Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

3108 results about "Pcr method" patented technology

Real Time PCR. Polymerase Chain Reaction (PCR) is a molecular cloning method used to analyze a short sequence of DNA which is present in minimal quantities in the samples containing some genetic material. The technique has been often called ‘DNA photocopier’.

PCR method

A method for balancing multiplexed PCR methods is provided. In the method, two or more sequential temporal PCR stages are used to effectively separate two or more PCR reactions in a single tube as an alternative to primer limiting to modulate the relative rate of production of a first amplicon by a first primer set and a second amplicon by a second primer set during the first and second amplification stages. Also provided are rapid RT-PCR methods that find particular use in intraoperative diagnoses and prognoses, for instance in diagnosing malignant esophageal adenocarcenoma by determining expression levels of carcinoembryonic antigen (CEA) in sentinel lymph nodes.
Owner:UNIVERSITY OF PITTSBURGH

Highly Multiplex PCR Methods and Compositions

The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons.
Owner:NATERA

Nano-PCR: methods and devices for nucleic acid amplification and detection

Methods, devices, and compositions are described that provide for amplification of nucleic acid sequences without reliance upon temperature cycling, thus freeing the methods from conventional benchtop thermal cycling devices. Denaturation of double stranded nucleic acids, primer annealing, and precision control over primer extension by polymerase can be accomplished by applying stress to a nucleic acid. These methods can provide one ore more benefits over conventional PCR methods including: precision control over the PCR process; generally improved fidelity; improved accuracy over problematic sequences such as GC-rich or tandem repeat regions; greater sequence length; increased reaction yield; reduced experimental time; greater efficiency; lower cost; greater portability; and, robustness to various environmental parameters, such as temperature, pH, and ionic strengths.
Owner:NANOBIOSYM INC

Highly multiplex PCR methods and compositions

The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons.
Owner:NATERA

Pcr method by electrostatic transportation, hybridization method for electrostatic transportation and devices therefor

To provide a PCR method utilizing electrostatic transportation which allows separate control of individual DNA-containing droplets by accurately transporting the droplets, suitably controlling the temperature thereof and allowing a primer to react therewith; a hybridization method utilizing electrostatic transportation which allows rapid and easy detection of hybridization; and devices therefor. A biological sample (droplets containing DNA and primer) (9) is prepared in a chemically inert liquid layer (8), is electrostatically transported by the action of an electrostatic transportation plate (1) with electrostatic transportation electrodes (2) and is heated at a predetermined position of the electrostatic transportation plate (1), thus carrying out PCR.
Owner:JAPAN SCI & TECH CORP

Quantitative multiplex methylation-specific PCR

ActiveUS20050239101A1Enhancing discriminatory powerIncrease assay specificitySugar derivativesMicrobiological testing/measurementPcr methodBiology
Methods are provided for diagnosing in a subject a condition, such as a carcinoma, sarcoma or leukemia, associated with hypermethylation of genes by isolating the genes from tissue containing as few as 50 to 1000 tumor cells. Using quantitative multiplex methylation specific PCR (QM-MSP), multiple genes can be quantitatively evaluated from samples usually yielding sufficient DNA for analyses of only 1 or 2 genes. DNA sequences isolated from the sample are simultaneously co-amplified in an initial multiplex round of PCR, and the methylation status of individual hypermethylation-prone gene promoter sequences is then determined separately or in multiplex using a real time PCR round that is methylation status-specific. Within genes of the panel, the level of promoter hypermethylation as well as the incidence of promoter hypermethylation can be determined and the level of genes in the panel can be scored cumulatively. The QM-MSP method is adaptable for high throughput automated technology.
Owner:THE JOHN HOPKINS UNIV SCHOOL OF MEDICINE

Nano-PCR: methods and devices for nucleic acid amplification and detection

Methods, devices, and compositions are described that provide for amplification of nucleic acid sequences without reliance upon temperature cycling, thus freeing the methods from conventional benchtop thermal cycling devices. Denaturation of double stranded nucleic acids, primer annealing, and precision control over primer extension by polymerase can be accomplished by applying stress to a nucleic acid. These methods can provide one ore more benefits over conventional PCR methods including: precision control over the PCR process; generally improved fidelity; improved accuracy over problematic sequences such as GC-rich or tandem repeat regions; greater sequence length; increased reaction yield; reduced experimental time; greater efficiency; lower cost; greater portability; and, robustness to various environmental parameters, such as temperature, pH, and ionic strengths.
Owner:NANOBIOSYM INC

Compositions and methods for detection of nucleic acid mutations

The invention provides methods and compositions for detecting a mutation in a target gene in a sample of blood or a fraction thereof, including in certain examples, a fraction that includes circulating tumor DNA. The methods can include a tiling PCR reaction, for example a one-sided multiplex tiling reaction. Virtually any type of mutation can be detected with the methods and compositions. In certain embodiments, gene fusions are detected. Improved PCR methods, especially for performing nested multiplex PCR reactions are provided.
Owner:NATERA

PCR and hybridization methods utilizing electrostatic transportation and devices therefor

To provide a PCR method utilizing electrostatic transportation which allows separate control of individual DNA-containing droplets by accurately transporting the droplets, suitably controlling the temperature thereof and allowing a primer to react therewith; a hybridization method utilizing electrostatic transportation which allows rapid and easy detection of hybridization; and devices therefor. A biological sample (droplets containing DNA and primer) (9) is prepared in a chemically inert liquid layer (8), is electrostatically transported by the action of an electrostatic transportation plate (1) with electrostatic transportation electrodes (2) and is heated at a predetermined position of the electrostatic transportation plate (1), thus carrying out PCR.
Owner:JAPAN SCI & TECH CORP

PCR and hybridization methods utilizing electrostatic transportation and devices therefor

To provide a PCR method utilizing electrostatic transportation which allows separate control of individual DNA-containing droplets by accurately transporting the droplets, suitably controlling the temperature thereof and allowing a primer to react therewith; a hybridization method utilizing electrostatic transportation which allows rapid and easy detection of hybridization; and devices therefor. A biological sample (droplets containing DNA and primer) (9) is prepared in a chemically inert liquid layer (8), is electrostatically transported by the action of an electrostatic transportation plate. (1) with electrostatic transportation electrodes (2) and is heated at a predetermined position of the electrostatic transportation plate (1), thus carrying out PCR.
Owner:JAPAN SCI & TECH CORP

Method for quickly detecting microbial dna/rna, kit therefor and the use of said method

A method for identifying microbial DNA / RNA comprising providing a sample containing microbial DNA / RNA; enriching DNA / RNA in the sample by a PCR method wherein the DNA / RNA that is identified comprise copies which are amplified by the PCR method; preliminarily classifying at least one microorganism by identifying the microbial DNA / RNA by a melting curve; adding at least one labeled oligonucleotide whereby temperature-dependent hybridization takes place and identifying the DNA / RNA on the basis of a physical property of the resultant DNA / RNA oligonucleotide complex, such as the temperature-dependence of the hybridization.
Owner:ROCHE DIAGNOSTICS OPERATIONS INC

PCR method for amplifying a gene using metallic sample container having inner surface coated with a resin or metal oxide

A sample container for heating a sample stored therein includes a resin layer on the whole inner surface of the container made of metal having a thickness ranging from 0.02 mm to 1.0 mm and the resin layer having a thickness ranging from 1 mu m to 100 mu m. A sample container for heating a sample stored therein includes a metal oxide layer on at least the whole inner surface of the container made of metal having a thickness ranging from 0.02 mm to 1.0 mm.
Owner:NGK INSULATORS LTD

Method for preparing II-type pig's ring-virus nucleic vaccine and the use thereof

The invention discloses a manufacturing method and application of II type pig ring virus nucleic acid vaccine. The method is: 1) designs the specific primer, uses PCV2 Hangzhou (HZ201) gene group as template, closes ORF1, ORF2, ORF3 and ORF4 genes of PCV-2 with PCR method, and they are constructed into eucaryon expressing carrier with pCI-neo; 2) separates the pig external blood single nucleus cell, clones the genes IFN, IL-2 and IL-4 with RT-PCR method, and they are constructed into eucaryon expressing carrier with pCI-neo; 3) based on above mentioned reconstructed carrier, constructs the fused expressing carrier of the other genes of PCV2, ORF2 and PCV2 or pig cell factor gene; the merits of the invention lie in: (1) it needs not to culture virus, the producing period is short; (2) it needs not cell culture, thus can prevent the contamination from other pig source virus; (3) it does not express the pathogenesis protein which is harmful to body, the safety is high. (4) it can activates body secretion and cell immunity replay at the same time.
Owner:ZHEJIANG UNIV

Universal RT-coupled PCR method for the specific amplification of mRNA

The invention relates to a novel Universal RT-coupled PCR strategy for the specific detection and accurate quantitation of mRNA. Claimed and disclosed are novel Universal reverse transcription (RT) primers, a specific primer mix containing the Universal RT-primers, a transcript specific forward primer and a reverse PCR primer identical to a unique tag sequence, and methods and kits thereof for avoiding the amplification of genomic DNA and / or pseudogenes.
Owner:HEALTH RES INC

Kit for detecting polymorphic site genetic typing of key enzyme genes of folic acid metabolism and detection method thereof

The invention provides a method for typing three sites of key enzyme genes (MTHFR and MTRR) for folic acid metabolism by utilizing a fluorescence labeling probe and combining with a multiple PCR method. An amplimer and a fluorescent probe are designed according to MTHFR and MTRR genes; three sections of DNA sequences are detected in the amplification of a PCR amplifier; fluorescence signals which are released in amplification and dissolution processes in a reaction system are detected; a result is judged in the manner of (1) judging a typing result according to a Tm value shown by a hybrid peak of wild type and mutant type standard plasmids and (2) simultaneously typing according to the magnitude of a fluorescence value of an amplification curve. The primer and the probe adopted by the invention are high in specificity and sensitivity; the detection for three sites is simultaneously performed; the operation is simple and the result is easily judged; the typing result is more accurate and reliable in the manner of twice calibrating typing. The method provided by the invention can be applied to the aspects of guiding the pregnant woman to orally take and supplement folic acid, prompting the high risk in cerebral apoplexy, coronary heart disease and venous thrombus, assessing the metabolic activity of folic acid, and the like.
Owner:上海蕴亲基因科技有限公司

Identifying and quantifying small RNAs

One-step RT-PCR methods, compositions and kits for the detection and quantification of small RNAs in a sample are disclosed. The one-step RT-PCR approach involves polyadenylation of a small RNA followed by reverse transcription with a first primer containing a poly(T) sequence and at least two 3′ nucleotides complementary to the 3′ terminal end nucleotides of the small RNA, to produce a cDNA. This may be followed by PCR amplification using the same first primer as the revere primer and a second, forward primer in which a portion of its sequence is complementary to the 3′ terminal end of the cDNA. This may be then followed by detection and / or quantification of the amplified product.
Owner:NORTH CAROLINA STATE UNIV

Cotton promoter GbU6-7PS and application

The invention provides a cotton promoter GbU6-7PS and application. The nucleotide sequence of the promoter is as shown in SEQ ID NO.1, and the nucleotide sequence of a complementary strand of the promoter is as shown in SEQ ID NO.2. The cotton promoter GbU6-7PS is obtained by conducting the first turn of PCR amplification so as to obtain a segment which covers full-length GbU6-7 promoter sequence, so that GbU6-7P is obtained; and then, conducting the second turn of PCR amplification, taking the GbU6-7P as a donor plasmid template and GbU6-5P::GUS as an acceptor plasmid template, and truncating and cloning the GbU6-7 promoter by virtue of Transfer PCR method, so that the cotton promoter GbU6-7PS is obtained. The cotton promoter GbU6-7PS disclosed by the invention is not only applicable to cotton, but also quite short in segment which is just 190bp long, conforming to the requirement of a CRISPR / Cas9 genome editing vector, the transcriptional level of sgRNA is significantly improved, and subsequently a genome editing efficiency may be increased.
Owner:XINJIANG AGRI UNIV

Nucleic acid sequence detection using multiplexed oligonucleotide PCR

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.
Owner:LOS ALAMOS NATIONAL SECURITY

Multiple real time fluorescence quantifying PCR method for detecting porcine circovirus, porcine parvovirus, porcine pseudorabies virus and classical swine fever virus

The invention discloses a multiplex real-time fluorescent quantitation PCR method capable of detecting porcine circovirus, porcine parvovirus, porcine pseudorabies virus and hog cholera virus at the same time. The method of the invention detects that the four virus are all in good linear relations at the same time, all ten times serial dilution points of constructed normal plasmid are all in one straight line, CT value and copy number are in good linear relation, and regression analysis shows that the related coefficient of the CT value and the copy number is R<2> more than 0.99.The multiplex real-time fluorescent quantitation PCR method has the advantages of excellent specificity, sensibility and stability, which can rapidly, sensitively and differentially detect the four virus with serious harm to the economy and can be used for early diagnosis of virus infection.
Owner:HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI

Real-time fluorescence quantitative PCR (Polymerase Chain Reaction) kit for detecting expression level of HER2 genes

The invention provides a real-time fluorescence quantitative PCR (Polymerase Chain Reaction) kit for detecting the expression level of HER2 genes and relates to a PCR kit. The real-time fluorescence quantitative PCR kit comprises PCR reaction liquid of the HER2 genes, PCR reaction liquid of ACTB genes, a Taq enzyme system, a control product and a packaging object; and the adopted primer is an annular primer, 3-8 self-designed basic groups are at the 5' end, and can be combined with the sequence at the 3' end under proper conditions so as to form double chains. The real-time fluorescence quantitative PCR kit has the advantages that the non-specific amplification products especially primer dimer generated by nonspecific amplification products especially the primer can be effectively prevented from being formed, the specificity is increased; and a relative-quantitative RT-PCR method is utilized for detecting the expression level of the HER2 genes of a patient with the breast cancer, adopts a 2-delta deltaCt value method for quantifying the detected result, and can be used for diagnosis of early stage and transferring of the breast cancer and assisting multiple fields such as clinicalmedicine selection and prognosis.
Owner:XIAMEN UNIV

Multiplex rt-pcr/pcr for simultaneous detection of bovine coronavirus, bovine rotavirus, cryptosporidium parvum, and escherichia coli

InactiveUS20050026144A1Rapid and sensitive and specificRapid and sensitive and detectionSugar derivativesMicrobiological testing/measurementBovine rotavirusEscherichia coli
The present invention provides a multiplex RT-PCR / PCR method, which enables in a single assay the simultaneous detection of any combination of bovine rotavirus, bovine coronavirus, Cryptosporidium parvum, and optionally, Escherichia coli strains producing K99 pili or heat-stable enterotoxin STa.
Owner:BOARD OF TRUSTEES OPERATING MICHIGAN STATE UNIV

Cotton promoter GbU6-5PS and application

The invention provides a cotton promoter GbU6-5PS and application. The positive and negative chains of the cotton promoter GbU6-5PS are as shown in SEQ ID NO.1 and SEQ ID NO.2. The promoter is obtained by conducting the first turn of PCR amplification so as to obtain a segment which covers full-length GbU6-5 promoter sequence; and then, conducting the second turn of PCR amplification, taking the GbU6-5P as a donor plasmid template and AtU6-26SK as an acceptor plasmid template, and truncating and cloning the GbU6-5P promoter by virtue of Transfer PCR method, so that the cotton promoter GbU6-5PS is obtained. The cotton promoter GbU6-5PS disclosed by the invention is not only applicable to cotton, but also quite short in segment which is just 105bp long, conforming to the requirement of a CRISPR / Cas9 genome editing vector, the transcriptional level of sgRNA is significantly improved, and subsequently a genome editing efficiency may be increased.
Owner:XINJIANG AGRI UNIV

Multiple PCR method based on selective probe and application thereof

The present invention relates to nucleic acid amplification, and is especially multiple PCR process based on selective probe for simultaneous amplification of several nucleic acid segments and its application. The multiple PCR process includes the following steps: 1. constructing selective probe; 2. extension-coupling reaction; 3. PCR amplification; and 4. detecting PCR amplification product. The present invention features the selective probe and the PCR amplification product with difference in length. The process has greatly increased analysis flux, saving in the nucleic acid template consumption for detecting the sample, high compatibility of the detection system and other advantages.
Owner:THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA

Universal RT-coupled PCR method for the specific amplification of mRNA

InactiveUS20030186288A1Genomic DNA amplification is avoidedSugar derivativesMicrobiological testing/measurementForward primerSpecific detection
The invention relates to a novel Universal RT-coupled PCR strategy for the specific detection and accurate quantitation of mRNA. Claimed and disclosed are novel Universal reverse transcription (RT) primers, a specific primer mix containing the Universal RT-primers, a transcript specific forward primer and a reverse PCR primer identical to a unique tag sequence, and methods and kits thereof for avoiding the amplification of genomic DNA and / or pseudogenes.
Owner:HEALTH RES INC

Tongue sole molecular marker auxiliary sex control method

The invention relates to a tongue sole molecule marker auxiliary sex control method, comprising the following steps: screening and clone of the female tongue sole specific AFLP marker, a construction of tongue sole genetic sex identification PCR method, preparation of pseudo male tongue sole, and feminization fingerling producing method utilizing pseudo male tongue sole; the female tongue sole specific AFLP marker is screened; the pseudo male tongue sole stimulation method and the pseudo male tongue sole identification method utilizing female specific molecule marker are constructed. The tongue sole molecule marker auxiliary sex control method firstly constructs the method that adopts the AFLP molecule marker and the sex reversing technique to control the sex of tongue sole and further to raise the feminization fry ratio, wherein, the ratio of the female fish in the tongue sole fries is increased by 20 to 25%. The tongue sole molecule marker auxiliary sex control method has the advantages of high efficiency, high accuracy, good reliability, important application value in the sex control and unisexual fingerling production of tongue sole, and potential application in the sex control and unisexual fingerling production of other fish.
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

Inherited metabolic disease screening method and reagent kit

The invention provides an inherited metabolic disease screening method and a reagent kit. The method includes the steps that following libraries are built, according to each encoding sequence of inherited metabolic disease associated disease-causing genes and the principle of sequence reverse complement, from 5' to 3', a probe sequence with the length being 120 bp starts to be designed from the first basic group, and besides, 60 bp superposition exists between every two adjacent probe sequences; a TAGGTGTGTAGGCGC sequence and a GTCAGCTAGTACGCA sequence are added to the 5' end and the 3' end of each probe sequence respectively; by the adoption of the oligonucleotide in-situ synthesis technology, large-scale synthesis of oligonucleotides is carried out on a chip; the oligonucleotides on the chip are eluted through ammonia water and dissolved in water to form an oligonucleotide mixture; through the PCR method, forward primers (TTAGATAGGTGTGTAGGCGC) and reverse primers (TAAGGTGCGTACTAGCTGAC) provided with biotin labels at the 5' ends are adopted, the oligonucleotide mixture is amplified, and an inherited metabolic disease associated disease-causing gene DNA probe library with the biotin labels is formed.
Owner:艾吉泰康(嘉兴)生物科技有限公司

East-Asia scorpion antibiotic peptide gene and preparation method and application

ActiveCN101063102AHigh antibacterial activitySimple and efficient approach to molecular designAntibacterial agentsBacteriaChemical synthesisCDNA library
The invention discloses a preparing method of east Asia Tityus antibiotic peptide gene and appliance, which comprises the following steps: restructuring bacillus coli Escherichia coli DH5a / BmKAMP1, CCTCC NO: M207036; constructing east Asia Tityus ioterium cell cDNA library; choosing PCR method; sieving positive colony of scorpion antibiotic peptide gene from ioterium cDNA library; sequence-analyzing coding trait of antibiotic peptide gene; assuring amino acid sequence of the antibiotic peptide gene; adopting chemosynthesis antibiotic peptide; possessing inhibition of diverse density for Gram's bacterium. This antibiotic peptide possesses specificity and high active, which can be used as antibacterial drugs.
Owner:唐克煌

Multiplex PCR method for distinguishing four meat components in food at the same time

The invention belongs to the technical field of food quality and safety detection and particularly relates to a method for rapidly detecting pork, beef, mutton and chicken components in food at the same time through animal genomic DNA (deoxyribonucleic acid) extraction, primer design and UP-M-PCR (universal primers-multiplex-PCR). The four meat components can be distinguished rapidly at the same time according to differential sites of mitochondrial cytochrome b of the animal by using the forward primer sharing and reverse primer specificity strategy and an M-PCR system including five primers. The result shows that the method has the advantages that the detection limit can be up to the pictogram level, the components of the reaction system are free from cross interference and the meat products on market can be detected, verified and distinguished accurately by sampling 80 meat products randomly according to the specificity of the four target meat components. In a word, the invention provides a specific, sensitive and practical multiplex PCR method for rapidly screening four common meat components in food at the same time.
Owner:NANJING INST OF PROD QUALITY INSPECTION

Fluorescence quantitative PCR reaction solution and fluorescence quantitative PCR method

ActiveCN102465120ASolve the problem of low amplification efficiencyImprove efficiencyMicrobiological testing/measurementDNA preparationBetaineFluorescence
The invention belongs to the fields of molecular biotechnology and experimental methods and specifically relates to a fluorescence quantitative PCR reaction solution. The solution is characterized by comprising a PCR reaction reinforcing agent which is one or more selected from the group consisting of dimethyl sulfoxide, glycerin, bovine serum albumin, methanamide, polyethylene glycol 6000, spermidine, ammonium sulfate and betaine, e.g., dimethyl sulphoxide, bovine serum albumin and betaine. The fluorescence quantitative PCR reaction solution further comprises heatproof DNA polymerase having 5'-3' polymerase activity and 5'-3' exonuclease activity and preferably comprises heatproof DNA polymerase and hot-start heatproof DNA polymerase, both of which having 3'-5' exonuclease activity. The invention also relates to a kit containing the reaction solution and a method of applying the reaction solution in fluorescence quantitative PCR.
Owner:BGI TECH SOLUTIONS