensively known that the lowest concentration that can be detected by Vibrio anguillarum is Ref 7 , that is, 1.0×10 -7 nmol / L.

[0063] The present invention not only accurately determines the optimal concentration for primer sensitivity detection, but also conducts multiplex PCR identification, with high sensitivity, strong specificity and short detection time. In addition, qRT-PCR technology is used to identify three types of vibrios, and the advantages and disadvantages of conventional PCR and qRT-PCR are compared. Conventional PCR technology has lower requirements for instruments and operations, but its accuracy is inferior to qRT-PCR; while qRT-PCR technology has higher sensitivity, but higher cost, stricter requirements for instruments and operations, and is suitable for high-precision experiments. Therefore, conventional PCR technology is more suitable for wide application. For detection cases with higher sensitivity requirements, it is more appropriate to use qRT-PCR technology. The PCR identification method established in this study can quickly detect the cause of sudden vibrio infection during the cultivation of Litopenaeus vannamei and help take corresponding response and control measures, and has important application value.

[0064] The above are only the preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed in the present application should be covered by the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. The present invention provides a method for detecting three pathogenic Vibrio of Penaeus vannamei, wherein the three Vibrio and PCR include: Vibrio fluviatilis, Vibrio anguillarum, Vibrio parahaemolyticus, conventional PCR, real-time fluorescence quantitative PCR.

2. The method for detecting three pathogenic Vibrio species of Penaeus vannamei according to claim 1, characterized in that: The detection genes corresponding to the three Vibrio species include: The toxR gene of toxin expression regulatory protein of Vibrio fluviatilis, the flaA gene of flagellin of Vibrio anguillarum, and the pyrH gene of Vibrio alginolyticus.

3. The method for detecting three pathogenic Vibrio species of Penaeus vannamei according to claim 1, characterized in that: The minimum concentrations of the three Vibrio species detected by the conventional PCR include: Vibrio fluvialis 5.21×10 2 cfu / mL, Vibrio anguillarum 2.70×10 4 cfu / mL, Vibrio alginolyticus 2.48×10 2 cfu / mL.

4. The method for detecting three pathogenic Vibrio species of Penaeus vannamei according to claim 1, characterized in that: The minimum concentrations of the three Vibrio species detected by the qRT-PCR include: Vibrio fluvialis 1.0×10 -6 nmol / L, Vibrio anguillarum 1.0×10 -7 nmol / L, Vibrio alginolyticus 1.0×10 -8 nmol / L.

5. The method for detecting three pathogenic Vibrio species of Penaeus vannamei according to claim 2, characterized in that: The gene primers include: toxR gene primer 1 forward primer TGCAAGTAAAGATCCTGATG, reverse primer GTCGTAAACAAAATGACACAA; flaA gene primer 2 forward primer TTACGCAGAAGCGGTGAT, reverse primer GCTGTTGGATGAAGGGTC; primer 3 forward primer TAGCGGATTTAGCAAGTTCAC, reverse primer TGGTCATAGTTTGCTCTCCT; pyrH gene primer 4 forward primer AAAGAACTGGTTGAACTGGGTG, reverse primer CCATCAACTTTCGTCGCTTT.

6. The method for detecting three pathogenic Vibrio species in Penaeus vannamei according to claim 5, characterized in that: The primer 2 and primer 3 include: Primer 2 was used for conventional PCR, and primer 3 was used for RT-PCR.

Images