159 results about "Pcr method" patented technology

The preparation and evaluation method comprises the following steps: 1, extracting a heavy-chain DNA fragment and a light-chain DNA fragment, carrying out recombinant transformation by using an overlapping PCR method to construct an scFv gene, 2, constructing an expression vector, culturing the expression vector, carrying out sequencing identification to obtain an scFv bacterial solution, recombining the scFv bacterial solution with a mouse Fc fragment, and identifying a sequence to obtain an MN8 bacterial solution, the method comprises the following steps: 1, preparing an MN8 bacterial liquid, 2, extracting the MN8 bacterial liquid, 3, carrying out inoculated culture on the MN8 bacterial liquid to obtain an MN8 genetically engineered antibody bacterial liquid, 4, extracting MN8 genetically engineered antibody bacterial liquid plasmids and carrying out transfection expression purification, and 5, carrying out antibody titer and thermal stability determination on the MN8 genetically engineered antibody. The scFv single-chain antibody obtained by recombination according to the method has the advantages of small molecular weight, high penetrability and the like, the stability and the sensitivity of an immunoassay method of the scolosporins can be improved, and a certain basis is provided for rapid determination of the scolosporins.

The invention discloses preparation and application of grouper enterospora sporowall protein SWP26 and a polyclonal antibody of the grouper enterospora sporowall protein SWP26, and belongs to the field of animal quarantine, the grouper enterospora sporowall protein SWP26 is obtained by amplifying grouper enterospora genes by using a PCR (Polymerase Chain Reaction) method, shearing a target band and transferring the target band into a pET-32a vector to construct a recombinant plasmid, and then transforming escherichia coli BL21 (DE3) for induced expression. A Ni-NTA affinity chromatography method is used for protein purification, animal immunization and polyclonal antibody purification are carried out on the purified SWP26 recombinant protein, western blot detection is carried out on the purified antibody, an obvious signal appears at about 43kDa, and it is proved that the anti-SWP26 polyclonal antibody can be subjected to a specific reaction with the SWP26 purified protein. The invention clones and identifies the high-abundance spore wall protein SWP26 positioned on the surface of the enterosporidium of the grouper for the first time, belongs to a specific protein of the enterosporidium of the grouper, and can be used as a drug target for treating enterocytozoonosis of the grouper.

The application discloses a kit for diagnosing systemic lupus erythematosus, which is lanosterol lipid metabolite key enzyme CYP51A1, the expression amount of the transcription level of the lanosterol lipid metabolite key enzyme CYP51A1, and the cDNA sequence of the lanosterol lipid metabolite key enzyme CYP51A1 is shown as SEQ ID No. 1. The kit for diagnosing SLE provided by the application comprises CYP51A1 gene primers and primers of a housekeeping gene GAPDH, a standard product and amplification reagents. The application overcomes the defect that SLE gene diagnosis cannot be diagnosed. The application adopts a real-time fluorescent quantitative PCR method, has the characteristics of rapidness, sensitivity, accuracy and the like, the expression of CYP51A1 is detected through real-time fluorescent quantitative PCR, important basis and reference value can be provided for clinical diagnosis of diseases, thus being beneficial to the formulation of a treatment scheme of the disease, and having popularization and application value.

The invention discloses SSR (Simple Sequence Repeat) multiple PCR (Polymerase Chain Reaction) primers for megalobrama amblycephala paternity test and application, the primers comprise seven pairs of specific primers, namely a primer pair MamGLB2501, a primer pair MamGLB2502, a primer pair MamGLB2503, a primer pair MamGLG2504, a primer pair MamGLG2505, a primer pair MamGLR2506 and a primer pair MamGLR2507, and the base sequences of the seven pairs of specific primers are sequentially shown as SEQ ID NO.1-14; the invention also discloses an SSR multiplex fluorescent PCR method for megalobrama amblycephala paternity test by using the primer and application of the primer or the method in megalobrama amblycephala paternity test. The microsatellite site amplified by the primer is 3-6 base repetition, the typing is accurate, and the polymorphism of the amplified site is high; the method is accurate in identification and low in price.

The invention discloses a qualitative and quantitative detection method for the integrity of an AAV vector under multi-primer ITR design, and the detection method comprises the following steps: S1, designing a plurality of primers in a conserved region of an ITR sequence of the AAV vector, the length of the primers being 18-25bp, the Tm value being 55-65 DEG C, and the GC% being 40-60%; s2, carrying out validity inspection on the primer; s3, adopting a Multiplex LAM-PCR (Polymerase Chain Reaction) method, performing amplification and sequencing by using the primer to obtain a chimeric sequence of the ITR and the host genome screened by using a biological analysis method, namely obtaining information of an ITR breakpoint; s4, according to the information of the ITR breakpoints, carrying out statistics on the distribution condition of the ITR breakpoints in the ITR region to obtain a statistical table; and S5, obtaining a qualitative and quantitative result of the ITR fracture position according to the statistical table. According to the method, the number of chimeric sequences in each primer region is counted, and the ITR breakpoints are qualitatively judged and quantitatively analyzed, so that the integrity of the AAV vector is comprehensively evaluated.

The invention belongs to the technical field of bacterium detection, and discloses a multiple PCR primer for simultaneously detecting eight respiratory tract pathogenic bacteria and application thereof. On the basis of a Luminex liquid phase chip technology, specific primers are designed aiming at eight common respiratory tract infection pathogenic bacteria including pseudomonas aeruginosa, staphylococcus aureus, streptococcus pneumoniae, klebsiella pneumoniae, acinetobacter baumannii, stenotrophomonas maltophilia, haemophilus influenzae and escherichia coli; the multiple PCR primers which are high in amplification efficiency, good in specificity and suitable for simultaneously detecting the eight respiratory tract pathogenic bacteria are screened out, the multiple PCR system and microsphere hybridization conditions are continuously optimized, the multiple PCR method for the eight respiratory tract pathogenic bacteria is successfully constructed by applying the Luminex xTAG technology, and the multiple PCR method can be applied to rapid detection of multiple pathogenic microorganisms.

The application discloses a kind of sheep mycoplasma Mo, Mccp, Mmc triple PCR detection method establishment and application, by using high-throughput Mauve genome collinearity analysis the specific difference section between three kinds of sheep mycoplasma genomes each other, design and screen out the specific primer capable of differential diagnosis three kinds of sheep mycoplasma, by primer sequence amplification, sequencing, identify three new sheep mycoplasma differential diagnosis target molecule, respectively Mo differential diagnosis target molecule DprA, Mccp differential diagnosis target molecule MCCPF38_00240, Mmc differential diagnosis target molecule restriction endonuclease subunit S.Utilize new target specific section, establish the triple PCR method capable of simultaneous differential diagnosis three kinds of sheep mycoplasma (Mo, Mccp, Mmc).The PCR method of the application has the characteristics of clinical convenient, rapid diagnosis, can be widely used in the clinical diagnosis of sheep mycoplasma, with good market prospect and economic value.

The application discloses a reagent, a method and application of the reagent and the method for simultaneously detecting three common viruses in a fancy carp, and belongs to the technical field of fish quarantine. The application provides a reaction system and a detection method for simultaneously detecting three common viruses in a fancy carp, establishes a multiplex fluorescence PCR method, adopts a full-closed reaction, solves the problem that common PCR is prone to generating aerosols and causing false positive results of tests, has high detection sensitivity, can detect target genes with a copy number of 10 orders of magnitude at the minimum, is suitable for detecting a small amount of viruses carried in normal fancy carp or viruses in water quality environment, and can fully meet the requirements of customs quarantine prevention and control, has strong specificity, has no cross reaction to templates such as IHNV, RSIV and EHNV, and further provides a virus-like particle which can be used as a positive reference product in the multiplex system, is stable in state and beneficial to storage, can monitor an extraction process, and ensures that a test is established.

The present invention relates to methods of detecting region(s) of interest in a gene comprising a polyA tail. The region(s) of interest can include gene(s), region(s), mutation(s), deletion(s), insertion(s), indel(s), and / or translocation(s). The region(s) can be greater than or less than 1 kilobases from the polyA tail. Methods can include forming a library of single cell transcripts comprising the region(s) in close proximity to a cell barcode and a unique molecular identifier (UMI). Methods for distinguishing cells by genotype can include amplifying the transcripts using PCR methods and detecting the cell barcode and UMI using single cell sequencing methods. Transcripts can be enriched using tagged region-specific PCR primers. Cell barcodes can be brought into close proximity to the region(s) by circularizing the transcripts. Sequencing of the transcripts can include using primer binding sites added during PCR amplification and library indexes for multiplexed sequencing.

The invention discloses a method and a device for detecting CAR (Chimeric Antigen Receptor) cells. The method comprises the following steps: taking a genome of a sample to be detected as a template, carrying out fluorescent quantitative PCR reaction by using a primer and a probe aiming at the sequence of a CD8 alpha transmembrane region-41 BB costimulatory molecule in a CAR gene to obtain a CT value, and calculating the copy number of the CAR gene according to the CT value and a standard curve to obtain the CAR cell distribution. Specific primers and probes are designed for CAR cells containing CD8 alpha transmembrane region-41BB costimulatory molecules, a fluorescent quantitative PCR method for detecting the copy number of CAR genes is developed, then the CAR cells are quantified, and it is proved that the method has wide applicability through multi-angle verification analysis and limitation of detection standards.

The invention relates to a quadruple TaqMan real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primer group and a probe group for simultaneously detecting cGPV (Complementary Glutathione Virus), MDPV (Minimal Disease Papilloma Virus), MDGPV (Minimal Disease Papilloma Virus) and SBDSV (Sequence Broadcast DSV) and a kit thereof. The sequences of the primer group and the probe group are respectively shown as SEQ ID NO.1-12. The research successfully develops and verifies a multiple TaqMan-MGB real-time fluorescent PCR method capable of simultaneously detecting and distinguishing four important waterfowl parvoviruses (cGPV, MDPV, MDGPV and SBDSV). The method has good specificity, repeatability and high sensitivity. Compared with a conventional PCR method, the multiple detection method has the advantages that the clinical waterfowl parvovirus detection rate is remarkably improved, mixed infection can be effectively recognized, and the clinical diagnosis efficiency is greatly improved.

The application discloses a construction method of a multiplex PCR reaction system for detecting and identifying Podosphaera species and application thereof. The method comprises the following steps: obtaining whole genome sequences of multiple Podosphaera species, and performing multiple sequence alignment to obtain specific genes and specific gene clusters of each species; taking the genes in the specific gene clusters of each species as templates, designing multiple upstream primers and downstream primers according to a conventional primer design method to generate primer pairs, and excluding unreasonable primer pairs and primer pairs with low sensitivity and specificity; according to the size of the amplification products, the primers are freely combined and matched to generate four pairs of mixed multiplex primers, and the multiplex PCR reaction conditions are optimized to obtain a multiplex PCR system capable of specifically detecting Podosphaera and simultaneously identifying single and multiple species. The multiplex PCR method for detecting and identifying Podosphaera provided by the application can quickly and accurately complete the detection of Podosphaera and identify the species identity of Podosphaera.

The present invention provides a method for simultaneously amplifying multiple target nucleic acid regions in a single reaction volume, and a method for selecting a primer library to be used in such amplification. Furthermore, the present invention provides a primer library having desired properties, such as minimal formation of amplification primer dimers or other non-target amplification products. [Solution] For example, a method for amplifying a target gene locus in a nucleic acid sample is provided, comprising the steps of (a) contacting the nucleic acid sample with a test primer library that simultaneously hybridizes to at least 1,000 different target gene loci to generate a reaction mixture, and (b) subjecting the reaction mixture to primer extension reaction conditions to generate an amplification product containing a target amplification product.

The application discloses a single cell whole genome amplification sequencing method. The application comprises the following steps: 1) separating a single cell, adding a single cell lysis solution to sufficiently lyse the single cell and digest proteins combined on the genomic DNA; 2) using a Tn5 transposome with a specific adapter sequence to fragment the DNA, while adding adapters to both ends of the fragments; 3) after end repair, using a ribonuclease to cut modified ribonucleotide residues on the adapter sequence; 4) using the adapter sequence as a primer to linearly amplify the fragmented DNA by using a single primer PCR method; and 5) adding sequencing adapters to both ends of the DNA fragments by using a chain extension and PCR method to obtain a final sequencing library. The method disclosed by the application can amplify single cell whole genome DNA with high coverage, uniformity and fidelity, and simultaneously and accurately detect chromosomal copy number variation CNV and single nucleotide mutation SNV on a single cell genome.

The invention belongs to the technical field of biology, and discloses a TaqMan primer probe combination for detecting virulent and attenuated Newcastle disease, which comprises a virulent primer RT, a virulent probe RT-probe, a universal primer SRT and a universal probe SRT-probe, the virulent primer RT comprises an upstream primer RT-F and a downstream primer RT-R, and the universal primer SRT comprises an upstream primer SRT-F and a downstream primer SRT-R; a TaqMan probe fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method for virulent and attenuated NDV (Newcastle Disease Virus) established by using the TaqMan primer probe combination has no cross reaction on amplification of common avian viruses AIV, FADV, IBV and IBDV and has good specificity; the lowest detection concentration of virulent and attenuated Newcastle disease virus is 101 copies / uL, which is 100 times higher than that of a conventional RT-PCR method, and the kit has good sensitivity; and compared with the conventional RT-PCR method, the detection rate is 100% and is superior to that of the conventional RT-PCR method, and the detection result is consistent with the sequencing result.

This invention relates to a method and its application for determining the plasmid content in a quadrivalent avian influenza DNA vaccine. Belonging to the field of molecular biology, this invention aims to provide a TaqMan quantitative real-time PCR method capable of quantitatively determining the content of each plasmid component in a quadrivalent DNA vaccine. Specifically, this invention provides a primer and probe composition for detecting the content of individual plasmids in a quadrivalent avian influenza (H5+H7) DNA vaccine based on TaqMan quantitative real-time PCR. The composition includes primers with nucleotide sequences shown in SEQ ID NO: 5-6, 8-9, 11-12, and 14-15, and TaqMan probes with nucleotide sequences shown in SEQ ID NO: 7, 10, 13, and 16. This primer and probe composition can quantitatively determine the content of each plasmid component in the quadrivalent DNA vaccine, exhibiting good specificity and reproducibility.

The application provides a peanut BAG gene family and application in early identification of peanut bacterial wilt, and belongs to the technical field of plant genetic engineering. The peanut BAG gene family provided by the application comprises AhYSVF0U, AhTEF0AP, Ah37JSRQ and AhCF9SCE genes. Four pairs of primers for detecting the peanut BAG family are disclosed, and the expression of the peanut BAG family genes can be rapidly and accurately detected by a fluorescence quantitative PCR method, thereby laying a foundation for identification and prevention and treatment of peanut bacterial wilt.

The invention relates to the technical field of intestinal pathogen detection, in particular to a multiplex PCR (polymerase chain reaction) primer group, a kit and a method for detecting pathogens causing calf diarrhea. The invention provides a primer group for detecting diarrheagenic Escherichia coli eaeA, stx1 and stx2 virulence genes, clostridium perfringens and cryptosporidium, and a multiple PCR (Polymerase Chain Reaction) method for detecting the diarrheagenic Escherichia coli eaeA, stx1 and stx2 virulence genes, clostridium perfringens and cryptosporidium is established on the basis of the primer group. According to the primer group and the multiple PCR method disclosed by the invention, the mixed infection and single infection conditions of diarrheogenic Escherichia coli eaeA, stx1 and stx2 virulence genes, clostridium perfringens and cryptosporidium in a sample to be detected can be determined through one-time multiple PCR reaction, and compared with a common PCR method, the primer group and the multiple PCR method are more convenient and quicker, and time and resources are saved; and compared with real-time fluorescent quantitative PCR, the method is more cost-saving and convenient to operate.

The invention relates to a reagent, a kit and a method for quantitative detection of HBV (hepatitis B virus) nucleic acid, specifically, the preparation comprises (a) a first upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a first downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a first probe with a nucleotide sequence as shown in SEQ ID NO: 3; and / or (b) a second upstream primer with a nucleotide sequence as shown in SEQ ID NO: 4, a second downstream primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a second probe with a nucleotide sequence as shown in SEQ ID NO: 6. The detection reagent, kit or method disclosed by the invention is good in specificity, high in sensitivity and complete in gene coverage and has an excellent effect on a large-volume sample.

The invention discloses a reagent and a method for improving the tolerance of a PCR inhibitor and application, and belongs to the technical field of molecular biology. According to the invention, the thermosensitive uracil DNA glycosidase and the deoxyuridine triphosphate are combined and used as the PCR antiinhibitor to be applied to DNA amplification of a whole blood sample, and experiments prove that the composition can improve the endurance capacity of a PCR reaction system to a whole blood inhibitor, reduce the false negative rate and improve the accuracy and reliability of detection. Meanwhile, the method for carrying out PCR reaction by using the composition is simple to operate, low in cost and high in nucleic acid detection sensitivity. Therefore, the reagent and the method have a good application prospect in detection of nucleic acid extracted from a whole blood sample.

This invention discloses a quantitative genomic RNA standard for the BCR-ABL1 fusion gene and its preparation method. The method involves extracting genomic RNA containing two mutant forms of the BCR-ABL1P210 fusion gene, b2a2 and b3a2. RNA storage buffer and quantitative standard solutions are prepared, and corresponding primers and probes are designed. A one-step reverse transcription digital PCR method is used, with the BCR-ABL1P210 fusion mutant genomic RNA as a template for PCR amplification. Fluorescence signals are collected to detect the expression of the BCR-ABL1P210 fusion genes b2a2 and b3a2, thereby obtaining the copy number content of the BCR-ABL1P210 fusion genes b2a2 and b3a2 and the abundance of the mutant gene in ABL-WT as quantitative values.

The invention relates to the technical field of medical examination, in particular to a rapid extraction-free hepatitis C virus detection kit and method. According to the invention, the material carrier is used for providing carrier support for reagent freeze-drying, and during use, the remelting buffer solution is used for remelting, so that the use effect before freeze-drying is achieved. The kit provided by the invention is used as a freeze-drying reagent, and solves the problem of cold-chain transportation of nucleic acid detection kits. The product simulates storage under different temperature conditions, detection results show that the product changes within 15 months, the storage period exceeds that of a control kit, and a new direction is laid for development and exploration of a later nucleic acid detection kit (pcr method). The kit disclosed by the invention lays a foundation for market occupation and long-term development by utilizing storage stability and transportation stability of the kit.

The invention relates to a primer probe group, a multiplex fluorescent quantitative PCR method and a kit for simultaneously detecting six pathogenic bacteria, and belongs to the technical field of molecular biology, the primer probe group comprises primer sequences and probe sequences shown in SEQ ID No.1-18 in a table 1; the 5'end of each probe sequence is modified with a reporter group, and the 3 'end of each probe sequence is modified with a quenching group; the reporter group is Cy5, FAM and VIC, and the quenching group is Eclipse. The invention provides a method for simultaneously detecting six pathogenic bacteria including vibrio parahaemolyticus, salmonella, staphylococcus aureus, escherichia coli O157: H7, listeria monocytogenes and shigella in the same reaction system by combining a multiple real-time fluorescent quantitative PCR (Polymerase Chain Reaction) technology. The multiplex real-time fluorescent quantitative PCR kit provided by the invention is used for detecting the six pathogenic bacteria, can improve the detection sensitivity and specificity, greatly improves the detection efficiency, and overcomes the defects of complex steps, long detection period and incapability of adapting to large-scale rapid detection in the conventional detection method.

The application provides a standard plasmid for detecting the copy number of exogenous genes of a recombinant CVA10 vaccine, and a preparation method and application thereof. The standard plasmid of the application comprises an endogenous gene MOX fragment SEQ ID No. 1, an exogenous gene P1 fragment SEQ ID No. 2 and an exogenous gene 3CD fragment SEQ ID No. 3 which are connected in series in a cloning vector. The application constructs the standard plasmid, adopts Taqman probe-fluorescence quantitative PCR method, and simply, quickly, absolutely quantitatively and accurately analyzes the copy number of inserted exogenous genes, so that the detection time of the determination of the copy number of exogenous genes of the recombinant CVA10 vaccine is effectively shortened, repeated operation is facilitated, and the determination of the copy number of exogenous genes of the recombinant CVA10 vaccine based on the Hansenula platform and the verification of the genetic stability of the exogenous genes of the recombinant CVA10 vaccine have a wide application prospect.

The invention discloses a plasmodium vivax SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in tracing. The SNP molecular marker provided by the invention can be used for effectively identifying plasmodium vivax in the inland of China. According to the invention, one SNP molecular marker is identified and obtained through a PCR method, and then plasmodium vivax is traced. According to the invention, plasmodium vivax DNA traceability is carried out by adopting a PCR method based on the SNP molecular marker, the method has the characteristics of convenience and rapidness, the SNP molecular marker stably and widely exists in plasmodium vivax genome DNA, and large-scale popularization of the traceability technology is facilitated.

The preparation and evaluation method comprises the following steps: 1, extracting a heavy-chain DNA fragment and a light-chain DNA fragment, carrying out recombinant transformation by using an overlapping PCR method to construct an scFv gene, 2, constructing an expression vector, culturing the expression vector, carrying out sequencing identification to obtain an scFv bacterial solution, recombining the scFv bacterial solution with a mouse Fc fragment, and identifying a sequence to obtain an MN8 bacterial solution, the method comprises the following steps: 1, preparing an MN8 bacterial liquid, 2, extracting the MN8 bacterial liquid, 3, carrying out inoculated culture on the MN8 bacterial liquid to obtain an MN8 genetically engineered antibody bacterial liquid, 4, extracting MN8 genetically engineered antibody bacterial liquid plasmids and carrying out transfection expression purification, and 5, carrying out antibody titer and thermal stability determination on the MN8 genetically engineered antibody. The scFv single-chain antibody obtained by recombination according to the method has the advantages of small molecular weight, high penetrability and the like, the stability and the sensitivity of an immunoassay method of the scolosporins can be improved, and a certain basis is provided for rapid determination of the scolosporins.

The invention discloses a multiplex PCR (polymerase chain reaction) method for quickly detecting pathogenic bacteria of tobacco brown spot, which is used for synchronously identifying two main pathogenic bacteria causing tobacco brown spot, namely alternaria tenuissima and alternaria alternata, and comprises the following steps: S1, extracting genome DNA (deoxyribonucleic acid): extracting genome DNA of standard strains of alternaria tenuissima and alternaria alternata as a detection template; the multiple PCR system has the beneficial effects that through system verification, it is confirmed that all primers only generate expected amplification products for target pathogenic bacteria, no cross amplification reaction exists between alternaria alternata and alternaria tenuissima, and it is indicated that the multiple PCR system has high interspecific specificity. The established detection method is high in stability, good in repeatability and suitable for standardized operation under different laboratory conditions. Compared with a traditional morphological identification or single gene sequencing method, the multiplex PCR technology has the advantages that the detection period is remarkably shortened, the operation is simple and convenient, time and labor are saved, the cost is low and the like. The method is suitable for rapid identification of standard strains.

This invention discloses primers for identifying animal-derived components based on third-generation sequencing technology. The primers are primer F (SEQ ID No. 1): GTATGACCGCGGTGGCTGGCAC, and primer R (SEQ ID No. 2): CCAAACTGGGATTAGATACCC. Compared to conventional DNA barcoding or quantitative real-time PCR methods, the primers designed in this invention can achieve full-length mitochondrial amplification in different animal-derived DNAs, enabling the identification of animal-derived components through a single primer pair, thus improving the detection efficiency of counterfeit animal-derived components in the public security, food, drug, and environmental protection fields. The primer pairs designed in this invention amplify all mitochondrial loci, including D-LOOP, COX1, COX2, COX3, and CYTB, providing higher species resolution compared to shorter fragments.

The present application relates to a kind of difficult culture pathogen resistance identification method and its application, belong to the field of agriculture and forestry science, step 1: the culture screening of toxic source plant, plant to be identified and indicator plant;Step 2: grafting transmission, the toxic source plant screened only with difficult culture pathogen, the plant to be identified without difficult culture pathogen and indicator plant are arranged in position, and transmission is carried out using grafting method;Step 3: observation and detection, according to the disease cycle of difficult culture pathogen, the disease phenotype of plant to be identified and indicator plant in step 2 is observed, and the colonization, propagation of difficult culture pathogen is detected by PCR method;Step 4: disease resistance and pathogen running speed evaluation.Effectively solve the problem that the identification result is inaccurate due to the low inoculation rate of difficult culture pathogen using transmission medium, the inconsistency of inoculation source pathogen and other reasons, the error is larger in resistance identification work, etc.

The invention provides a method and a primer probe combination for detecting EGFR (epidermal growth factor receptor) gene G719X mutation. The primer probe combination for detecting G719X can specifically amplify and detect mutation of a G719X region in a No.18 exon of an EGFR (epidermal growth factor receptor) gene. According to the method, fluorescent combination types in different partitions are judged by applying a digital PCR method, and detection and quantitative analysis can be performed on a plurality of different mutations in the same reaction. The method provided by the invention is simple and convenient in analysis, accurate and reliable in result, and capable of effectively detecting three mutations of G719A, G719S and G719C in the G719X region.