SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of litopenaeus vannamei and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of litopenaeus vannamei and application of the SNP molecular marker, and belongs to the field of molecular marker-assisted breeding of aquatic animals. Specifically, after a target fragment located on the MEF2 gene of the litopenaeus vannamei is amplified through PCR (polymerase chain reaction), the genotype of the SNP molecular marker located on the MEF2 gene is identified by using a Sanger sequencing method or a PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method, and three genotypes of GG, GC and CC are found. Through correlation analysis of the genotype of the SNP molecular marker and the growth traits of the litopenaeus vannamei, it is found that the growth traits of the litopenaeus vannamei with the genotype of GG are superior to those of GC and CC genotypes. Therefore, the SNP molecular marker can be used as a functional site for screening litopenaeus vannamei with excellent growth traits, and the research provides data for mining litopenaeus vannamei growth traits related molecular markers.

Description

Technical Field

[0001] The invention belongs to the field of molecular marker-assisted breeding of aquatic animals, and in particular relates to a SNP molecular marker related to the growth traits of white shrimp Litopenaeus vannamei and an application thereof. Background Art

[0002] Litopenaeus vannamei, commonly known as the South American whiteleg shrimp, is one of the world's three major farmed shrimp species. Due to its many advantages, including rapid growth, strong stress resistance, high meat yield, and tolerance to high-density and low-salinity farming, it has become a major shrimp farming species in my country. Shrimp growth rate is a key factor in evaluating its quality and directly impacts farmers' profits. Currently, the majority of new Litopenaeus vannamei varieties bred independently in my country prioritize growth rate as their primary breeding objective. However, these varieties are still primarily selected based on traditional phenotypic selection, a method that is characterized by long breeding cycles, high costs, susceptibility to environmental factors, and unstable results.

[0003] In recent years, genetic improvement technologies for aquatic animals have advanced rapidly. Molecular marker-assisted breeding allows for direct selection of individuals with desired markers at the DNA level, thereby shortening the breeding cycle and improving accuracy. SNPs, third-generation molecular markers, show promising application prospects in the selective breeding of Litopenaeus vannamei due to their abundance, widespread distribution, stability, and ease of scalability and automated detection.

[0004] Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) is a molecular identification technique that combines PCR technology with nucleic acid restriction enzyme digestion technology. By using appropriate restriction endonucleases to digest PCR products of the same length, fragments of different sizes are obtained. These fragments are then differentiated by gel electrophoresis, allowing for rapid identification of SNP genotypes.

[0005] Myocyte enhancer factor 2 (MEF2) is a specific transcription factor. The gene family consists of four members: MEF2A, MEF2B, MEF2C, and MEF2D. It has DNA-binding properties and can bind to related genes to regulate the proliferation and differentiation of muscle cells, stem cells, neurons, and lymphocytes. Studies have shown that MEF2 may be a potential gene affecting the growth rate of Litopenaeus vannamei. Summary of the Invention

[0006] The results of this study clarified the SNP site in the MEF2 gene of Penaeus vannamei and discovered its association with the growth traits of Penaeus vannamei, providing a technical method for using this SNP site to select new varieties of Penaeus vannamei with fast growth.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a SNP molecular marker associated with growth traits of Litopenaeus vannamei, wherein the SNP molecular marker is SNP1;

[0009] The molecular marker SNP1 is located at 450 bp of the nucleotide sequence shown in SEQ ID NO. 1, and has three genotypes: GG, GC, and CC.

[0010] Furthermore, the weight, total length, body length and cephalothorax length of the vannamei shrimp individuals with the GG genotype are significantly higher than those of the individuals with the GC and CC genotypes, that is, the vannamei shrimp individuals with the GG genotype are selected as reserve parents for breeding.

[0011] In a second aspect, the present invention provides a detection primer pair, wherein the nucleotide sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0012] In a third aspect, the present invention provides the use of the detection primers in preparing products for detecting growth traits related to Litopenaeus vannamei.

[0013] In a fourth aspect, the present invention provides a method for evaluating the growth traits of Penaeus vannamei, comprising performing PCR amplification on the target fragment of the MEF2 gene using the primers, detecting the genotype of the molecular marker SNP1 by Sanger sequencing, and selecting Penaeus vannamei individuals with a genotype of GG for retention.

[0014] Furthermore, the PCR amplification reaction system is as follows: total volume 25 μL, ddH2O 8.5 μL; 2×Accurate Taq premix 12.5 μL; 10 mM upstream primer 1 μL; 10 mM downstream primer 1 μL; DNA template 2 μL;

[0015] The PCR amplification reaction procedure is as follows: a. pre-denaturation at 94°C for 10 min; b. 35 cycles of chain reaction, including: denaturation at 94°C for 1 min, annealing at 62°C for 1 min, and extension at 72°C for 1 min; c. final extension at 72°C for 10 min.

[0016] In a fifth aspect, the present invention also provides a method for evaluating the growth traits of Penaeus vannamei, comprising performing PCR amplification on the target fragment of the MEF2 gene using the primers, the reaction system, and the reaction procedure, detecting the genotype of the molecular marker SNP1 by a PCR-RFLP detection method, and selecting Penaeus vannamei individuals with a genotype of GG for retention.

[0017] Furthermore, the enzyme digestion reaction system in the PCR-RFLP detection method is: total volume 10 μL, PCR product 6 μL; XcmI enzyme 0.2 μL; 10×rCutSmartBuffer 1 μL; ddH2O 2.8 μL; the enzyme digestion reaction program is 37°C for 2 hours.

[0018] In a sixth aspect, the present invention also provides a PCR detection kit for evaluating the growth traits of Penaeus vannamei, the kit comprising the detection primers, 2×Accurate Taq premix and ddH2O; the kit is used to detect the genotype of the molecular marker SNP1 using the Sanger sequencing method.

[0019] In a seventh aspect, the present invention also provides an enzyme digestion reaction kit for evaluating the growth traits of Penaeus vannamei, the kit comprising the detection primers, 2×Accurate Taq premix, ddH2O, XcmI enzyme and 10×rCutSmartBuffer; the kit is used to detect the genotype of the molecular marker SNP1 using the PCR-RFLP detection method.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker significantly associated with the growth traits of Litopenaeus vannamei and develops a rapid growth trait assessment kit based on this SNP marker. This kit can be used in the selective breeding of new Litopenaeus vannamei fast-growing varieties, shortening the breeding cycle and reducing breeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the electrophoresis diagram of the PCR product of the MEF2 gene of Litopenaeus vannamei in Example 1.

[0023] Figure 2 This is the sequencing peak diagram of the three genotypes GG, GC and CC of the MEF2 gene SNP1 molecular marker in Example 1.

[0024] Figure 3 It is the XcmI restriction endonuclease cleavage site and SNP1 molecular marker on the MEF2 gene of Litopenaeus vannamei in Example 4.

[0025] Figure 4 This is the XcmI enzyme electrophoresis diagram of the three genotypes of the SNP1 molecular marker of the MEF2 gene of the vannamei shrimp in Example 4. DETAILED DESCRIPTION

[0026] To better illustrate the present invention, the following embodiments are listed. Obviously, the embodiments described are only part of the present invention, not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without making any creative efforts are also within the scope of protection of the present invention.

[0027] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0028] Example 1 Preliminary mining of SNP molecular markers associated with growth traits of the MEF2 gene of Litopenaeus vannamei

[0029] 1. Collection of phenotypic data related to growth traits of Litopenaeus vannamei

[0030] 1,000 postlarvae (L. vannamei) were selected from the breeding population of Fujian Dongfang Liyang Seedling Breeding Co., Ltd. After stabilization for three days, they were divided into two groups and transferred to two cement ponds for six months of culture. Both ponds were maintained under identical culture conditions. After the culture period, 100 L. vannamei from pond one were randomly selected for growth measurement and muscle tissue sampling. Growth parameters measured included weight (g), total length (cm), body length (cm), carapace length (cm), and meat yield (%). Muscle tissue samples collected from each L. vannamei were stored in anhydrous ethanol for future use.

[0031] 2. Obtaining genomic DNA of Litopenaeus vannamei

[0032] The genomic DNA of muscle tissue of 100 Litopenaeus vannamei in step 1 was extracted using a marine animal tissue DNA extraction kit (Beijing Tiangen). The specific extraction method was referred to the kit instructions. After passing the quality inspection, the DNA was stored in a -80°C refrigerator.

[0033] 3. PCR Amplification and Sequencing of MEF2 Gene in Mixed Pools of Litopenaeus vannamei

[0034] The base sequence of the MEF2 gene of Litopenaeus vannamei was found in the Ensembl Metazoa database (Gene: LOC113807011, Transcript: XM_027358156.1), and the following primers (as shown in Table 1) were designed using Primer Premier 5.0 software. The primers were synthesized by Guangzhou Tianyi Huiyuan Biotechnology Co., Ltd.

[0035] Table 1 Primer sequences

[0036]

[0037] 1 μL of each genomic DNA sample from 100 Litopenaeus vannamei in step 2 was taken and mixed to prepare a DNA pool sample. This DNA pool sample was used as a template for pool PCR amplification.

[0038] The PCR reaction system (25 μL) consisted of: 8.5 μL of ddH2O; 12.5 μL of 2× Accurate Taq premix; 1 μL of 10 mM upstream primer; 1 μL of 10 mM downstream primer; and 2 μL of DNA template. The upstream and downstream primer sequences are shown in Table 1.

[0039] The PCR amplification procedure was as follows: a. pre-denaturation at 94°C for 10 min; b. 35 cycles of chain reaction, including: denaturation at 94°C for 1 min, annealing at 62°C for 1 min, and extension at 72°C for 1 min; c. final extension at 72°C for 10 min.

[0040] After the PCR product is qualified by agarose gel electrophoresis (such as Figure 1 Sanger sequencing was performed, and SeqMan software was used to observe whether the sequencing peak graph contained overlapping peaks.

[0041] 4. Screening of SNP Molecular Markers in MEF2 Gene of Litopenaeus vannamei

[0042] This mixed pool sequencing revealed an overlapping peak located at 450 bp of the nucleotide sequence shown in SEQ ID NO. 1, located at base 162 of exon 8 of the MEF2 gene, where a G mutation occurred to a C, namely E8-162, recorded as SNP1.

[0043] >SEQ ID NO.1

[0044] CAGACGGCGAGCAAGACTACACC(SEQ ID NO.2)CTGAACCCCACGC ACCGAGGCCAAGTACAACAAGATTGATGAGGAATTTACACTCATGATGCAGCGTAACCAGATCAACGGAGGCACTCGAGTGAGTTTAGAGTTCGTGTTGGGGAAGGGAATGGTGGATATTCTGTGAATGTCAATTATTGTGAAAATATATATTTTTGCTCTGATGTATATTTTGTATTCTGTTATGCATATAGATATTTTTGTACA CTCCATGAACTCCGAAATTAATCTTGCCGACTGGCATTAAACTTAGCCCTATCTTGCGGCACAGCAACCGGTGGGACTGAACAACTACAACATGGCCGTGACCGTTCCCGTAAACAACACCGCGTATGACCCGGCCCTCATGCAGCCGTCGCCGCAAATGTCTCACGCCTCACTGTCCCCGCGCCCCGGATCCTCCAGTGGGATGCT G(C) GACATGAACGGTTCCAACGGCTACCCCGGCTCGACGTCGCCTCTGCCCCAGGGAGGAGCGCCCTCGCCTGGACTCCTCTCCGACCGCACTCCTCTAAGACCCACTCGCCTACCAGACCGAACCTCCGCGTCCACATCCCAAACCCTCAAGGACAGACGGTA (SEQ ID NO. 3)CGTTGCTGCTGCTCTCCGATAC

[0045] Note: SEQ ID NO.1 shows the PCR-amplified MEF2 gene sequence, SEQ ID NO.2 and SEQ ID NO.3 show the upstream and downstream primer sequences, and the underlined positions show the mutated SNP molecular markers.

[0046] Example 2 In-depth analysis of SNP molecular markers associated with growth traits of the MEF2 gene of Litopenaeus vannamei

[0047] 1. Single-sample PCR amplification and sequencing of the MEF2 gene of Litopenaeus vannamei

[0048] PCR amplification was performed using 100 genomic DNA samples extracted from Example 1 as templates. PCR primers, PCR reaction conditions, and system composition were the same as in Example 1. After the PCR products passed quality inspection, Sanger sequencing was performed to determine the genotype of the SNP molecular markers for each shrimp. Excel software was used to calculate the gene frequency and genotype frequency of the SNP molecular marker alleles, and the chi-squared value was used to calculate the chi-squared value. 2 Popgen32 software was used to calculate genetic heterozygosity (H).

[0049] The results showed that the molecular marker SNP1 has three genotypes: GG, GC, and CC. There were 30 shrimp with the GG genotype, with a genotype frequency of 0.3; 48 shrimp with the GC genotype, with a genotype frequency of 0.48; and 22 shrimp with the CC genotype, with a genotype frequency of 0.22. The frequencies of the G and C alleles were 0.54 and 0.46, respectively. The G allele had a higher frequency than the C allele, indicating that it is a dominant gene in the population.

[0050] The genetic heterozygosity (H) of molecular marker SNP1 was 1.9901 (>0.5), which was highly polymorphic; 2 The test results showed that the χ 2 The values are all in χ 2 < 2 0.05(k-1), P>0.05, indicating that the population of Litopenaeus vannamei is in Hardy-Weinberg equilibrium. The genotype frequency and gene frequency distribution of SNP molecular markers of MEF2 gene in Litopenaeus vannamei are shown in Table 2.

[0051] Table 2 Population genetic characteristics of SNP molecular markers in MEF2 gene of Litopenaeus vannamei

[0052]

[0053] Note: 2 0.05 (df=2)=5.99, χ 2 0.01 (df=2)=9.21.

[0054] 2. Association analysis between SNP molecular marker genotypes of MEF2 gene and growth trait phenotype data of Litopenaeus vannamei

[0055] SPSS 26.0 software was used to perform association analysis on the SNP molecular marker genotypes of the 100 vannamei shrimp in Example 1 and their corresponding growth trait phenotype data.

[0056] The results showed that the weight (g), total length (cm), body length (cm), and carapace length (cm) of individuals with the GG genotype for the molecular marker SNP1 were significantly higher than those with the GC and CC genotypes. Furthermore, the meat yield (%) of individuals with the GG genotype was significantly higher than that of individuals with the GC genotype. The results of the correlation analysis between different SNP genotypes of the MEF2 gene in L. vannamei and their growth traits are shown in Table 3. The results are expressed as mean ± standard deviation.

[0057] The following inference can be made: in the selective breeding of growth traits of Penaeus vannamei, the Penaeus vannamei individuals with the genotype GG of the MEF2 gene molecular marker SNP1 should be selected as reserve parents for breeding.

[0058] Table 3 Correlation analysis between different genotypes of MEF2 gene SNP molecular markers and their growth traits in Litopenaeus vannamei

[0059]

[0060] Note: The same indicators in the same column marked with completely different letters indicate significant differences (P<0.05); those without letters indicate no significant differences (P>0.05).

[0061] Example 3 Verification of SNP Molecular Markers Related to Growth Traits of the MEF2 Gene of Litopenaeus vannamei

[0062] To further verify the inference obtained in Example 2, 100 vannamei shrimp were randomly selected from culture pond No. 2 for growth trait-related index measurement, DNA extraction and PCR amplification, sequencing to determine the genotype of the SNP molecular marker of each vannamei shrimp, and then correlation analysis was performed using SPSS26.0 software. The specific operation method was the same as that of Examples 1 and 2.

[0063] The results showed that the weight (g), total length (cm), body length (cm) and cephalothorax length (cm) of the shrimp with the molecular marker SNP1 genotype GG were significantly higher than those of the individuals with the genotypes GC and CC. The specific results are shown in Table 4.

[0064] In summary, the experimental results of Example 3 can verify the inference obtained in Example 2, that is, in the selective breeding of growth traits of Penaeus vannamei, Penaeus vannamei individuals with the genotype GG of the MEF2 gene molecular marker SNP1 should be selected as reserve parents for breeding.

[0065] Table 4 Correlation analysis between different genotypes of MEF2 gene SNP molecular markers and their growth traits in Litopenaeus vannamei

[0066]

[0067]

[0068] Note: The same indicators in the same column marked with completely different letters indicate significant differences (P<0.05); those without letters indicate no significant differences (P>0.05).

[0069] Example 4: A method for identifying SNP molecular marker genotypes associated with growth traits of Litopenaeus vannamei

[0070] 1. Screening of enzyme cleavage sites in the MEF2 gene of Litopenaeus vannamei

[0071] Using the NEBcutter 3.0 website, we identified a restriction endonuclease XcmI cleavage site near the SNP1 marker in the MEF2 gene of Litopenaeus vannamei. This site is located between bp 444 and 445 of the nucleotide sequence shown in SEQ ID NO. 1, and its recognition sequence is CCANNNNN (cleavage site) NNNNTGG. This means that when the SNP1 marker genotype is GG, the PCR amplification product can be digested by the enzyme. Agarose gel electrophoresis reveals two bands, 444 bp and 191 bp, respectively, confirming the GG genotype.

[0072] 2. Amplification of the target fragment of the MEF2 gene of Litopenaeus vannamei

[0073] The genomic DNA of 100 Litopenaeus vannamei in Example 1 was used as a template, and the primers, PCR reaction system and reaction conditions described in Example 1 were used to amplify the target fragment of the MEF2 gene of these 100 Litopenaeus vannamei.

[0074] 3. PCR-RFLP method to identify the molecular marker SNP1 genotype

[0075] The PCR products of the MEF2 gene from 100 Litopenaeus vannamei shrimp obtained in step 2 were digested using the restriction endonuclease XcmI. The digestion system (10 μL) consisted of: 6 μL of PCR product; 0.2 μL of XcmI; 1 μL of rCutSmart Buffer (10×); and 2.8 μL of ddH2O. Samples were added according to the above system composition and incubated at 37°C for 2 h. The digestion results were then analyzed by agarose gel electrophoresis.

[0076] When there are two bands with sizes of 444 bp and 191 bp, respectively, the genotype of the SNP1 molecular marker for that particular L. vannamei is GG. When there are three bands with sizes of 635 bp, 444 bp, and 191 bp, respectively, the genotype of the SNP1 molecular marker for that particular L. vannamei is GC. When there is one band with a size of 635 bp, the genotype of the SNP1 molecular marker for that particular L. vannamei is CC. The genotypes of the SNP1 molecular marker for these 100 L. vannamei were obtained by counting the enzyme digestion results of these 100 L. vannamei shrimp and compared with the genotypes of the SNP1 molecular marker for these 100 L. vannamei shrimp obtained by Sanger sequencing in Example 2. The two results were completely consistent, indicating that this method can serve as an alternative to Sanger sequencing for identifying SNP loci associated with growth traits in L. vannamei.

[0077] Example 5 A method for evaluating the growth traits of Litopenaeus vannamei

[0078] 1. Obtaining genomic DNA of the shrimp Litopenaeus vannamei to be tested

[0079] Genomic DNA was extracted from the swimmers or tail fan tissue of the Litopenaeus vannamei shrimp to be tested using a Marine Animal Tissue DNA Extraction Kit (Beijing Tiangen). The extraction steps were followed according to the kit's instructions. The genomic DNA was quality-tested and set aside.

[0080] 2. PCR amplification of the target fragment of the MEF2 gene of the shrimp to be tested

[0081] Using the DNA of the shrimp Penaeus vannamei to be tested as a template, and using the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 in Example 1 as upstream and downstream primers, PCR amplification was performed according to the PCR reaction system and reaction procedure in Example 1. The PCR product was qualified after quality inspection and set aside.

[0082] 3. Sanger sequencing to identify the genotype of molecular marker SNP1

[0083] The PCR product was sequenced by Sanger sequencing to identify the genotype of the molecular marker SNP1 of the MEF2 gene of the tested shrimp Litopenaeus vannamei.

[0084] 4. Result determination

[0085] When the genotype of the MEF2 gene molecular marker SNP1 is GG, the individual can be retained as a shrimp individual with excellent growth traits.

[0086] Example 6 A simple method for evaluating the growth traits of Litopenaeus vannamei

[0087] 1. Obtaining genomic DNA of the shrimp Litopenaeus vannamei to be tested

[0088] Same as step 1 in Example 5.

[0089] 2. PCR amplification of the target fragment of the MEF2 gene of the shrimp to be tested

[0090] Same as step 2 of Example 5.

[0091] 3. PCR-RFLP sequencing to identify the genotype of molecular marker SNP1

[0092] The PCR product in step 2 was subjected to an enzyme digestion experiment, and the enzyme digestion reaction system and conditions were the same as those in step 3 of Example 4.

[0093] 4. Result determination

[0094] When the number of bands detected by electrophoresis of the enzyme digestion product is two and the band sizes are 444 bp and 191 bp respectively, the genotype of the molecular marker SNP1 of the tail of the vannamei shrimp is GG, and the individual can be retained as an individual of the vannamei shrimp with excellent growth traits.

[0095] Example 7 A PCR kit for evaluating growth traits of Litopenaeus vannamei

[0096] 1. Composition: upstream and downstream primers, 2×Accurate Taq premix and ddH2O

[0097] The upstream and downstream primer sequences are as follows:

[0098] MEF2-F: CAGACGGCGAGCAAGACTACACC (SEQ ID NO. 2);

[0099] MEF2-R: GTATCGGAAGAGCAGCAGCAACG (SEQ ID NO.3);

[0100] 2. Usage: The method of using the kit is the same as that in Example 5.

[0101] Example 8: A rapid enzymatic reaction kit for evaluating growth traits of Litopenaeus vannamei

[0102] 1. Composition: upstream and downstream primers, 2× Accurate Taq premix, XcmI enzyme, rCutSmartBuffer (10×) and ddH2O.

[0103] The upstream and downstream primer sequences are as follows:

[0104] MEF2-F: CAGACGGCGAGCAAGACTACACC (SEQ ID NO. 2);

[0105] MEF2-R: GTATCGGAAGAGCAGCAGCAACG (SEQ ID NO.3);

[0106] 2. Usage: The method of using the kit is the same as that in Example 6.

[0107] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with growth traits of Litopenaeus vannamei, characterized in that: The SNP molecular marker is SNP1; The molecular marker SNP1 is located at 450 bp of the nucleotide sequence shown in SEQ ID NO. 1, and has three genotypes: GG, GC, and CC.

2. The molecular marker according to claim 1, characterized in that The weight, total length, body length and cephalothorax length of the vannamei shrimp individuals with the GG genotype are significantly higher than those of the individuals with the GC and CC genotypes, that is, the vannamei shrimp individuals with the GG genotype are selected as reserve parents for breeding.

3. A detection primer, characterized in that The nucleotide sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. Use of the detection primer according to claim 3 in preparing a product for detecting growth traits related to Litopenaeus vannamei.

5. A method for evaluating the growth traits of Penaeus vannamei, characterized in that: The target fragment of the MEF2 gene is amplified by PCR using the primers described in claim 3, the genotype of the molecular marker SNP1 described in any one of claims 1-2 is detected by Sanger sequencing, and the shrimp individuals with the genotype of GG are selected for retention.

6. The method according to claim 5, characterized in that The PCR amplification reaction system is as follows: total volume 25 μL, ddH2O 8.5 μL; 2×Accurate Taq premix 12.5 μL; 10 mM upstream primer 1 μL; 10 mM downstream primer 1 μL; DNA template 2 μL; The PCR amplification reaction procedure is as follows: a. pre-denaturation at 94°C for 10 min; b. 35 cycles of chain reaction, including: denaturation at 94°C for 1 min, annealing at 62°C for 1 min, and extension at 72°C for 1 min; c. final extension at 72°C for 10 min.

7. A method for evaluating the growth traits of Penaeus vannamei, characterized in that: The target fragment of the MEF2 gene is amplified by PCR using the primers described in claim 3, the reaction system and the reaction procedure described in claim 6, the genotype of the molecular marker SNP1 described in any one of claims 1-2 is detected by a PCR-RFLP detection method, and the vannamei shrimp individuals with a genotype of GG are selected for retention.

8. The method according to claim 7, characterized in that: The enzyme digestion reaction system in the PCR-RFLP detection method is as follows: total volume 10 μL, PCR product 6 μL; XcmI enzyme 0.2 μL; 10×rCutSmart Buffer 1 μL; ddH2O 2.8 μL; the enzyme digestion reaction procedure is to react at 37°C for 2 hours.

9. A PCR detection kit for evaluating the growth traits of Litopenaeus vannamei, characterized in that: The kit comprises the detection primers according to claim 3, 2×Accurate Taq premix and ddH2O; the kit is used to detect the genotype of the molecular marker SNP1 using the Sanger sequencing method according to any one of claims 5-6.

10. A enzyme digestion reaction kit for evaluating the growth traits of Litopenaeus vannamei, characterized in that: The kit comprises all the reagents described in claim 9, XcmI enzyme and 10×rCutSmartBuffer; the kit is used to detect the genotype of the molecular marker SNP1 using the PCR-RFLP detection method described in any one of claims 7-8.

Images