410 results about "Pcr method" patented technology

The invention relates to the technical field of gene engineering, in particular to a nucleic acid composition, a kit and a detection method for simultaneously and rapidly detecting 16 respiratory tract pathogens. The method specifically comprises the following steps: detecting influenza A virus, influenza B virus, novel coronavirus (ORF1ab gene, N gene), haemophilus influenzae, universal human parainfluenza virus, respiratory syncytial virus, human metapneumovirus, enterovirus, mycoplasma pneumoniae, group A streptococcus, bordetella pertussis, common coronavirus, rhinovirus, bocavirus and adenovirus; a forward primer, a reverse primer and a specific fluorescent probe of streptococcus pneumoniae. Through the PCR reaction, whether respiratory tract pathogens exist or not can be rapidly detected from a specimen at the same time, typing identification of 16 respiratory tract pathogens is carried out at the same time, and compared with a single fluorescent quantitative PCR method, the method is more convenient and rapid, and the cost is lower.

The invention provides a kit and a method for detecting common fusion genes of lymphoid leukemia based on a multiple digital PCR (Polymerase Chain Reaction) method. By constructing a synergistic effect mechanism of the primer and the fluorescent probe and optimizing matching of the primer, the probe and a fluorescent marker, non-specific binding among amplification products is effectively avoided. A composite reaction aid with a specific formula, namely a PCR enhancer, is innovatively introduced, so that the amplification efficiency and specificity of a multiple detection system are remarkably improved. According to the kit provided by the invention, the integrated detection capability on seven fluorescent channels, namely Atto 425, VIC, FAM, ROX, CY5, CY5.5 and CY7, is realized in a single-hole design. By innovatively constructing an ROX + CY5 and Atto425 + VIC dual-channel joint detection system, when the ROX and CY5 channels or Atto425 and VIC channels in the same detection hole simultaneously present positive signals, two additional detection targets can be specifically interpreted. The innovative detection strategy based on channel combination enables the kit to realize precise detection of 18 fusion genes only through two detection holes in a breakthrough manner.

The invention relates to the field of gene detection, and discloses a detection primer for an abdominal aortic aneurysm related SNP site rs116309149 and application of the detection primer, and the detection primer comprises two non-specific outer side primers and two inner side primers for specifically detecting SNP mutation sites; the outer primer has sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2 or complementary sequences of the sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the inner side primer has sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4 or complementary sequences of the sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4. According to the detection primer and the application design of the detection primer, the primer which is specifically matched with the rs116309149 site based on an ARMS-PCR method is verified, a reaction system and reaction conditions are perfected and optimized based on the detection primer, amplification and detection of a target gene are successfully completed, and the positive significance is achieved for clinic.

The invention discloses an animal-derived component identification primer based on a three-generation sequencing technology. The animal-derived component identification primer comprises a primer F as shown in SEQ ID No. 1, namely GTATGACCGCGGTGGCTGGCAC, and a primer R as shown in SEQ ID No. 2, namely CCAAACTGGGATTAGATACCC. The animal-derived component identification primer comprises a primer A, a primer B and a primer C, wherein the primer F is GTATGACCGCGGTGGCTGGCAC, and the primer C is CCAAACTGGGATTAGATACCC. Compared with a conventional DNA bar code method or a fluorescent quantitative PCR method, the primers designed by the invention can realize full-length mitochondrial amplification in different animal-derived DNAs, and the identification of animal-derived components is realized through a pair of primers, so that the detection efficiency of identification of fake animal-derived components in the field of public security food and medicine rings is improved. According to the primer pair designed by the invention, the amplification range covers all mitochondrial gene loci such as D-LOOP, COX1, COX2, COX3 and CYTB, and compared with a short fragment, the primer pair has higher species resolution.

The invention relates to the technical field of microfluidics, in particular to a PCR (polymerase chain reaction) micro-fluidic chip and a PCR method, and the PCR micro-fluidic chip comprises a renaturation extension region, a denaturation region and a low-temperature overshoot region, reaction liquid drops reach the renaturation extension region from the denaturation region through the low-temperature overshoot region; the working temperature of the low-temperature overshoot area is lower than that of the renaturation extension area. By using the micro-fluidic chip provided by the invention, in the PCR reaction process, liquid drops can be subjected to overshoot type rapid temperature change in a manner of firstly entering the low-temperature overshoot area, so that the temperature stabilization time after the liquid drops reach the renaturation extension area is reduced or eliminated, the overall time of the PCR reaction is shortened, and the PCR efficiency is improved.

The invention discloses a panda-derived feline panleucopenia virus RAA-CRISPRCas12a detection method, and belongs to the technical field of virus detection, and the panda-derived feline panleucopenia virus RAA-CRISPRCas12a detection method comprises the following steps: S1, primer and probe design; s2, screening an RAA amplification primer; s3, RAA reaction condition optimization; s4, performing RAA sensitivity and specificity verification; s5, preparing crRNA (Complementary Ribonucleic Acid); s6, optimal crRNA screening is carried out; s7, optimizing the RAA-CRISPR / Cas12a (Reverse Amplified Architecture- S8, the specificity and the sensitivity of the RAA-CRISPR / Cas12a are verified; s9, clinical sample detection; according to the invention, by elaborately designing a primer and a probe aiming at the capsid protein VP2 gene of the feline parvovirus (FPV), fully utilizing the advantages of recombinase-mediated amplification (RAA) and a CRISPR / Cas12a system, and comprehensively optimizing reaction conditions and components of the system, the detection method has remarkable advantages, can quickly complete the detection process under the condition of constant temperature of 37 DEG C, is extremely high in sensitivity, and can be used for rapidly detecting the feline parvovirus. The lowest detection limit can reach 1 * 10 < 1 > copies / mu L, the specificity is high, and the coincidence rate with a real-time fluorescent quantitative PCR method is as high as 100%.

The invention relates to the field of pathogen detection, in particular to a primer probe group, a gene chip and a kit for detecting seven waterfowl infectious disease pathogens and application. The primer probe group provided by the invention can be used for simultaneously detecting the goose parvovirus, the duck viral enteritis virus, the muscovy duck parvovirus, the duck hepatitis A virus type 1, the duck hepatitis A virus type 3, the duck tembusu virus and the novel duck reovirus, and is strong in specificity and high in sensitivity. Furthermore, a gene chip prepared by using the primer probe group provided by the invention not only has strong specificity and high sensitivity (1.0 * 100 copies / [mu] L), but also has good repeatability and stability, can be stably stored within at least 180 days, has sensitivity superior to that of a standard fluorescent quantitative PCR method, can rapidly and efficiently detect main epidemic disease pathogens of waterfowl together, and has good application prospects. The method can be used for epidemiological investigation and disease diagnosis of waterfowls.

The invention relates to the technical field of virus detection, in particular to a primer probe combination for bovine respiratory disease syndrome pathogen identification and application and a kit thereof. When the bovine viral diarrhea virus is identified, the nucleotide sequence of the upstream primer of the used primer probe group is as shown in SEQ ID No.1, the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2, and the nucleotide sequence of the probe is as shown in SEQ ID No.3. The primer probe combination provided by the invention can be used for identifying and diagnosing eight common pathogens capable of causing the bovine respiratory disease syndrome at one time through a two-tube reaction system by using a fluorescent quantitative PCR method, can also be used for identifying a mixed infected sample, has the advantages of accurate identification, high sensitivity, simplicity in operation, short time consumption and the like, and can be used for detecting the bovine respiratory disease syndrome. And an effective technical means can be provided for pathogen diagnosis and disease prevention of the bovine respiratory disease syndrome in China.

The present invention discloses a PCR method for real-time detection of two target nucleic acids with a single signal. The method of the present invention detects a signal for each target nucleic acid in an annealing step and an extension step among the three steps of PCR including denaturation, annealing step, and extension steps. That is, among the two target nucleic acids, a signal for a first target nucleic acid is detected in an annealing step, and a signal for a second target nucleic acid is detected in an extension step. Each detected signal provides qualitative and / or quantitative information about each of the two target nucleic acids. At this time, the detection signal is the same single signal for both of the two target nucleic acids, which can be detected in one detection channel.

The invention provides a PCR (polymerase chain reaction) method for rapidly screening effective donors for FMT (fibronectin) treatment of depression, which comprises the following steps: (1) collecting excrement samples of the donors, and extracting total microbial genome DNA (deoxyribonucleic acid) of the excrement samples; (2) designing six primer pairs according to a specific conserved sequence of a target strain; (3) taking the extracted donor excrement DNA as a PCR (Polymerase Chain Reaction) template, and adding a primer pair for amplification; (4) observing a PCR result through electrophoresis; and if each target band is positive in the PCR electrophoresis result of the donor sample, determining that the donor contains the target strain, and determining that the donor is an effective donor for FMT treatment of depression. The effective donor suitable for FMT treatment of depression is screened out by detecting whether the donor faeces contain three key probiotics closely related to depression symptom relieving or not, a basis is provided for microbial therapy of mental diseases such as depression, and important clinical application value is achieved.

The invention discloses a reverse genetic operating system of fowl adenovirus type 4 and application of the reverse genetic operating system. Belongs to the technical field of virus genetic manipulation. The FAdV-4 full-length genome is amplified in a segmented mode through a PCR method, segmented amplification products are cloned to pOK-CMV vectors through the homologous recombination technology, four library plasmids covering the whole gene are successfully obtained, and LMH cells are transfected to successfully rescue the virus. Meanwhile, the reporter gene NanoLuc is inserted into the FAdV-4 genome, so that the recombinant FAdV-4 for expressing the NanoLuc is successfully rescued. The invention provides an efficient technical platform for deep development of foundation and application research of FAdV-4, and has important scientific application value.

The invention provides a probe library for high-throughput detection of mouse and hamster related species-specific viruses in a CHO cell library and application of the probe library. The probe library is used for detecting a mouse pox virus, a hantavirus, a K virus, a lactic dehydrogenase virus, a lymphocytic choriomeningitis virus, a mouse microvirus, a mouse adenovirus, a mouse cytomegalovirus, a mouse encephalomyelitis virus, a mouse hepatitis virus, a mouse rotavirus, a mouse pneumovirus, a multiple oma virus, a reovirus type 3 and a sendai virus; sV5 and thymoviruses and variant viruses thereof. The high-throughput sequencing method based on the probe library can be used for distinguishing viral nucleic acid with infection risk and quickly checking whether a sample is polluted by specific live viruses or not. The detection limit reaches the level of a traditional PCR method, the capability of detecting all known variants of to-be-detected species-specific viruses is kept, 17 viruses can be detected only by implementing one detection item, and the method has the advantages of high efficiency, rapidness and high sensitivity.

The preparation and evaluation method comprises the following steps: 1, extracting a heavy-chain DNA fragment and a light-chain DNA fragment, carrying out recombinant transformation by using an overlapping PCR method to construct an scFv gene, 2, constructing an expression vector, culturing the expression vector, carrying out sequencing identification to obtain an scFv bacterial solution, recombining the scFv bacterial solution with a mouse Fc fragment, and identifying a sequence to obtain an MN8 bacterial solution, the method comprises the following steps: 1, preparing an MN8 bacterial liquid, 2, extracting the MN8 bacterial liquid, 3, carrying out inoculated culture on the MN8 bacterial liquid to obtain an MN8 genetically engineered antibody bacterial liquid, 4, extracting MN8 genetically engineered antibody bacterial liquid plasmids and carrying out transfection expression purification, and 5, carrying out antibody titer and thermal stability determination on the MN8 genetically engineered antibody. The scFv single-chain antibody obtained by recombination according to the method has the advantages of small molecular weight, high penetrability and the like, the stability and the sensitivity of an immunoassay method of the scolosporins can be improved, and a certain basis is provided for rapid determination of the scolosporins.

The invention discloses a primer combination for multiple PCR (Polymerase Chain Reaction) identification of aspongopus, hemp skin bug, tea wing bug, short-horned melon bug and large winged bug, and further discloses application of the primer combination and an identification method based on the primer combination. The specific identification method of the aspongopus raw material is established by a multiplex PCR method, the original animal of the aspongopus and the adulterants of the aspongopus are simultaneously identified through the same amplification condition, and the aspongopus medicinal material and the adulterants of the aspongopus are simultaneously identified, namely the adulterants of the aspongopus, the adulterants of the aspongopus, the adulterants of the aspongopus, the adulterants of the aspongopus, the adulterants of the aspongopus, and the adulterants of the aspongopus are simultaneously identified. The method can be used for simultaneously identifying the aspongopus decoction pieces and adulterants such as hemp skin bugs, tea wing bugs, cucurbitaceae cucurbitaceae bugs and large winged bugs, and is high in identification efficiency and good in specificity.

The invention discloses a digital PCR (polymerase chain reaction) detection method for west nile virus, and belongs to the technical field of molecular biological detection. According to the invention, a WNV conserved region NS2A sequence is taken as a template, a primer probe is designed, a West Nile Virus WNV detection method with good repeatability, high sensitivity and good specificity is established, and a detection result shows that the method has good specificity and high sensitivity, and can be used for detecting the West Nile Virus WNV. The kit has the advantages that the kit is free of cross reaction on poultry and livestock diseases such as toxoplasmosis (TOX), brucella (BRF), avian influenza virus (AIV), H3N8 equine influenza virus, NiV (Nipah virus), equine influenza virus (EHV) and equine arteritis virus (EAV), the detection sensitivity of the WNV virus can reach 4 copies / mu L, and results show that the established WNV digital PCR method has the characteristics of high efficiency, specificity, sensitivity and the like and can be used for test detection of the West Nile virus.

The invention provides a PCR (Polymerase Chain Reaction) method for rapidly identifying sinomenium acutum radix tetrastigme and wisteria tetrastigme. The PCR method comprises the following steps: 1, extracting radix tetrastigme DNA (Deoxyribonucleic Acid) by a CTAB (Cetyltrimethyl Ammonium Bromide) method; 2, carrying out PCR (Polymerase Chain Reaction) amplification by using a pair of forward and reverse primers for amplifying the DNA (Deoxyribose Nucleic Acid) sequence of the FLS11 gene promoter region; and 3, carrying out agarose gel electrophoresis analysis, and detecting a PCR product under an ultraviolet gel imaging system. The rapid, convenient and reliable identification method is established, and the method is easy to operate, low in price, good in reproducibility and good in stability and can be directly used for rapidly identifying different types of radix tetrastigme.

The invention relates to the technical field of gene detection, in particular to a primer and probe combination and a kit for detecting human papilloma virus nucleic acid 14 typing based on a digital PCR (polymerase chain reaction) method and application of the primer and probe combination and the kit. 14 HPV high-risk types including human papilloma viruses HPV52, HPV35, HPV18, HPV66, HPV39, HPV56, HPV68, HPV16, HPV31, HPV58, HPV59, HPV33, HPV45 and HPV51 can be quantitatively detected by utilizing a micro-droplet digital PCR method, compared with the prior art, the quantitative detection of more HPV types can be realized, the specificity is strong, the sensitivity is high, the lowest detection limit is reduced to 0.1 copies / uL, and real absolute quantification is realized.

The invention discloses a primer probe group, a kit and a detection method for simultaneously detecting five fungi. Specifically, in the primer and probe group, the nucleotide sequences of the primers comprise SEQ ID NO.7 to 8, SEQ ID NO.16 to 17, SEQ ID NO.25 to 26, SEQ ID NO.34 to 35 and SEQ ID NO.43 to 44, and the nucleotide sequences of the probes comprise SEQ ID NO.9, SEQ ID NO.18, SEQ ID NO.27, SEQ ID NO.36 and SEQ ID NO.45. The invention also discloses a kit for detecting the detection of the tumor cells. According to the invention, multiple detection in one tube is realized, and five invasive fungi, namely mucor, aspergillus, cryptococcus neoformans, pneumocystis yarrowii and talaromyces marneffei, are simultaneously detected in one tube of reagent by utilizing a PCR method.

The invention discloses preparation and application of grouper enterospora sporowall protein SWP26 and a polyclonal antibody of the grouper enterospora sporowall protein SWP26, and belongs to the field of animal quarantine, the grouper enterospora sporowall protein SWP26 is obtained by amplifying grouper enterospora genes by using a PCR (Polymerase Chain Reaction) method, shearing a target band and transferring the target band into a pET-32a vector to construct a recombinant plasmid, and then transforming escherichia coli BL21 (DE3) for induced expression. A Ni-NTA affinity chromatography method is used for protein purification, animal immunization and polyclonal antibody purification are carried out on the purified SWP26 recombinant protein, western blot detection is carried out on the purified antibody, an obvious signal appears at about 43kDa, and it is proved that the anti-SWP26 polyclonal antibody can be subjected to a specific reaction with the SWP26 purified protein. The invention clones and identifies the high-abundance spore wall protein SWP26 positioned on the surface of the enterosporidium of the grouper for the first time, belongs to a specific protein of the enterosporidium of the grouper, and can be used as a drug target for treating enterocytozoonosis of the grouper.

The application discloses a kit for diagnosing systemic lupus erythematosus, which is lanosterol lipid metabolite key enzyme CYP51A1, the expression amount of the transcription level of the lanosterol lipid metabolite key enzyme CYP51A1, and the cDNA sequence of the lanosterol lipid metabolite key enzyme CYP51A1 is shown as SEQ ID No. 1. The kit for diagnosing SLE provided by the application comprises CYP51A1 gene primers and primers of a housekeeping gene GAPDH, a standard product and amplification reagents. The application overcomes the defect that SLE gene diagnosis cannot be diagnosed. The application adopts a real-time fluorescent quantitative PCR method, has the characteristics of rapidness, sensitivity, accuracy and the like, the expression of CYP51A1 is detected through real-time fluorescent quantitative PCR, important basis and reference value can be provided for clinical diagnosis of diseases, thus being beneficial to the formulation of a treatment scheme of the disease, and having popularization and application value.

The invention discloses SSR (Simple Sequence Repeat) multiple PCR (Polymerase Chain Reaction) primers for megalobrama amblycephala paternity test and application, the primers comprise seven pairs of specific primers, namely a primer pair MamGLB2501, a primer pair MamGLB2502, a primer pair MamGLB2503, a primer pair MamGLG2504, a primer pair MamGLG2505, a primer pair MamGLR2506 and a primer pair MamGLR2507, and the base sequences of the seven pairs of specific primers are sequentially shown as SEQ ID NO.1-14; the invention also discloses an SSR multiplex fluorescent PCR method for megalobrama amblycephala paternity test by using the primer and application of the primer or the method in megalobrama amblycephala paternity test. The microsatellite site amplified by the primer is 3-6 base repetition, the typing is accurate, and the polymorphism of the amplified site is high; the method is accurate in identification and low in price.

The invention discloses a microsatellite instability detection method and device based on a next-generation sequencing technology, and belongs to the technical field of biological detection. The method comprises the following steps: selecting MSI sites, and carrying out capture probe design and / or amplicon primer design based on any combination of the sites; selecting a plurality of samples, and calculating the missing fragment proportion and the normal fragment proportion of each sample at each MSI site; selecting a plurality of samples which are judged to be in an MSI-L or MSS state by a PCR method as baseline samples, and setting different depth levels for each baseline sample to construct a baseline; carrying out MSI state detection; selecting a sample of which the MSI state is MSI-H, and judging whether the sample is an abnormal sample or not through a Spearman rank correlation coefficient; and if yes, adjusting the base line and re-judging the MSI state. The method has high stability and high accuracy, does not need a control sample, and can be simultaneously applied to microsatellite instability detection of hybridization capture and amplicon sequencing data.

The invention discloses an SYBR Green I fluorescent dye quantitative PCR (polymerase chain reaction) method for identifying clostridium butyricum, and belongs to the technical field of molecular detection. The invention provides a primer pair for qPCR (quantitative polymerase chain reaction) identification of clostridium butyricum. The primer pair comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO. 1; 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 2. The identification sensitivity is high, the detection limit is 7.2 * 10 < 2 > CFU / mL, the specificity is strong, and the repeatability is good. Meanwhile, the bacterial genome is obtained by cracking the bacterial liquid with the crude extraction cracking liquid, so that the genome obtaining process is simplified. According to the method, the concentration of the clostridium butyricum liquid in the sample is directly obtained through standard curve conversion, the problems that a clostridium butyricum identification method is complex, long in consumed time, low in efficiency and the like are effectively solved, and a more convenient identification method is provided for related research of clostridium butyricum.

The invention discloses a qualitative and quantitative detection method for the integrity of an AAV vector under multi-primer ITR design, and the detection method comprises the following steps: S1, designing a plurality of primers in a conserved region of an ITR sequence of the AAV vector, the length of the primers being 18-25bp, the Tm value being 55-65 DEG C, and the GC% being 40-60%; s2, carrying out validity inspection on the primer; s3, adopting a Multiplex LAM-PCR (Polymerase Chain Reaction) method, performing amplification and sequencing by using the primer to obtain a chimeric sequence of the ITR and the host genome screened by using a biological analysis method, namely obtaining information of an ITR breakpoint; s4, according to the information of the ITR breakpoints, carrying out statistics on the distribution condition of the ITR breakpoints in the ITR region to obtain a statistical table; and S5, obtaining a qualitative and quantitative result of the ITR fracture position according to the statistical table. According to the method, the number of chimeric sequences in each primer region is counted, and the ITR breakpoints are qualitatively judged and quantitatively analyzed, so that the integrity of the AAV vector is comprehensively evaluated.

The invention belongs to the technical field of bacterium detection, and discloses a multiple PCR primer for simultaneously detecting eight respiratory tract pathogenic bacteria and application thereof. On the basis of a Luminex liquid phase chip technology, specific primers are designed aiming at eight common respiratory tract infection pathogenic bacteria including pseudomonas aeruginosa, staphylococcus aureus, streptococcus pneumoniae, klebsiella pneumoniae, acinetobacter baumannii, stenotrophomonas maltophilia, haemophilus influenzae and escherichia coli; the multiple PCR primers which are high in amplification efficiency, good in specificity and suitable for simultaneously detecting the eight respiratory tract pathogenic bacteria are screened out, the multiple PCR system and microsphere hybridization conditions are continuously optimized, the multiple PCR method for the eight respiratory tract pathogenic bacteria is successfully constructed by applying the Luminex xTAG technology, and the multiple PCR method can be applied to rapid detection of multiple pathogenic microorganisms.

The invention discloses TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) primers, a probe, a detection method and a kit for detecting oviductus ovatus and application of the TaqMan real-time fluorescent quantitative PCR primers and the probe. The primer comprises an upstream primer HO-F and a downstream primer HO-R, and the nucleotide sequences of the upstream primer HO-F and the downstream primer HO-R are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2. The nucleotide sequence of the probe HO-P is shown as SEQ ID NO.3, the 5'end of the probe HO-P is marked with a fluorescence reporter group FAM, and the 3 'end of the probe HO-P is marked with a quenching group BHQ1. The TaqMan real-time fluorescent quantitative PCR method established by using the primer and the probe can specifically detect the ovulus ovatus of sheep, and has no cross reaction with other bacteria of ovulus ovatus and 47 common bacteria of cattle and sheep. The method or the kit not only can be applied to rapid identification of oviductus ovatus, but also can be applied to qualitative, relative quantitative and absolute quantitative detection of oviductus ovatus in cattle and sheep clinical samples, has the advantages of strong specificity, high sensitivity, good repeatability and the like, provides a reliable method for rapid detection of oviductus ovatus infection of cattle, sheep and sheep, and has a wide application prospect. Good popularization and application prospects are realized.

The invention discloses an application of an endogenous reference gene in rapid identification of Bauhinia bauhinia, the nucleotide sequence of the endogenous reference gene is shown as SEQ ID NO.1. The method can be used for accurately distinguishing the Bauhinia bauhinia from similar easily-confused organisms such as rhododendron simsii, and qualitative and quantitative PCR methods for detecting the endogenous reference gene are respectively established by taking the endogenous reference gene as a target sequence. The method can provide a rapid detection basis for avoiding mistaken eating and misuse, is high in sensitivity, strong in specificity, simple to operate, low in cost and suitable for on-site real-time detection, and has a wide application prospect in rapid adulteration identification of similar species, and a reaction result is easy to observe.

The application discloses a kind of sheep mycoplasma Mo, Mccp, Mmc triple PCR detection method establishment and application, by using high-throughput Mauve genome collinearity analysis the specific difference section between three kinds of sheep mycoplasma genomes each other, design and screen out the specific primer capable of differential diagnosis three kinds of sheep mycoplasma, by primer sequence amplification, sequencing, identify three new sheep mycoplasma differential diagnosis target molecule, respectively Mo differential diagnosis target molecule DprA, Mccp differential diagnosis target molecule MCCPF38_00240, Mmc differential diagnosis target molecule restriction endonuclease subunit S.Utilize new target specific section, establish the triple PCR method capable of simultaneous differential diagnosis three kinds of sheep mycoplasma (Mo, Mccp, Mmc).The PCR method of the application has the characteristics of clinical convenient, rapid diagnosis, can be widely used in the clinical diagnosis of sheep mycoplasma, with good market prospect and economic value.

The invention discloses a PCR primer group for detecting and distinguishing avian reoviruses and application of the PCR primer group, and belongs to the technical field of molecular biology. The invention provides a PCR primer for detecting and / or distinguishing the avian reovirus, the primer group has good specificity on the avian reovirus and has no cross reaction with other major poultry diseases, a sensitivity test result shows that the sensitivity is about 10 times higher than that of a conventional PCR method, other common poultry viruses have no specific amplification, and the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result is about 10 times higher than that of the conventional PCR method. No cross reaction is found, intra-batch and inter-batch variation coefficients are both smaller than 2%, and the detection method has the advantages of being high in sensitivity, high in specificity, good in repeatability and the like.

The invention relates to a large yellow croaker shield ciliate disease pathogen detection primer, a kit and application. The pathogens of the Pseudosciaena crocea shield ciliate disease comprise greedy Michaelia mirata and marine Tylocercidae. Two pairs of specific primers are designed by taking 18S rDNA (ribosomal deoxyribonucleic acid) genes of greedy Michaelike and marine Tylobacter as target genes, and are prepared into a reaction system according to a certain proportion for PCR (polymerase chain reaction) amplification, so that a PCR method capable of simultaneously and rapidly detecting the two pathogens of the Pseudosciaena crocea didysosis is established, and the PCR method has the advantages of strong specificity and high sensitivity. Reliable molecular detection technical support is provided for early rapid diagnosis of the Pseudosciaena crocea shield ciliate disease.