83 results about "Pcr method" patented technology

The invention discloses SSR (Simple Sequence Repeat) multiple PCR (Polymerase Chain Reaction) primers for megalobrama amblycephala paternity test and application, the primers comprise seven pairs of specific primers, namely a primer pair MamGLB2501, a primer pair MamGLB2502, a primer pair MamGLB2503, a primer pair MamGLG2504, a primer pair MamGLG2505, a primer pair MamGLR2506 and a primer pair MamGLR2507, and the base sequences of the seven pairs of specific primers are sequentially shown as SEQ ID NO.1-14; the invention also discloses an SSR multiplex fluorescent PCR method for megalobrama amblycephala paternity test by using the primer and application of the primer or the method in megalobrama amblycephala paternity test. The microsatellite site amplified by the primer is 3-6 base repetition, the typing is accurate, and the polymorphism of the amplified site is high; the method is accurate in identification and low in price.

The present invention relates to methods of detecting region(s) of interest in a gene comprising a polyA tail. The region(s) of interest can include gene(s), region(s), mutation(s), deletion(s), insertion(s), indel(s), and / or translocation(s). The region(s) can be greater than or less than 1 kilobases from the polyA tail. Methods can include forming a library of single cell transcripts comprising the region(s) in close proximity to a cell barcode and a unique molecular identifier (UMI). Methods for distinguishing cells by genotype can include amplifying the transcripts using PCR methods and detecting the cell barcode and UMI using single cell sequencing methods. Transcripts can be enriched using tagged region-specific PCR primers. Cell barcodes can be brought into close proximity to the region(s) by circularizing the transcripts. Sequencing of the transcripts can include using primer binding sites added during PCR amplification and library indexes for multiplexed sequencing.

The invention discloses a method and a device for detecting CAR (Chimeric Antigen Receptor) cells. The method comprises the following steps: taking a genome of a sample to be detected as a template, carrying out fluorescent quantitative PCR reaction by using a primer and a probe aiming at the sequence of a CD8 alpha transmembrane region-41 BB costimulatory molecule in a CAR gene to obtain a CT value, and calculating the copy number of the CAR gene according to the CT value and a standard curve to obtain the CAR cell distribution. Specific primers and probes are designed for CAR cells containing CD8 alpha transmembrane region-41BB costimulatory molecules, a fluorescent quantitative PCR method for detecting the copy number of CAR genes is developed, then the CAR cells are quantified, and it is proved that the method has wide applicability through multi-angle verification analysis and limitation of detection standards.

The application discloses a construction method of a multiplex PCR reaction system for detecting and identifying Podosphaera species and application thereof. The method comprises the following steps: obtaining whole genome sequences of multiple Podosphaera species, and performing multiple sequence alignment to obtain specific genes and specific gene clusters of each species; taking the genes in the specific gene clusters of each species as templates, designing multiple upstream primers and downstream primers according to a conventional primer design method to generate primer pairs, and excluding unreasonable primer pairs and primer pairs with low sensitivity and specificity; according to the size of the amplification products, the primers are freely combined and matched to generate four pairs of mixed multiplex primers, and the multiplex PCR reaction conditions are optimized to obtain a multiplex PCR system capable of specifically detecting Podosphaera and simultaneously identifying single and multiple species. The multiplex PCR method for detecting and identifying Podosphaera provided by the application can quickly and accurately complete the detection of Podosphaera and identify the species identity of Podosphaera.

The present invention provides a method for simultaneously amplifying multiple target nucleic acid regions in a single reaction volume, and a method for selecting a primer library to be used in such amplification. Furthermore, the present invention provides a primer library having desired properties, such as minimal formation of amplification primer dimers or other non-target amplification products. [Solution] For example, a method for amplifying a target gene locus in a nucleic acid sample is provided, comprising the steps of (a) contacting the nucleic acid sample with a test primer library that simultaneously hybridizes to at least 1,000 different target gene loci to generate a reaction mixture, and (b) subjecting the reaction mixture to primer extension reaction conditions to generate an amplification product containing a target amplification product.

The application discloses a single cell whole genome amplification sequencing method. The application comprises the following steps: 1) separating a single cell, adding a single cell lysis solution to sufficiently lyse the single cell and digest proteins combined on the genomic DNA; 2) using a Tn5 transposome with a specific adapter sequence to fragment the DNA, while adding adapters to both ends of the fragments; 3) after end repair, using a ribonuclease to cut modified ribonucleotide residues on the adapter sequence; 4) using the adapter sequence as a primer to linearly amplify the fragmented DNA by using a single primer PCR method; and 5) adding sequencing adapters to both ends of the DNA fragments by using a chain extension and PCR method to obtain a final sequencing library. The method disclosed by the application can amplify single cell whole genome DNA with high coverage, uniformity and fidelity, and simultaneously and accurately detect chromosomal copy number variation CNV and single nucleotide mutation SNV on a single cell genome.

The invention belongs to the technical field of biology, and discloses a TaqMan primer probe combination for detecting virulent and attenuated Newcastle disease, which comprises a virulent primer RT, a virulent probe RT-probe, a universal primer SRT and a universal probe SRT-probe, the virulent primer RT comprises an upstream primer RT-F and a downstream primer RT-R, and the universal primer SRT comprises an upstream primer SRT-F and a downstream primer SRT-R; a TaqMan probe fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method for virulent and attenuated NDV (Newcastle Disease Virus) established by using the TaqMan primer probe combination has no cross reaction on amplification of common avian viruses AIV, FADV, IBV and IBDV and has good specificity; the lowest detection concentration of virulent and attenuated Newcastle disease virus is 101 copies / uL, which is 100 times higher than that of a conventional RT-PCR method, and the kit has good sensitivity; and compared with the conventional RT-PCR method, the detection rate is 100% and is superior to that of the conventional RT-PCR method, and the detection result is consistent with the sequencing result.

This invention relates to a method and its application for determining the plasmid content in a quadrivalent avian influenza DNA vaccine. Belonging to the field of molecular biology, this invention aims to provide a TaqMan quantitative real-time PCR method capable of quantitatively determining the content of each plasmid component in a quadrivalent DNA vaccine. Specifically, this invention provides a primer and probe composition for detecting the content of individual plasmids in a quadrivalent avian influenza (H5+H7) DNA vaccine based on TaqMan quantitative real-time PCR. The composition includes primers with nucleotide sequences shown in SEQ ID NO: 5-6, 8-9, 11-12, and 14-15, and TaqMan probes with nucleotide sequences shown in SEQ ID NO: 7, 10, 13, and 16. This primer and probe composition can quantitatively determine the content of each plasmid component in the quadrivalent DNA vaccine, exhibiting good specificity and reproducibility.

The invention relates to a reagent, a kit and a method for quantitative detection of HBV (hepatitis B virus) nucleic acid, specifically, the preparation comprises (a) a first upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a first downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a first probe with a nucleotide sequence as shown in SEQ ID NO: 3; and / or (b) a second upstream primer with a nucleotide sequence as shown in SEQ ID NO: 4, a second downstream primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a second probe with a nucleotide sequence as shown in SEQ ID NO: 6. The detection reagent, kit or method disclosed by the invention is good in specificity, high in sensitivity and complete in gene coverage and has an excellent effect on a large-volume sample.

The invention discloses a reagent and a method for improving the tolerance of a PCR inhibitor and application, and belongs to the technical field of molecular biology. According to the invention, the thermosensitive uracil DNA glycosidase and the deoxyuridine triphosphate are combined and used as the PCR antiinhibitor to be applied to DNA amplification of a whole blood sample, and experiments prove that the composition can improve the endurance capacity of a PCR reaction system to a whole blood inhibitor, reduce the false negative rate and improve the accuracy and reliability of detection. Meanwhile, the method for carrying out PCR reaction by using the composition is simple to operate, low in cost and high in nucleic acid detection sensitivity. Therefore, the reagent and the method have a good application prospect in detection of nucleic acid extracted from a whole blood sample.

This invention discloses a quantitative genomic RNA standard for the BCR-ABL1 fusion gene and its preparation method. The method involves extracting genomic RNA containing two mutant forms of the BCR-ABL1P210 fusion gene, b2a2 and b3a2. RNA storage buffer and quantitative standard solutions are prepared, and corresponding primers and probes are designed. A one-step reverse transcription digital PCR method is used, with the BCR-ABL1P210 fusion mutant genomic RNA as a template for PCR amplification. Fluorescence signals are collected to detect the expression of the BCR-ABL1P210 fusion genes b2a2 and b3a2, thereby obtaining the copy number content of the BCR-ABL1P210 fusion genes b2a2 and b3a2 and the abundance of the mutant gene in ABL-WT as quantitative values.

The invention relates to a primer probe group, a multiplex fluorescent quantitative PCR method and a kit for simultaneously detecting six pathogenic bacteria, and belongs to the technical field of molecular biology, the primer probe group comprises primer sequences and probe sequences shown in SEQ ID No.1-18 in a table 1; the 5'end of each probe sequence is modified with a reporter group, and the 3 'end of each probe sequence is modified with a quenching group; the reporter group is Cy5, FAM and VIC, and the quenching group is Eclipse. The invention provides a method for simultaneously detecting six pathogenic bacteria including vibrio parahaemolyticus, salmonella, staphylococcus aureus, escherichia coli O157: H7, listeria monocytogenes and shigella in the same reaction system by combining a multiple real-time fluorescent quantitative PCR (Polymerase Chain Reaction) technology. The multiplex real-time fluorescent quantitative PCR kit provided by the invention is used for detecting the six pathogenic bacteria, can improve the detection sensitivity and specificity, greatly improves the detection efficiency, and overcomes the defects of complex steps, long detection period and incapability of adapting to large-scale rapid detection in the conventional detection method.

The application provides a standard plasmid for detecting the copy number of exogenous genes of a recombinant CVA10 vaccine, and a preparation method and application thereof. The standard plasmid of the application comprises an endogenous gene MOX fragment SEQ ID No. 1, an exogenous gene P1 fragment SEQ ID No. 2 and an exogenous gene 3CD fragment SEQ ID No. 3 which are connected in series in a cloning vector. The application constructs the standard plasmid, adopts Taqman probe-fluorescence quantitative PCR method, and simply, quickly, absolutely quantitatively and accurately analyzes the copy number of inserted exogenous genes, so that the detection time of the determination of the copy number of exogenous genes of the recombinant CVA10 vaccine is effectively shortened, repeated operation is facilitated, and the determination of the copy number of exogenous genes of the recombinant CVA10 vaccine based on the Hansenula platform and the verification of the genetic stability of the exogenous genes of the recombinant CVA10 vaccine have a wide application prospect.

The preparation and evaluation method comprises the following steps: 1, extracting a heavy-chain DNA fragment and a light-chain DNA fragment, carrying out recombinant transformation by using an overlapping PCR method to construct an scFv gene, 2, constructing an expression vector, culturing the expression vector, carrying out sequencing identification to obtain an scFv bacterial solution, recombining the scFv bacterial solution with a mouse Fc fragment, and identifying a sequence to obtain an MN8 bacterial solution, the method comprises the following steps: 1, preparing an MN8 bacterial liquid, 2, extracting the MN8 bacterial liquid, 3, carrying out inoculated culture on the MN8 bacterial liquid to obtain an MN8 genetically engineered antibody bacterial liquid, 4, extracting MN8 genetically engineered antibody bacterial liquid plasmids and carrying out transfection expression purification, and 5, carrying out antibody titer and thermal stability determination on the MN8 genetically engineered antibody. The scFv single-chain antibody obtained by recombination according to the method has the advantages of small molecular weight, high penetrability and the like, the stability and the sensitivity of an immunoassay method of the scolosporins can be improved, and a certain basis is provided for rapid determination of the scolosporins.

The present application relates to a kind of difficult culture pathogen resistance identification method and its application, belong to the field of agriculture and forestry science, step 1: the culture screening of toxic source plant, plant to be identified and indicator plant;Step 2: grafting transmission, the toxic source plant screened only with difficult culture pathogen, the plant to be identified without difficult culture pathogen and indicator plant are arranged in position, and transmission is carried out using grafting method;Step 3: observation and detection, according to the disease cycle of difficult culture pathogen, the disease phenotype of plant to be identified and indicator plant in step 2 is observed, and the colonization, propagation of difficult culture pathogen is detected by PCR method;Step 4: disease resistance and pathogen running speed evaluation.Effectively solve the problem that the identification result is inaccurate due to the low inoculation rate of difficult culture pathogen using transmission medium, the inconsistency of inoculation source pathogen and other reasons, the error is larger in resistance identification work, etc.

The application provides a kit and method for detecting common fusion genes of lymphoid leukemia based on a multiple digital PCR method. By constructing a synergistic mechanism of primers and fluorescent probes, optimizing the collocation of primers, probes and fluorescent markers, and effectively avoiding the non-specific binding between amplification products. The innovative introduction of a composite reaction aid with a specific formula, namely a PCR enhancer, significantly improves the amplification efficiency and specificity of the multiple detection system. The kit provided by the application realizes the integrated detection capability of seven fluorescent channels, Atto 425, VIC, FAM, ROX, CY5, CY5.5 and CY7 in a single hole design. By innovatively constructing a ROX+CY5 and Atto 425+VIC dual-channel combined detection system, when the ROX and CY5 channels or the Atto 425 and VIC channels in the same detection hole simultaneously present positive signals, two additional detection targets can be specifically interpreted. This innovative detection strategy based on channel combination enables the kit to break through and achieve accurate detection of 18 fusion genes with only 2 detection holes.

The invention discloses a kit for detecting intestinal core bacteria by a TaqMan real-time fluorescent quantitative PCR (Polymerase Chain Reaction) method, and belongs to the technical field of kits. The kit disclosed by the invention comprises standard positive templates of nine common intestinal core bacteria and nine groups of specific primers and probes which are required in a PCR amplification process and correspond to the standard positive templates. The kit disclosed by the invention is simple, convenient and rapid to operate; the specificity is good and the sensitivity is high; complicated raw information data analysis does not need to be carried out; the intestinal core bacteria can be detected and quantified without high-throughput sequencing, and three bacteria can be detected in one reaction hole, so that the cost is greatly reduced. The kit provided by the invention can be used for rapidly and quantitatively detecting nine intestinal core bacteria including bifidobacterium, lactobacillus, prevotella, bacteroides and the like, can partially replace a high-throughput detection method which is higher in cost and more complicated to operate according to research and diagnosis purposes, and is suitable for being widely popularized in clinical detection and laboratory research.

This invention belongs to the field of genetics and provides a technique and data analysis method for simultaneously detecting 193 Y-STRs in the Chinese population based on an NGS platform. This invention discloses 193 Y-STR loci for human Y-chromosome STR genotyping; the selected 193 Y-STRs are used for library construction using a two-step PCR method. This invention has advantages such as rapid amplification, consistent efficiency, high sensitivity, and good data visualization; due to the high depth of high-throughput sequencing, it is more conducive to the analysis of mixed and degraded materials.

The application provides an INDEL molecular marker linked with peanut kernel weight QTL qHKWA05 and application thereof. The nucleotide sequence of the molecular marker is ATGCATAATATTCCTCCATCT / A, qHKWA05.INDEL molecular marker is located at 106411957 bp of chromosome 106 of peanut cultivar Arahy05, and genotype identification of the INDEL molecular marker is carried out through a PCR method. The molecular marker qHKWA05.INDEL obtained by the application can effectively identify the kernel weight of peanuts, and is used for genetic improvement of peanut kernel traits, so that the selection accuracy of kernel weight and size of hybrid offspring is effectively improved, breeding cost is reduced, breeding efficiency is improved, and the breeding process of breeding new peanut varieties with high yield and processing speciality is accelerated.

The application discloses a method for detecting thyroid cancer driving gene mutations based on multiplex fluorescence PCR, and belongs to the technical field of molecular biology detection. The method simultaneously detects nine mutation sites, namely BRAF V600E, NRAS Q61R, NRAS Q61K, HRAS Q61R, HRAS Q61K, KRAS G12V, KRAS G12D, TERT C228T and TERT C250T in a single tube reaction. The method enhances the distinguishing ability of wild type and mutant types by using a locked nucleic acid modified allele-specific primer, suppresses wild type amplification by using a peptide nucleic acid clamp, introduces a competitive internal reference probe to correct amplification efficiency difference, and reduces the sample usage to one fifth of that of a traditional multi-tube scheme. The mutation detection lower limit reaches 0.5% allele frequency, and the total time consumption is not more than 2.5 h.

This invention relates to the design of specific primers for buffalo (Bubalus bubalis) cytochrome b (Cytb) gene for the detection of buffalo DNA using conventional PCR method. The primer sequence of buffalo species specific Cytb gene consists of forward sequence 5'- TTAGTACTATTCGCACCCGACCTC-3' and reverse 5'- TCGTTGTTTGGATGTATGTAGCAG-3'. This primer sequence has an amplicon size of 216 bp. The primers were used in a conventional PCR process operated under the following conditions, initiation stage of denaturation at 95ºC for 60 seconds, denaturation stage at 95ºC for 15 seconds, annealing stage at 63ºC for 15 seconds, elongation at 72ºC for 10 seconds cycle, final elongation at 72ºC for 60 seconds and at 35 cycles. This invention aims to amplify buffalo species specifically using conventional PCR methods so that it can detect the presence of buffalo DNA in processed products, especially for processed buffalo skin crackers.

The application discloses a kind of Megalobrama amblycephala parentage identification SSR multiplex PCR primer and application, the primer includes 7 pairs of specific primers, respectively primer pair MamGLB2501, MamGLB2502, MamGLB2503, MamGLG2504, MamGLG2505, MamGLR2506 and MamGLR2507, the base sequence of 7 pairs of specific primers is sequentially shown as SEQ ID NO.1~14;Also disclosed is the SSR multiplex fluorescence PCR method for Megalobrama amblycephala parentage identification using the above primer, and the application of the above primer or method in Megalobrama amblycephala parentage identification.The microsatellite site amplified by the primer of the application is 3-6 base repeats, accurate in typing, and high in amplification site polymorphism;The method of the application is accurate in identification and low in price.

The application discloses a MIRA-LFD primer probe composition for visual rapid detection of DHAV-1 and DHAV-3, a kit and application thereof. The primer probe composition comprises a first primer pair and a probe for detecting DHAV-1, and a second primer pair and a probe for detecting DHAV-3. The application is based on a multi-enzyme constant temperature rapid amplification technology combined with a lateral flow chromatographic test strip, and visual double detection of DHAV-1 and DHAV-3 can be completed within 15 min under a constant temperature condition of 39 DEG C, and the minimum detection limit is 1.5 x 10 2 copies / muL, and there is no cross reaction with other common viruses of duck origin. The primer probe composition and the kit are used for detecting clinical samples, and the result is consistent with that of an RT-PCR method, and the primer probe composition and the kit have the advantages of simple operation, rapidness, and no need of expensive instruments.

This invention discloses a household-use, fully enclosed thermos for COVID-19 nucleic acid testing. Based on loop-mediated isothermal amplification (RT-LAMP) technology, it integrates the entire nucleic acid testing process and post-testing sterilization into a constant-temperature, negative-pressure thermos. The testing process is observed and analyzed via a mobile app using a smartphone camera, and the results are displayed on a screen. The device can also connect to a mobile app to upload test results. The testing process requires the necessary experimental materials for RT-LAMP. This invention significantly reduces costs compared to the RT-PCR method, while offering portability and a simpler operating procedure.

The invention provides a multiplex PCR primer group and a reagent for simultaneously detecting three pathogenic genotypes of theileria orientalis, specific primers are designed on the basis of theileria orientalis MPSP genes, and a multiplex PCR method capable of simultaneously detecting Ikeda type, Chitose type and Buffeli type is established through primer combination screening and optimization of annealing temperature, primer concentration and Mg < 2 + > concentration. According to the primer group and the multiplex PCR method, mixed infection and single infection conditions of three common genotypes, namely the Ikeda type, the Chitose type and the Buffeli type, of theileria orientalis in a sample to be detected are determined through one-time multiplex PCR reaction, and compared with a common PCR method, more time is saved; compared with real-time fluorescent quantitative PCR, more cost is saved; and the method has the advantages of rapidness, economy and high efficiency, has low requirements on operators and equipment, is suitable for clinical detection, and provides technical support for diagnosis and prevention and control of different genotypes of theileria orientalis.

The application discloses a multiplex PCR primer for SSR of Sparus macrocephalus and application thereof, the multiplex PCR primer for SSR of Sparus macrocephalus comprises eight pairs of specific primers, namely primer pairs XD1, XD2, XD3, XD4, XD5, XD6, XD7 and XD8, and base sequences of the eight pairs of specific primers are shown in SEQ ID NO. 1-16 in sequence respectively; a multiplex fluorescence PCR method for SSR of Sparus macrocephalus and application of the multiplex PCR primer, a kit containing the primer or a method in evaluation of genetic diversity of Sparus macrocephalus are also disclosed; the primer amplification in the application is 3-6 base repeats of SSR sites, is stable and accurate in typing, and the method comprises a group of eight microsatellite sites, is high in accuracy, low in cost and convenient to operate.

The invention discloses a fluorescent quantitative PCR (polymerase chain reaction) method for ricefield eel rhabdovirus, and belongs to the technical field of virus molecule detection. The purpose of the invention is not subversively replaced by the prior art, but is optimization based on the defects of complementing the defects and improving the performance of the existing detection requirements: the specificity advantage of molecular detection is reserved, and the defects of sensitivity and quantitative capability are made up through a fluorescent quantitative technology; according to the method, the operation process is simplified to adapt to basic application, the popularization threshold is lowered through compatibility design, a set of accurate, rapid, easy-to-use and economical CrERV detection scheme is finally formed, technical guarantee is provided for disease prevention and control of the ricefield eel culture industry, and meanwhile a reference thought is provided for fluorescent quantitative detection technology development of other aquatic viruses.

The invention provides a probe primer composition, a kit and a detection system for rapidly detecting pneumocystis yarrowii. The method comprises the following steps: firstly, respectively designing a plurality of groups of upstream and downstream primers and probes on the basis of characteristic sites (SSU gene and LSU gene in NC020331 (mitochondrial genome) and HSP 70 gene in XM018373242 (genome)), and permutation and combination of the upstream and downstream primers and probes; screening in a conventional PCR (Polymerase Chain Reaction) mode to obtain three sets of primer probe combinations aiming at the three targets; further performing specificity and sensitivity test on the screened primer probe combination, and exploring the lowest detection concentration based on an actual clinical sample, so as to sensitively and specifically detect the pneumocystis yarrowii in the clinical sample on a conventional miniaturized constant-temperature fluorescent PCR instrument.

This invention relates to the field of parasite detection technology, specifically to a TaqMan-MGB multiplex quantitative PCR primer set, probe, kit, and method for detecting three pathogenic Eimeria species in goats. This invention provides a TaqMan-MGB multiplex quantitative PCR primer set and probe for detecting *Eimeria cruzi*, *Eimeria aurea*, and *Eimeria yabrilliosa*, and establishes a TaqMan-MGB multiplex quantitative PCR method for detecting these three species based on this primer set and probe. The primer set, probe, and TaqMan-MGB multiplex quantitative PCR method of this invention can determine the mixed or single infection status of *Eimeria cruzi*, *Eimeria aurea*, and *Eimeria yabrilliosa* in a single TaqMan-MGB multiplex quantitative PCR reaction, offering advantages such as better repeatability, higher sensitivity, stronger specificity, and simpler operation compared to conventional PCR and nano-PCR methods.

The invention belongs to the technical field of plant virus molecular detection, particularly discloses a multiplex RT-PCR method and a kit for detecting important blueberry viruses, and particularly provides a multiplex RT-PCR detection primer for the blueberry viruses, and the sequence of the primer is shown as SEQ ID NO.1-12. The technical scheme provided by the invention is wide in detection range, high in specificity, high in specificity and high in sensitivity. The kit can be used for simultaneously detecting blueberry scorching virus, blueberry shock virus standard strains and variants thereof, tomato fruit ring spot virus, blueberry necrotic mottle virus and apple mosaic virus, solves the problem that the variants and different virus strains cannot be detected by a traditional ELISA method, covers main blueberry viruses and trans-boundary infected key virus types, and is high in specificity and high in sensitivity. The sensitivity is high.