281 results about "Pcr method" patented technology

The invention provides a kit and a method for detecting common fusion genes of lymphoid leukemia based on a multiple digital PCR (Polymerase Chain Reaction) method. By constructing a synergistic effect mechanism of the primer and the fluorescent probe and optimizing matching of the primer, the probe and a fluorescent marker, non-specific binding among amplification products is effectively avoided. A composite reaction aid with a specific formula, namely a PCR enhancer, is innovatively introduced, so that the amplification efficiency and specificity of a multiple detection system are remarkably improved. According to the kit provided by the invention, the integrated detection capability on seven fluorescent channels, namely Atto 425, VIC, FAM, ROX, CY5, CY5.5 and CY7, is realized in a single-hole design. By innovatively constructing an ROX + CY5 and Atto425 + VIC dual-channel joint detection system, when the ROX and CY5 channels or Atto425 and VIC channels in the same detection hole simultaneously present positive signals, two additional detection targets can be specifically interpreted. The innovative detection strategy based on channel combination enables the kit to realize precise detection of 18 fusion genes only through two detection holes in a breakthrough manner.

The invention relates to the field of gene detection, and discloses a detection primer for an abdominal aortic aneurysm related SNP site rs116309149 and application of the detection primer, and the detection primer comprises two non-specific outer side primers and two inner side primers for specifically detecting SNP mutation sites; the outer primer has sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2 or complementary sequences of the sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the inner side primer has sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4 or complementary sequences of the sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4. According to the detection primer and the application design of the detection primer, the primer which is specifically matched with the rs116309149 site based on an ARMS-PCR method is verified, a reaction system and reaction conditions are perfected and optimized based on the detection primer, amplification and detection of a target gene are successfully completed, and the positive significance is achieved for clinic.

The invention discloses an animal-derived component identification primer based on a three-generation sequencing technology. The animal-derived component identification primer comprises a primer F as shown in SEQ ID No. 1, namely GTATGACCGCGGTGGCTGGCAC, and a primer R as shown in SEQ ID No. 2, namely CCAAACTGGGATTAGATACCC. The animal-derived component identification primer comprises a primer A, a primer B and a primer C, wherein the primer F is GTATGACCGCGGTGGCTGGCAC, and the primer C is CCAAACTGGGATTAGATACCC. Compared with a conventional DNA bar code method or a fluorescent quantitative PCR method, the primers designed by the invention can realize full-length mitochondrial amplification in different animal-derived DNAs, and the identification of animal-derived components is realized through a pair of primers, so that the detection efficiency of identification of fake animal-derived components in the field of public security food and medicine rings is improved. According to the primer pair designed by the invention, the amplification range covers all mitochondrial gene loci such as D-LOOP, COX1, COX2, COX3 and CYTB, and compared with a short fragment, the primer pair has higher species resolution.

The invention discloses a panda-derived feline panleucopenia virus RAA-CRISPRCas12a detection method, and belongs to the technical field of virus detection, and the panda-derived feline panleucopenia virus RAA-CRISPRCas12a detection method comprises the following steps: S1, primer and probe design; s2, screening an RAA amplification primer; s3, RAA reaction condition optimization; s4, performing RAA sensitivity and specificity verification; s5, preparing crRNA (Complementary Ribonucleic Acid); s6, optimal crRNA screening is carried out; s7, optimizing the RAA-CRISPR / Cas12a (Reverse Amplified Architecture- S8, the specificity and the sensitivity of the RAA-CRISPR / Cas12a are verified; s9, clinical sample detection; according to the invention, by elaborately designing a primer and a probe aiming at the capsid protein VP2 gene of the feline parvovirus (FPV), fully utilizing the advantages of recombinase-mediated amplification (RAA) and a CRISPR / Cas12a system, and comprehensively optimizing reaction conditions and components of the system, the detection method has remarkable advantages, can quickly complete the detection process under the condition of constant temperature of 37 DEG C, is extremely high in sensitivity, and can be used for rapidly detecting the feline parvovirus. The lowest detection limit can reach 1 * 10 < 1 > copies / mu L, the specificity is high, and the coincidence rate with a real-time fluorescent quantitative PCR method is as high as 100%.

The invention relates to the technical field of virus detection, in particular to a primer probe combination for bovine respiratory disease syndrome pathogen identification and application and a kit thereof. When the bovine viral diarrhea virus is identified, the nucleotide sequence of the upstream primer of the used primer probe group is as shown in SEQ ID No.1, the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2, and the nucleotide sequence of the probe is as shown in SEQ ID No.3. The primer probe combination provided by the invention can be used for identifying and diagnosing eight common pathogens capable of causing the bovine respiratory disease syndrome at one time through a two-tube reaction system by using a fluorescent quantitative PCR method, can also be used for identifying a mixed infected sample, has the advantages of accurate identification, high sensitivity, simplicity in operation, short time consumption and the like, and can be used for detecting the bovine respiratory disease syndrome. And an effective technical means can be provided for pathogen diagnosis and disease prevention of the bovine respiratory disease syndrome in China.

The invention provides a PCR (polymerase chain reaction) method for rapidly screening effective donors for FMT (fibronectin) treatment of depression, which comprises the following steps: (1) collecting excrement samples of the donors, and extracting total microbial genome DNA (deoxyribonucleic acid) of the excrement samples; (2) designing six primer pairs according to a specific conserved sequence of a target strain; (3) taking the extracted donor excrement DNA as a PCR (Polymerase Chain Reaction) template, and adding a primer pair for amplification; (4) observing a PCR result through electrophoresis; and if each target band is positive in the PCR electrophoresis result of the donor sample, determining that the donor contains the target strain, and determining that the donor is an effective donor for FMT treatment of depression. The effective donor suitable for FMT treatment of depression is screened out by detecting whether the donor faeces contain three key probiotics closely related to depression symptom relieving or not, a basis is provided for microbial therapy of mental diseases such as depression, and important clinical application value is achieved.

The preparation and evaluation method comprises the following steps: 1, extracting a heavy-chain DNA fragment and a light-chain DNA fragment, carrying out recombinant transformation by using an overlapping PCR method to construct an scFv gene, 2, constructing an expression vector, culturing the expression vector, carrying out sequencing identification to obtain an scFv bacterial solution, recombining the scFv bacterial solution with a mouse Fc fragment, and identifying a sequence to obtain an MN8 bacterial solution, the method comprises the following steps: 1, preparing an MN8 bacterial liquid, 2, extracting the MN8 bacterial liquid, 3, carrying out inoculated culture on the MN8 bacterial liquid to obtain an MN8 genetically engineered antibody bacterial liquid, 4, extracting MN8 genetically engineered antibody bacterial liquid plasmids and carrying out transfection expression purification, and 5, carrying out antibody titer and thermal stability determination on the MN8 genetically engineered antibody. The scFv single-chain antibody obtained by recombination according to the method has the advantages of small molecular weight, high penetrability and the like, the stability and the sensitivity of an immunoassay method of the scolosporins can be improved, and a certain basis is provided for rapid determination of the scolosporins.

The invention relates to the technical field of gene detection, in particular to a primer and probe combination and a kit for detecting human papilloma virus nucleic acid 14 typing based on a digital PCR (polymerase chain reaction) method and application of the primer and probe combination and the kit. 14 HPV high-risk types including human papilloma viruses HPV52, HPV35, HPV18, HPV66, HPV39, HPV56, HPV68, HPV16, HPV31, HPV58, HPV59, HPV33, HPV45 and HPV51 can be quantitatively detected by utilizing a micro-droplet digital PCR method, compared with the prior art, the quantitative detection of more HPV types can be realized, the specificity is strong, the sensitivity is high, the lowest detection limit is reduced to 0.1 copies / uL, and real absolute quantification is realized.

The invention discloses a primer probe group, a kit and a detection method for simultaneously detecting five fungi. Specifically, in the primer and probe group, the nucleotide sequences of the primers comprise SEQ ID NO.7 to 8, SEQ ID NO.16 to 17, SEQ ID NO.25 to 26, SEQ ID NO.34 to 35 and SEQ ID NO.43 to 44, and the nucleotide sequences of the probes comprise SEQ ID NO.9, SEQ ID NO.18, SEQ ID NO.27, SEQ ID NO.36 and SEQ ID NO.45. The invention also discloses a kit for detecting the detection of the tumor cells. According to the invention, multiple detection in one tube is realized, and five invasive fungi, namely mucor, aspergillus, cryptococcus neoformans, pneumocystis yarrowii and talaromyces marneffei, are simultaneously detected in one tube of reagent by utilizing a PCR method.

The invention discloses preparation and application of grouper enterospora sporowall protein SWP26 and a polyclonal antibody of the grouper enterospora sporowall protein SWP26, and belongs to the field of animal quarantine, the grouper enterospora sporowall protein SWP26 is obtained by amplifying grouper enterospora genes by using a PCR (Polymerase Chain Reaction) method, shearing a target band and transferring the target band into a pET-32a vector to construct a recombinant plasmid, and then transforming escherichia coli BL21 (DE3) for induced expression. A Ni-NTA affinity chromatography method is used for protein purification, animal immunization and polyclonal antibody purification are carried out on the purified SWP26 recombinant protein, western blot detection is carried out on the purified antibody, an obvious signal appears at about 43kDa, and it is proved that the anti-SWP26 polyclonal antibody can be subjected to a specific reaction with the SWP26 purified protein. The invention clones and identifies the high-abundance spore wall protein SWP26 positioned on the surface of the enterosporidium of the grouper for the first time, belongs to a specific protein of the enterosporidium of the grouper, and can be used as a drug target for treating enterocytozoonosis of the grouper.

The application discloses a kit for diagnosing systemic lupus erythematosus, which is lanosterol lipid metabolite key enzyme CYP51A1, the expression amount of the transcription level of the lanosterol lipid metabolite key enzyme CYP51A1, and the cDNA sequence of the lanosterol lipid metabolite key enzyme CYP51A1 is shown as SEQ ID No. 1. The kit for diagnosing SLE provided by the application comprises CYP51A1 gene primers and primers of a housekeeping gene GAPDH, a standard product and amplification reagents. The application overcomes the defect that SLE gene diagnosis cannot be diagnosed. The application adopts a real-time fluorescent quantitative PCR method, has the characteristics of rapidness, sensitivity, accuracy and the like, the expression of CYP51A1 is detected through real-time fluorescent quantitative PCR, important basis and reference value can be provided for clinical diagnosis of diseases, thus being beneficial to the formulation of a treatment scheme of the disease, and having popularization and application value.

The invention discloses SSR (Simple Sequence Repeat) multiple PCR (Polymerase Chain Reaction) primers for megalobrama amblycephala paternity test and application, the primers comprise seven pairs of specific primers, namely a primer pair MamGLB2501, a primer pair MamGLB2502, a primer pair MamGLB2503, a primer pair MamGLG2504, a primer pair MamGLG2505, a primer pair MamGLR2506 and a primer pair MamGLR2507, and the base sequences of the seven pairs of specific primers are sequentially shown as SEQ ID NO.1-14; the invention also discloses an SSR multiplex fluorescent PCR method for megalobrama amblycephala paternity test by using the primer and application of the primer or the method in megalobrama amblycephala paternity test. The microsatellite site amplified by the primer is 3-6 base repetition, the typing is accurate, and the polymorphism of the amplified site is high; the method is accurate in identification and low in price.

The invention discloses a qualitative and quantitative detection method for the integrity of an AAV vector under multi-primer ITR design, and the detection method comprises the following steps: S1, designing a plurality of primers in a conserved region of an ITR sequence of the AAV vector, the length of the primers being 18-25bp, the Tm value being 55-65 DEG C, and the GC% being 40-60%; s2, carrying out validity inspection on the primer; s3, adopting a Multiplex LAM-PCR (Polymerase Chain Reaction) method, performing amplification and sequencing by using the primer to obtain a chimeric sequence of the ITR and the host genome screened by using a biological analysis method, namely obtaining information of an ITR breakpoint; s4, according to the information of the ITR breakpoints, carrying out statistics on the distribution condition of the ITR breakpoints in the ITR region to obtain a statistical table; and S5, obtaining a qualitative and quantitative result of the ITR fracture position according to the statistical table. According to the method, the number of chimeric sequences in each primer region is counted, and the ITR breakpoints are qualitatively judged and quantitatively analyzed, so that the integrity of the AAV vector is comprehensively evaluated.

The invention belongs to the technical field of bacterium detection, and discloses a multiple PCR primer for simultaneously detecting eight respiratory tract pathogenic bacteria and application thereof. On the basis of a Luminex liquid phase chip technology, specific primers are designed aiming at eight common respiratory tract infection pathogenic bacteria including pseudomonas aeruginosa, staphylococcus aureus, streptococcus pneumoniae, klebsiella pneumoniae, acinetobacter baumannii, stenotrophomonas maltophilia, haemophilus influenzae and escherichia coli; the multiple PCR primers which are high in amplification efficiency, good in specificity and suitable for simultaneously detecting the eight respiratory tract pathogenic bacteria are screened out, the multiple PCR system and microsphere hybridization conditions are continuously optimized, the multiple PCR method for the eight respiratory tract pathogenic bacteria is successfully constructed by applying the Luminex xTAG technology, and the multiple PCR method can be applied to rapid detection of multiple pathogenic microorganisms.

The invention discloses TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) primers, a probe, a detection method and a kit for detecting oviductus ovatus and application of the TaqMan real-time fluorescent quantitative PCR primers and the probe. The primer comprises an upstream primer HO-F and a downstream primer HO-R, and the nucleotide sequences of the upstream primer HO-F and the downstream primer HO-R are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2. The nucleotide sequence of the probe HO-P is shown as SEQ ID NO.3, the 5'end of the probe HO-P is marked with a fluorescence reporter group FAM, and the 3 'end of the probe HO-P is marked with a quenching group BHQ1. The TaqMan real-time fluorescent quantitative PCR method established by using the primer and the probe can specifically detect the ovulus ovatus of sheep, and has no cross reaction with other bacteria of ovulus ovatus and 47 common bacteria of cattle and sheep. The method or the kit not only can be applied to rapid identification of oviductus ovatus, but also can be applied to qualitative, relative quantitative and absolute quantitative detection of oviductus ovatus in cattle and sheep clinical samples, has the advantages of strong specificity, high sensitivity, good repeatability and the like, provides a reliable method for rapid detection of oviductus ovatus infection of cattle, sheep and sheep, and has a wide application prospect. Good popularization and application prospects are realized.

The application discloses a kind of sheep mycoplasma Mo, Mccp, Mmc triple PCR detection method establishment and application, by using high-throughput Mauve genome collinearity analysis the specific difference section between three kinds of sheep mycoplasma genomes each other, design and screen out the specific primer capable of differential diagnosis three kinds of sheep mycoplasma, by primer sequence amplification, sequencing, identify three new sheep mycoplasma differential diagnosis target molecule, respectively Mo differential diagnosis target molecule DprA, Mccp differential diagnosis target molecule MCCPF38_00240, Mmc differential diagnosis target molecule restriction endonuclease subunit S.Utilize new target specific section, establish the triple PCR method capable of simultaneous differential diagnosis three kinds of sheep mycoplasma (Mo, Mccp, Mmc).The PCR method of the application has the characteristics of clinical convenient, rapid diagnosis, can be widely used in the clinical diagnosis of sheep mycoplasma, with good market prospect and economic value.

The invention discloses a PCR primer group for detecting and distinguishing avian reoviruses and application of the PCR primer group, and belongs to the technical field of molecular biology. The invention provides a PCR primer for detecting and / or distinguishing the avian reovirus, the primer group has good specificity on the avian reovirus and has no cross reaction with other major poultry diseases, a sensitivity test result shows that the sensitivity is about 10 times higher than that of a conventional PCR method, other common poultry viruses have no specific amplification, and the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result is about 10 times higher than that of the conventional PCR method. No cross reaction is found, intra-batch and inter-batch variation coefficients are both smaller than 2%, and the detection method has the advantages of being high in sensitivity, high in specificity, good in repeatability and the like.

The invention relates to a large yellow croaker shield ciliate disease pathogen detection primer, a kit and application. The pathogens of the Pseudosciaena crocea shield ciliate disease comprise greedy Michaelia mirata and marine Tylocercidae. Two pairs of specific primers are designed by taking 18S rDNA (ribosomal deoxyribonucleic acid) genes of greedy Michaelike and marine Tylobacter as target genes, and are prepared into a reaction system according to a certain proportion for PCR (polymerase chain reaction) amplification, so that a PCR method capable of simultaneously and rapidly detecting the two pathogens of the Pseudosciaena crocea didysosis is established, and the PCR method has the advantages of strong specificity and high sensitivity. Reliable molecular detection technical support is provided for early rapid diagnosis of the Pseudosciaena crocea shield ciliate disease.

The application discloses a reagent, a method and application of the reagent and the method for simultaneously detecting three common viruses in a fancy carp, and belongs to the technical field of fish quarantine. The application provides a reaction system and a detection method for simultaneously detecting three common viruses in a fancy carp, establishes a multiplex fluorescence PCR method, adopts a full-closed reaction, solves the problem that common PCR is prone to generating aerosols and causing false positive results of tests, has high detection sensitivity, can detect target genes with a copy number of 10 orders of magnitude at the minimum, is suitable for detecting a small amount of viruses carried in normal fancy carp or viruses in water quality environment, and can fully meet the requirements of customs quarantine prevention and control, has strong specificity, has no cross reaction to templates such as IHNV, RSIV and EHNV, and further provides a virus-like particle which can be used as a positive reference product in the multiplex system, is stable in state and beneficial to storage, can monitor an extraction process, and ensures that a test is established.

The present invention relates to methods of detecting region(s) of interest in a gene comprising a polyA tail. The region(s) of interest can include gene(s), region(s), mutation(s), deletion(s), insertion(s), indel(s), and / or translocation(s). The region(s) can be greater than or less than 1 kilobases from the polyA tail. Methods can include forming a library of single cell transcripts comprising the region(s) in close proximity to a cell barcode and a unique molecular identifier (UMI). Methods for distinguishing cells by genotype can include amplifying the transcripts using PCR methods and detecting the cell barcode and UMI using single cell sequencing methods. Transcripts can be enriched using tagged region-specific PCR primers. Cell barcodes can be brought into close proximity to the region(s) by circularizing the transcripts. Sequencing of the transcripts can include using primer binding sites added during PCR amplification and library indexes for multiplexed sequencing.

The invention discloses a method and a device for detecting CAR (Chimeric Antigen Receptor) cells. The method comprises the following steps: taking a genome of a sample to be detected as a template, carrying out fluorescent quantitative PCR reaction by using a primer and a probe aiming at the sequence of a CD8 alpha transmembrane region-41 BB costimulatory molecule in a CAR gene to obtain a CT value, and calculating the copy number of the CAR gene according to the CT value and a standard curve to obtain the CAR cell distribution. Specific primers and probes are designed for CAR cells containing CD8 alpha transmembrane region-41BB costimulatory molecules, a fluorescent quantitative PCR method for detecting the copy number of CAR genes is developed, then the CAR cells are quantified, and it is proved that the method has wide applicability through multi-angle verification analysis and limitation of detection standards.

The invention relates to a quadruple TaqMan real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primer group and a probe group for simultaneously detecting cGPV (Complementary Glutathione Virus), MDPV (Minimal Disease Papilloma Virus), MDGPV (Minimal Disease Papilloma Virus) and SBDSV (Sequence Broadcast DSV) and a kit thereof. The sequences of the primer group and the probe group are respectively shown as SEQ ID NO.1-12. The research successfully develops and verifies a multiple TaqMan-MGB real-time fluorescent PCR method capable of simultaneously detecting and distinguishing four important waterfowl parvoviruses (cGPV, MDPV, MDGPV and SBDSV). The method has good specificity, repeatability and high sensitivity. Compared with a conventional PCR method, the multiple detection method has the advantages that the clinical waterfowl parvovirus detection rate is remarkably improved, mixed infection can be effectively recognized, and the clinical diagnosis efficiency is greatly improved.

The invention discloses a method for improving backfat thickness of Sichuan consumption cattle, which is characterized in that the genotype of SNP (Single Nucleotide Polymorphism) of COL8A1 gene of Sichuan consumption cattle is detected, the SNP is located at the 44071475th site of the first chromosome of an AR-UCD2.0 version cattle genome NC037328.1: 44071475, the backfat thickness of a TT genotype individual is obviously lower than that of a CT or CC genotype individual, and the TT genotype is a dominant genotype. The genetic polymorphism of the COL8A1 gene of the Sichuan yak and the correlation between the COL8A1 gene and the meat quality character are found through a DNA sequencing technology and a PCR method in molecular biology, the backfat thickness character of the Sichuan yak can be evaluated through the genetic polymorphism, molecular breeding of the backfat thickness character of the Sichuan yak is carried out, and the backfat thickness of the Sichuan yak is improved. The invention provides a theoretical basis for marker-assisted breeding for improving meat quality of yaks and establishment of dominant high-quality groups.

The application discloses a construction method of a multiplex PCR reaction system for detecting and identifying Podosphaera species and application thereof. The method comprises the following steps: obtaining whole genome sequences of multiple Podosphaera species, and performing multiple sequence alignment to obtain specific genes and specific gene clusters of each species; taking the genes in the specific gene clusters of each species as templates, designing multiple upstream primers and downstream primers according to a conventional primer design method to generate primer pairs, and excluding unreasonable primer pairs and primer pairs with low sensitivity and specificity; according to the size of the amplification products, the primers are freely combined and matched to generate four pairs of mixed multiplex primers, and the multiplex PCR reaction conditions are optimized to obtain a multiplex PCR system capable of specifically detecting Podosphaera and simultaneously identifying single and multiple species. The multiplex PCR method for detecting and identifying Podosphaera provided by the application can quickly and accurately complete the detection of Podosphaera and identify the species identity of Podosphaera.

The present invention provides a method for simultaneously amplifying multiple target nucleic acid regions in a single reaction volume, and a method for selecting a primer library to be used in such amplification. Furthermore, the present invention provides a primer library having desired properties, such as minimal formation of amplification primer dimers or other non-target amplification products. [Solution] For example, a method for amplifying a target gene locus in a nucleic acid sample is provided, comprising the steps of (a) contacting the nucleic acid sample with a test primer library that simultaneously hybridizes to at least 1,000 different target gene loci to generate a reaction mixture, and (b) subjecting the reaction mixture to primer extension reaction conditions to generate an amplification product containing a target amplification product.

The application discloses a single cell whole genome amplification sequencing method. The application comprises the following steps: 1) separating a single cell, adding a single cell lysis solution to sufficiently lyse the single cell and digest proteins combined on the genomic DNA; 2) using a Tn5 transposome with a specific adapter sequence to fragment the DNA, while adding adapters to both ends of the fragments; 3) after end repair, using a ribonuclease to cut modified ribonucleotide residues on the adapter sequence; 4) using the adapter sequence as a primer to linearly amplify the fragmented DNA by using a single primer PCR method; and 5) adding sequencing adapters to both ends of the DNA fragments by using a chain extension and PCR method to obtain a final sequencing library. The method disclosed by the application can amplify single cell whole genome DNA with high coverage, uniformity and fidelity, and simultaneously and accurately detect chromosomal copy number variation CNV and single nucleotide mutation SNV on a single cell genome.

The invention belongs to the technical field of biology, and discloses a TaqMan primer probe combination for detecting virulent and attenuated Newcastle disease, which comprises a virulent primer RT, a virulent probe RT-probe, a universal primer SRT and a universal probe SRT-probe, the virulent primer RT comprises an upstream primer RT-F and a downstream primer RT-R, and the universal primer SRT comprises an upstream primer SRT-F and a downstream primer SRT-R; a TaqMan probe fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method for virulent and attenuated NDV (Newcastle Disease Virus) established by using the TaqMan primer probe combination has no cross reaction on amplification of common avian viruses AIV, FADV, IBV and IBDV and has good specificity; the lowest detection concentration of virulent and attenuated Newcastle disease virus is 101 copies / uL, which is 100 times higher than that of a conventional RT-PCR method, and the kit has good sensitivity; and compared with the conventional RT-PCR method, the detection rate is 100% and is superior to that of the conventional RT-PCR method, and the detection result is consistent with the sequencing result.

This invention relates to a method and its application for determining the plasmid content in a quadrivalent avian influenza DNA vaccine. Belonging to the field of molecular biology, this invention aims to provide a TaqMan quantitative real-time PCR method capable of quantitatively determining the content of each plasmid component in a quadrivalent DNA vaccine. Specifically, this invention provides a primer and probe composition for detecting the content of individual plasmids in a quadrivalent avian influenza (H5+H7) DNA vaccine based on TaqMan quantitative real-time PCR. The composition includes primers with nucleotide sequences shown in SEQ ID NO: 5-6, 8-9, 11-12, and 14-15, and TaqMan probes with nucleotide sequences shown in SEQ ID NO: 7, 10, 13, and 16. This primer and probe composition can quantitatively determine the content of each plasmid component in the quadrivalent DNA vaccine, exhibiting good specificity and reproducibility.

The invention discloses a specific molecular sequence and a method for rapidly detecting enterococcus hirai by using the specific molecular sequence. The base sequence of the specific molecular sequence is as shown in SEQ ID No.1-SEQ ID No.26. The invention further discloses a method for rapidly detecting enterococcus hirai by using the specific molecular sequence. The detection method comprises the following steps: designing a specific amplification primer pair according to any one molecular sequence in base sequences SEQ ID NO.1-SEQ ID NO.26; extracting DNA of a sample, and amplifying by a PCR method; and detecting an amplification product by gel electrophoresis, if a corresponding single amplification band appears in an electrophoresis result, judging that the sample contains the target bacteria, otherwise, judging that the sample does not contain the target bacteria. The detection method has the advantages of short detection time, low cost, simplicity in operation, high specificity and the like, can detect the enterococcus hillatus without biochemical identification, and is more practical.

The application provides a peanut BAG gene family and application in early identification of peanut bacterial wilt, and belongs to the technical field of plant genetic engineering. The peanut BAG gene family provided by the application comprises AhYSVF0U, AhTEF0AP, Ah37JSRQ and AhCF9SCE genes. Four pairs of primers for detecting the peanut BAG family are disclosed, and the expression of the peanut BAG family genes can be rapidly and accurately detected by a fluorescence quantitative PCR method, thereby laying a foundation for identification and prevention and treatment of peanut bacterial wilt.