Method for detecting panda-derived feline panleukopenia virus RAA-CRISPRCas12a

Through the RAA-CRISPR/Cas12a detection method, the existing FPV detection time and high equipment requirements are solved, and the rapid, sensitive and highly specific FPV detection under constant temperature of 37℃ is achieved, which is suitable for clinical sample detection of giant panda disease.

CN120384156APending Publication Date: 2025-07-29CHENGDU RES BASE OF GIANT PANDA BREEDING
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510846141.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-24
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

The existing FPV detection methods are time-consuming, complex in operation and high requirements for equipment and environmental conditions, and are difficult to implement quickly in clinical sites and cannot meet the rapid detection needs of panleukinocytopenia virus from giant panda origin.

Method used

The RAA-CRISPR/Cas12a detection method is adopted to ensure the sensitivity and specificity of the method through primer and probe design, RAA amplification primer screening, reaction condition optimization, crRNA preparation and system optimization.

Benefits of technology

The test results are obtained in a short time, with high sensitivity, able to accurately detect FPV at low virus concentrations, and strong specificity. It is suitable for rapid clinical sample detection and improve the prevention and control level of giant panda disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384156A_ABST
    Figure CN120384156A_ABST
Patent Text Reader

Abstract

The invention discloses a panda-derived feline panleucopenia virus RAA-CRISPRCas12a detection method, and belongs to the technical field of virus detection, and the panda-derived feline panleucopenia virus RAA-CRISPRCas12a detection method comprises the following steps: S1, primer and probe design; s2, screening an RAA amplification primer; s3, RAA reaction condition optimization; s4, performing RAA sensitivity and specificity verification; s5, preparing crRNA (Complementary Ribonucleic Acid); s6, optimal crRNA screening is carried out; s7, optimizing the RAA-CRISPR / Cas12a (Reverse Amplified Architecture- S8, the specificity and the sensitivity of the RAA-CRISPR / Cas12a are verified; s9, clinical sample detection; according to the invention, by elaborately designing a primer and a probe aiming at the capsid protein VP2 gene of the feline parvovirus (FPV), fully utilizing the advantages of recombinase-mediated amplification (RAA) and a CRISPR / Cas12a system, and comprehensively optimizing reaction conditions and components of the system, the detection method has remarkable advantages, can quickly complete the detection process under the condition of constant temperature of 37 DEG C, is extremely high in sensitivity, and can be used for rapidly detecting the feline parvovirus. The lowest detection limit can reach 1 * 10 < 1 > copies / mu L, the specificity is high, and the coincidence rate with a real-time fluorescent quantitative PCR method is as high as 100%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and specifically relates to a RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant pandas. Background Art

[0002] Feline panleukopenia is caused by the single-stranded DNA virus feline parvovirus (FPV), which is a highly contagious disease that often causes the death of the host. The host range of FPV is extremely wide, and it can infect many species in the order Carnivora, such as cats, dogs, minks, raccoon dogs, foxes, as well as animals in the families Procyonidae, Mustelidae, and Canidae, and even giant pandas. In severe cases, it can cause the death of giant pandas.

[0003] Currently, the detection methods for FPV mainly include ELISA, colloidal gold detection, PCR, LAMP, etc. However, these traditional detection methods generally have the problems of long detection time, complex operation process, and high requirements for detection equipment and environmental conditions. Usually, samples need to be sent to a professional laboratory for detection, making it difficult to quickly implement detection work at the clinical site and unable to effectively meet the actual needs of rapid detection of FPV from giant pandas. Therefore, a RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant pandas is needed to solve the above problems. Summary of the Invention

[0004] The purpose of the present invention is to provide a RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant pandas to solve the problems raised in the above background art.

[0005] To achieve the above purpose, the present invention provides the following technical solution: A RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant pandas, comprising the following steps: S1. Primer and probe design; S2. Screening of RAA amplification primers; S3. Optimization of RAA reaction conditions; S4. Verification of RAA sensitivity and specificity; S5. Preparation of crRNA; S6. Screening of the optimal crRNA; S7. Optimization of the RAA-CRISPR / Cas12a system; S8. Verification of the specificity and sensitivity of RAA-CRISPR / Cas12a; S9. Detection of clinical samples.

[0006] As a preferred solution, in "Step S1", based on the conserved region of the FPV capsid protein VP2 gene sequence logged in NCBI and the PAM site recognized by the Cas12a protein.

[0007] As a preferred solution, in "Step S2", cross-combine the upstream and downstream primers of RAA, carry out the RAA reaction, and screen out the primer pair with the most ideal amplification effect.

[0008] As a preferred solution, in "Step S3", determine the optimal temperature and time of the RAA reaction.

[0009] As a preferred solution, in "Step S4", verify the sensitivity and specificity of this method by gradient dilution of FPVDNA and RAA amplification using multiple viral nucleic acids.

[0010] As a preferred solution, in "Step S5", anneal to synthesize double-stranded DNA, then transcribe it into crRNA, and set aside after purification.

[0011] As a preferred solution, in "Step S6", configure the cleavage reaction system and screen out the optimal crRNA according to the fluorescence curve.

[0012] As a preferred solution, in "Step S7", screen and optimize the system components, probe concentration, Cas12a protein concentration, and crRNA concentration.

[0013] As a preferred solution, in "Step S8", use multiple viral nucleic acids and gradient-diluted recombinant plasmid standards for reaction to verify the specificity and sensitivity of this method.

[0014] As a preferred solution, in "Step S9", extract the nucleic acid of clinical samples, carry out RAA-CRISPR / Cas12a detection, and compare with the qPCR detection results.

[0015] Compared with the prior art, the beneficial effects of the present invention are: In the present invention, both the RAA and CRISPR / Cas12a systems can complete the reaction under the constant temperature condition of 37°C, greatly shortening the detection time required, and can well meet the actual needs of on-site rapid detection. Compared with the traditional detection method that requires a long detection cycle, this method can obtain the detection result in a shorter time, winning precious time for the timely diagnosis and prevention and control of giant panda diseases, making this improved method have the advantage of rapid detection; In the present invention, the lowest concentration of positive plasmid that can be detected by the RAA-CRISPR / Cas12a method is 1×10 1Copy / μL, which has higher sensitivity compared with traditional detection methods. This means that even when the virus content in giant pandas is at a low level, this method can accurately detect the presence of viral nucleic acid, helping to detect the virus in the early stage of disease infection, providing a basis for early intervention and treatment, and improving the cure rate and survival rate of giant panda diseases; In the present invention, during the detection process, except for FPV, the fluorescence signals of other viruses did not increase, indicating that the established method has strong specificity. This method can effectively avoid the interference of other viruses, accurately identify the nucleic acid of FPV from giant pandas, ensure the accuracy and reliability of the detection results, and provide a reliable basis for formulating targeted prevention and control measures; In the present invention, the clinical sample detection results show that the coincidence rate of the RAA-CRISPR / Cas12a method and the real-time fluorescence quantitative PCR method is 100%. It can be used for the rapid detection of clinical samples, and this method is relatively simple to operate and has relatively low requirements for equipment, which is conducive to popularization and application in more giant panda protection institutions and grass-roots veterinary units, improving the overall level of giant panda disease prevention and control, and having high clinical application value. Brief Description of the Drawings

[0016] Figure 1 is the overall flowchart of the present invention; Figure 2 is the information table of primers and probes of the present invention; Figure 3 is the result diagram of the screening of RAA amplification primers of the present invention; Figure 4 is the result diagram of the screening of the optimal reaction temperature of RAA of the present invention; Figure 5 is the result diagram of the screening of the optimal reaction time of RAA of the present invention; Figure 6 is the result diagram of the sensitivity experiment of RAA of the present invention; Figure 7 is the result diagram of the specificity experiment of RAA of the present invention; Figure 8 is the result diagram of the screening of the optimal crRNA of the present invention; Figure 9 is the result diagram of the system verification of the present invention; Figure 10 is the result diagram of the screening of probe concentration of the present invention; Figure 11 is the result diagram of the screening of Cas12a protein concentration of the present invention; Figure 12 is the result diagram of the screening of crRNA concentration of the present invention; Figure 13 is the result diagram of the specificity test of RAA-CRISPR / Cas12a of the present invention; Figure 14This is the result diagram of the RAA-CRISPR / Cas12a sensitivity test for the present invention. Detailed implementation manners

[0017] The present invention will be further described below in conjunction with embodiments.

[0018] The following embodiments are used to illustrate the present invention, but cannot be used to limit the protection scope of the present invention. The conditions in the embodiments can be further adjusted according to specific conditions, and simple improvements to the method of the present invention under the premise of the concept of the present invention all belong to the scope required to be protected by the present invention.

[0019] Please refer to Figure 1-14 , the present invention provides a method for detecting feline panleukopenia virus RAA-CRISPR Cas12a from giant pandas, including the following steps: S1. Primer and probe design; S2. Screening of RAA amplification primers; S3. Optimization of RAA reaction conditions; S4. Verification of RAA sensitivity and specificity; S5. Preparation of crRNA; S6. Screening of the optimal crRNA; S7. Optimization of the RAA-CRISPR / Cas12a system; S8. Verification of the specificity and sensitivity of RAA-CRISPR / Cas12a; S9. Detection of clinical samples.

[0020] As Figure 2 shown, in "Step S1", according to the conserved region of the FPV capsid protein VP2 gene sequence logged in NCBI and the PAM site recognized by the Cas12a protein, a primer and probe combination is designed, including the following categories: RAA primers designed for the conserved region of the FPV capsid protein VP2 gene, namely RAA-VP2-F1, RAA-VP2-F2, RAA-VP2-R1, RAA-VP2-R2; PCR primers FPV-PCR-VP2-F1, FPV-PCR-VP2-F2, FPV-PCR-VP2-R1, FPV-PCR-VP2-R2; crRNA primers crRNA-F1, crRNA-R1, crRNA-F2, crRNA-R2, crRNA-F3, crRNA-R3; and a non-specific ssDNA reporter molecule labeled with FAM at the 5' end and BHQ at the 3' end; The specific sequence characteristics of the primer and probe combination are as follows: the sequence of RAA-VP2-F1 is GGTTTAATCCAGGAGATTGGCAACTAATTG; The RAA-VP2-F2 sequence is CTAATTGTTAATACTATGAGTGAGTTGCAT; The RAA-VP2-R1 sequence is CAATTAGTTGCCAATCTCCTGGATTAAACC; The RAA-VP2-R2 sequence is CCCCAATGTCTCAGATCTCATAGCTGCTGGAGT; The FPV-PCR-VP2-F1 sequence is GACCAGCTGAGGTTGGTTATAG; The FPV-PCR-VP2-R1 sequence is TCCTGCTGCAATAGGTGTTT; The FPV-PCR-VP2-F sequence is TGGAACTAGTGGCACACCAA; The FPV-PCR-VP2-R sequence is AAATGGTGGTAAGCCCAATG; The crRNA-F1 sequence is TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGAT; The crRNA-R1 sequence is GTGGCTGAGTAGCAGATTCTATCTACACTTAGTAGAAATTA; The crRNA-F2 sequence is TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGAT; The crRNA-R2 sequence is GCAACCATCAATGATGCAGTATCTACACTTAGTAGAAATTA; The crRNA-F3 sequence is TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGAT; The crRNA-R3 sequence is AGATCTCATAGCTGCTGGAGATCTACACTTAGTAGAAATTA; The ssDNAreporter sequence is FAM-TTATTATT-BHQ.

[0021] As Figure 3 shown, in "Step S2", a basic RAA nucleic acid amplification kit was used, and the reaction system was prepared strictly according to the kit instructions. The upstream and downstream 2 RAA primers were cross-combined into 4 primer pairs for RAA reaction; The specific operation is as follows: Add 14.7 μL of reaction buffer, 1 μL each of forward and reverse primers (10 μmol / L) to the reaction tube, and make up to 21.25 μL with DEPC water; Add 2.5 μL of template (standard plasmid positive sample) and 1.25 μL of magnesium acetate solution to the lid of each reaction tube; After instantaneous centrifugation, react for 30 min in a 37 °C water bath environment. After the reaction, use the FastPure Gel DNA Extraction Mini Kit to purify the reaction product. Take 5 μL of the purified product for 1.5% agarose gel electrophoresis detection to screen out the primer pair with the best amplification effect; The experimental results show that the amplification band of the F2R2 primer pair is the brightest and the amplification effect is the best.

[0022] As Figure 4 and Figure 5 shown, in "Step S3", determine the optimal temperature and time for the RAA reaction. The amplification reaction temperatures are set to 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, and 42 °C respectively, and the cycle times are set to 10 min, 15 min, 20 min, 25 min, 30 min, and 35 min respectively. Determine the optimal reaction temperature and reaction time based on the results of the amplification efficiency. Through the analysis of the gel electrophoresis band brightness, determine that 37 °C is the optimal reaction temperature and 25 min is the optimal reaction time.

[0023] As Figure 6 and Figure 7 shown, in "Step S4", perform 10-fold serial dilution on the DNA of FPV with the determined concentration, and the dilution concentration range is 1×10 8 copies / μL~1×10 0 copies / μL. Take this as the template, use ddH2O as the negative control, and perform amplification using the established RAA to evaluate the sensitivity of this method; Use the nucleic acids of FPV, CDV, RV, VSV, and GTPV as templates respectively, use the DNA standard product of FPV as the positive control, and ddH2O as the blank control, and perform amplification using RAA to evaluate the specificity of this method; The results show that the lowest detection limit of the RAA method is 10 2 copies / reaction, and no amplification occurs for other viruses except FPV, indicating that this method has good specificity; In "Step S5", synthesize double-stranded DNA by annealing, then transcribe it into crRNA, and reserve it after purification; Use the DNA oligonucleotide annealing buffer to anneal and synthesize 3 double-stranded DNAs from 3 pairs of VP2-crRNA upstream primers (crRNA-F1, crRNA-F2, crRNA-F3) and downstream primers (crRNA-R1, crRNA-R2, crRNA-R3) and purify them; Use the HiScribe™ T7 Quick High Yield RNA Synthesis Kit to transcribe the above 3 double-stranded DNAs into crRNA-1, crRNA-2, and crRNA-3 in vitro; Then, the reaction was carried out overnight at 37 °C. After incubation with DNase I, the harvested reaction products were purified using an RNA purification kit. After measuring the concentration, they were stored at -80 °C for later use.

[0024] As Figure 8 shown, in "Step S6", a cleavage reaction system was configured, and the best crRNA was screened according to the fluorescence curve; Using the LbaCas12a (Cpf1) nuclease reagent, a cleavage reaction system was configured: Cas12a (50 nM) 0.5 μL, ssDNA reporter (0.5 μL, 40 nM), crRNA (crRNA-1, crRNA-2, crRNA-3, all 50 nM) 0.5 μL each, 10× Reaction Buffer (1×) 2.5 μL, template 1 μL, and nuclease-free water was added to make up to 25 μL; Except for the individual reaction of a single crRNA, the three crRNAs were combined in pairs to form crRNA (1+2); crRNA (2+3); crRNA (1+3); The reaction procedure was as follows: The reaction temperature was set at 37 °C, and the fluorescence value was read every 1 min for a total of 40 cycles. The best crRNA was screened according to the fluorescence curve; The results showed that the fluorescence signal of the crRNA (1+2) combination was the strongest, and it was the best crRNA.

[0025] As Figure 9 、 Figure 10 、 Figure 11 and Figure 12 shown, in "Step S7", the system components, probe concentration, Cas12a protein concentration, and crRNA concentration were screened and optimized; Removal of components in the RAA-CRISPR / Cas12a system: A complete reaction system was prepared using commercial LbCas12a, crRNA, dsDNA, ssDNA, and 10× Reaction Buffer. At the same time, reaction systems lacking LbCas12a protein, ssDNA molecule, crRNA, and dsDNA were configured respectively to verify the integrity of the CRISPR / Cas12a system. The results showed that only the complete system showed a fluorescence signal, and the systems lacking other components had no fluorescence, indicating that LbCas12a protein, ssDNA molecule, crRNA, and dsDNA were all indispensable in the reaction system, and the established RAA-CRISPR / Cas12a detection system must be complete to effectively amplify; Screening of probe concentration: Using the FPV plasmid 1×10 5Plasmid templates at copies / µL were used for RAA amplification. The ssDNA probe concentration gradients were set at 10 nM, 20 nM, 40 nM, 80 nM, 160 nM, and 200 nM, a total of 6 gradients. At the same time, a negative control with nuclease-free water as the template was set; the appropriate probe concentration was screened according to the reaction results. The experimental results showed that the detection effect was the best at a probe concentration of 160 nM; 5 Screening of Cas12a protein concentration: Using the FPV plasmid at 1×10 copies / µL of plasmid template for RAA amplification. The Cas12a protein concentration gradients were set at 160 nM, 80 nM, 40 nM, 20 nM, and 10 nM, a total of 5 gradients. At the same time, a negative control with nuclease-free water as the template was set; the reaction results at different concentration gradients were analyzed, and the detection effect was evaluated by observing indicators such as the fluorescence signal intensity. The results showed that at a Cas12a protein concentration of 80 nM, the fluorescence signal intensity of the detection system was appropriate and the detection effect was the best. Therefore, 80 nM was determined as the optimal Cas12a protein concentration; 5 Screening of crRNA concentration: Using the FPV plasmid at 1×10 As shown in Figure 13 and Figure 14 the figure, in "Step S8", multiple viral nucleic acids and gradient-diluted recombinant plasmid standards were used for the reaction to verify the specificity and sensitivity of the method; RAA-CRISPR / Cas12a specificity test: RAA-CRISPR / Cas12a reactions were carried out using the nucleic acids or cDNAs of FPV, CDV, RV, VSV, and GTPV as templates respectively. At the same time, a negative control with nuclease-free water as the template was set; a qPCR machine and a blue light gel cutter were used to collect the reaction results, and the presence of specific amplification was judged by detecting the change of the fluorescence signal. The results showed that except for FPV, the fluorescence signals of other virus samples did not increase, which was consistent with the results of the negative control. This indicated that the established RAA-CRISPR / Cas12a method could specifically recognize FPV nucleic acid and had no cross-reaction with other viruses, showing strong specificity; RAA-CRISPR / Cas12a sensitivity test: The recombinant plasmid standard was serially diluted 10-fold. Standard plasmids with a concentration range of 1×10 6 to 100 copies / μL were used as templates, and nuclease-free water was used as a negative control to conduct the RAA-CRISPR / Cas12a reaction; during the reaction, the change in fluorescence signal intensity over time was monitored in real time, and templates with different dilution concentrations were repeatedly detected to ensure the accuracy and reliability of the results; by statistically analyzing the fluorescence signal data, the lowest template concentration at which a positive result could be detected was determined; the experimental results showed that the lowest concentration of positive plasmid that could be detected by the RAA-CRISPR / Cas12a method was 1×10 1 copies / μL, indicating that this method has high sensitivity and can effectively detect low concentrations of Feline panleukopenia virus nucleic acid from giant pandas, and can accurately identify it even when the virus nucleic acid content is extremely low.

[0026] As a preferred scheme, in "Step S9", nucleic acid of clinical samples was extracted, RAA-CRISPR / Cas12a detection was carried out, and the results were compared with those of qPCR detection; Twenty-four fecal samples of giant pandas from Chengdu Research Base of Giant Panda Breeding and six anal swab samples of cats from animal hospitals were collected; First, a professional nucleic acid extraction kit was used to extract nucleic acid from these samples. After qPCR detection, all samples showed negative for FPV. Considering the difficulty in obtaining nucleic acid from positive samples of giant panda feces, 9 FPV DNA standards were artificially added to some samples to simulate positive samples, and the remaining 15 samples were used as negative samples; at the same time, a negative control with ddH2O as the template was set up. These samples and 6 cat anal swab samples were separately subjected to RAA-CRISPR / Cas12a detection and qPCR detection, and the two were used as parallel detection methods to verify the correlation of the methods; By comparing the results of the two detection methods and calculating the coincidence rate between them, the effectiveness and reliability of the RAA-CRISPR / Cas12a detection method in the detection of actual clinical samples were verified; The detection results of clinical samples showed that samples positive by real-time fluorescence quantitative PCR detection were also all positive by RAA-CRISPR / Cas12a detection, and the coincidence rate of the two methods reached 100%; This fully demonstrates that the RAA-CRISPR / Cas12a method established in this study has a high degree of conformity with the real-time fluorescence quantitative PCR method and can be fully used for the rapid detection of clinical samples, providing an efficient and reliable new method for the clinical diagnosis of feline panleukopenia virus from giant pandas.

[0027] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant pandas, characterized in that: It includes the following steps: S1. Primer and probe design; S2. Screening of RAA amplification primers; S3. Optimization of RAA reaction conditions; S4. Verification of the sensitivity and specificity of RAA; S5. Preparation of crRNA; S6. Screening of the optimal crRNA; S7. Optimization of the RAA-CRISPR / Cas12a system; S8. Verification of the specificity and sensitivity of RAA-CRISPR / Cas12a; S9. Detection of clinical samples.

2. The raccoon dog parvovirus RAA-CRISPR Cas12a detection method for giant panda source according to claim 1, characterized in that: In "Step S1", according to the conserved region of the FPV capsid protein VP2 gene sequence logged in NCBI and the PAM site recognized by the Cas12a protein.

3. The RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant panda according to claim 1, wherein: In "Step S2", the upstream and downstream primers of RAA are cross-combined to carry out the RAA reaction, and the primer pair with the most ideal amplification effect is screened out.

4. The RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant panda according to claim 1, wherein: In "Step S3", the optimal temperature and time of the RAA reaction are determined.

5. The RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant panda according to claim 1, wherein: In "Step S4", by gradient dilution of FPV DNA and RAA amplification with a variety of viral nucleic acids, the sensitivity and specificity of this method are verified.

6. The RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant panda according to claim 1, wherein: In "Step S5", double-stranded DNA is synthesized by annealing and then transcribed into crRNA, which is purified and reserved for use.

7. The raccoon dog parvovirus RAA-CRISPR Cas12a detection method from giant panda according to claim 1, wherein: In "Step S6", a cleavage reaction system is configured, and the optimal crRNA is screened according to the fluorescence curve.

8. The RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant panda according to claim 1, wherein: In "Step S7", the system components, probe concentration, Cas12a protein concentration, and crRNA concentration are screened and optimized.

9. The RAA-CRISPR Cas12a detection method for feline panleukopenia virus from giant panda according to claim 1, wherein: In "Step S8", reactions are carried out using a variety of viral nucleic acids and gradient-diluted recombinant plasmid standards to verify the specificity and sensitivity of this method.

10. The raccoon dog parvovirus RAA-CRISPR Cas12a detection method from giant panda according to claim 1, characterized in that: In "Step S9", nucleic acids of clinical samples are extracted, RAA-CRISPR / Cas12a detection is carried out, and the results are compared with those of qPCR detection.

Citation Information

Cited By

  • Primer and probe combination for detecting four viruses in cat digestive tract, application of primer and probe combination and kit

    CN121380449A

  • A primer and probe combination for detecting four feline digestive tract viruses, its applications, and a kit.

    CN121380449B