A method for constructing a multiplex PCR reaction system for detecting and identifying pycnospora and its application
By designing highly specific and sensitive multiplex PCR primers and optimizing PCR reaction conditions, a multiplex PCR system was constructed, which solved the problem of rapid and accurate identification of species of coin spot pathogens, and achieved efficient detection and identification of large batches of samples.
Patent Information
- Application Number
- CN202210549115.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-20
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2042-05-20
AI Technical Summary
Existing technologies struggle to quickly and accurately detect and identify different species of caudal spot bacteria, especially C. jacksonii, C. paspali, C. monteithiana, and C. hainanense. Traditional morphological methods are inefficient, while molecular biological methods are time-consuming and unsuitable for large-scale diagnosis.
We designed highly specific and sensitive multiplex PCR primers, obtained species-specific gene clusters through multiple sequence alignment, optimized PCR reaction conditions, and constructed a multiplex PCR system that can simultaneously detect and identify multiple species of coin spot pathogens.
It enables rapid and accurate detection and identification of species of coin spot pathogens, is suitable for large batches of samples, improves the efficiency and accuracy of disease diagnosis, and has important field application value.
Smart Images

Figure CN116179735B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for designing multiple species-specific primers, and more particularly to a method for constructing a multiplex PCR reaction system for the detection and species identification of coin spot disease and its application. Background Technology
[0002] Coin spot is one of the most serious diseases affecting turfgrass. There are six main pathogens causing coin spot, among which *C. jacksonii*, *C. paspali*, *C. monteithiana*, and *C. hainanense* are the most widely distributed and prevalent both domestically and internationally. The detection and identification of plant pathogenic fungi is a crucial task in disease diagnosis and control, especially given the significant differentiation and pathogenicity differences among the four species of coin spot fungi. Because the morphological differences among the coin spot fungi are minimal and vary greatly across different growth stages and environments, traditional morphological detection and identification methods are inefficient and inaccurate, failing to meet the practical needs for rapid identification.
[0003] Currently, with the development of molecular biology techniques, using fungal DNA as a template to clone ITS sequences and align them through sequencing is the main method for pathogen identification. Although this method has the advantages of high accuracy and specificity, it is time-consuming and costly, making it unsuitable for diagnosing large numbers of pathogens. Therefore, it is particularly necessary to design highly sensitive and specific primers and construct a multiplex PCR system that can simultaneously and rapidly detect and identify single or multiple species.
[0004] However, designing such a highly specific and sensitive multiplex PCR system is difficult for the following two reasons: First, the species of *Symplocos rubrum* to be identified are closely related and have similar gene sequences, so primers need to be designed at positions where the gene sequences of different lineages differ significantly and where the gene sequences within each species are conserved (to avoid false positives); Second, multiplex PCR requires adding two or more pairs of primers to the same PCR reaction system to amplify multiple nucleic acid fragments simultaneously, which is more difficult than single PCR reaction, thus making it difficult to construct such a PCR system. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the first objective of this invention is to provide a method for constructing a multiplex PCR reaction system for the detection and species identification of C. jacksonii, C. paspali, C. monteithiana, and C. hainanense, respectively, by designing PCR primers with high specificity and sensitivity for four species of C. jacksonii, C. paspali, C. monteithiana, and C. hainanense, and constructing a multiplex PCR reaction system with a mixture of four primer pairs.
[0006] The second objective of this invention is to provide a primer set for detecting and identifying species of *Cryptotympany* based on a multiplex PCR method.
[0007] A third objective of this invention is to provide a kit containing the aforementioned primer set.
[0008] The fourth objective of this invention is to provide the application of the aforementioned primer set and the aforementioned reagent kit.
[0009] The technical solution adopted by this invention to solve its technical problem is:
[0010] In a first aspect, the present invention protects a method for constructing a multiplex PCR system for detecting and identifying species of *Coin spot*, comprising the following steps:
[0011] ① Obtain the whole genome sequence of each species of coin spot pathogen and perform multiple sequence Blast alignment. Based on the gene consistency rate, further obtain the unique gene sequence of the same species.
[0012] ②The species-specific gene clusters are determined by the unique gene sequences obtained in step ①. Using the genes in each species-specific gene cluster as templates, primer pairs are designed to clone gene sequences according to conventional primer design principles to verify gene specificity.
[0013] ③ Using the specific gene in step ② as a template, design multiple upstream and downstream primers (fragment size <800bp) to generate primer pairs and verify the specificity and sensitivity of the primer pairs;
[0014] ④ Using the primer pairs generated in step ③, randomly combine them according to the size of the target fragment to be amplified to generate a multiplex PCR primer set.
[0015] This invention targets four species of fungi causing dollar spot disease: C. jacksonii, C. paspali, C. monteithiana, and C. hainanense.
[0016] The construction method of this invention can simultaneously obtain multiple unique gene sequences of each species of coin-shaped ...
[0017] Secondly, this invention protects a primer set for detecting and identifying species of C. jacksonii based on multiplex PCR, wherein the C. jacksonii species include C. paspali, C. monteithiana, and C. hainanense; the primer set consists of primer pairs targeting specific gene fragments of C. jacksonii, C. paspali, C. monteithiana, and C. hainanense.
[0018] The C. jacksonii specific gene sequence is any one of the following A)-E):
[0019] A) As shown in nucleotides 1-392 of SEQ ID No: 1;
[0020] B) As shown in nucleotides 72-376 of SEQ ID No: 1;
[0021] C) As shown in nucleotides 1-630 of SEQ ID No: 2;
[0022] D) As shown in nucleotides 260-440 of SEQ ID No: 2;
[0023] E) As shown in nucleotides 1-1724 of SEQ ID No: 3;
[0024] The C. paspali-specific gene sequence is any one of the following F)-K):
[0025] F) As shown in nucleotides 1-1084 of SEQ ID No: 4;
[0026] G) As shown in nucleotides 1-1870 of SEQ ID No: 5;
[0027] H) As shown in nucleotides 1153-1514 of SEQ ID No: 5;
[0028] I) As shown in nucleotides 675-849 of SEQ ID No: 5;
[0029] J) As shown in nucleotides 1-972 of SEQ ID No: 6;
[0030] K) As shown in nucleotides 1-268 of SEQ ID No: 7;
[0031] The C. monteithiana specific gene sequence is any one of the following L)-P):
[0032] L) As shown in nucleotides 1-1124 of SEQ ID No: 8;
[0033] M) is shown as nucleotides 1-981 in SEQ ID No: 9;
[0034] N) As shown in nucleotides 581–832 of SEQ ID No: 9;
[0035] O) As shown in nucleotides 182–544 of SEQ ID No: 9;
[0036] P) As shown in nucleotides 1–1763 of SEQ ID No: 10;
[0037] The C. hainanense specific gene sequence is any one of the following (Q)-U):
[0038] Q) As shown in nucleotides 1-2482 of SEQ ID No: 11;
[0039] R) is shown as nucleotides 1391-2086 in the sequence listing SEQ ID No: 11;
[0040] S) As shown in nucleotides 1116-1403 of SEQ ID No: 11;
[0041] T) is shown as nucleotides 1-1598 in the sequence listing SEQ ID No: 12;
[0042] U) As shown in nucleotides 271-836 of SEQ ID No: 12;
[0043] Preferred,
[0044] The C. jacksonii specific gene sequence is any one of the following B) and D):
[0045] B) As shown in nucleotides 72-376 of SEQ ID No: 1;
[0046] D) As shown in nucleotides 260-440 of SEQ ID No: 2;
[0047] The C. paspali-specific gene sequence is any one of the following (H) and (I):
[0048] H) As shown in nucleotides 1153-1514 of SEQ ID No: 5;
[0049] I) As shown in nucleotides 675-849 of SEQ ID No: 5;
[0050] The C. monteithiana specific gene sequence is any one of the following N) and O):
[0051] N) As shown in nucleotides 581–832 of SEQ ID No: 9;
[0052] O) As shown in nucleotides 182–544 of SEQ ID No: 9;
[0053] The C. hainanense specific gene sequence is any one of the following R), S), and U):
[0054] R) is shown as nucleotides 1391-2086 in SEQ ID No: 11;
[0055] S) As shown in nucleotides 1116-1403 of SEQ ID No: 11;
[0056] U) is shown as nucleotides 271-836 in the sequence listing SEQ ID No: 12.
[0057] As a preferred technical solution of this application, the primer set consists of the following (1), (2), (3), and (4), wherein (1), (2), (3), and (4) are primer pairs targeting specific gene fragments of C. jacksonii, C. paspali, C. monteithiana, and C. hainanense, respectively; wherein,
[0058] (1) Selected from the following primer pair (a) or primer pair (b):
[0059] The primer pair (a) is specifically:
[0060] CJ_Gene2_F1: TCCACGTCCAGAGCCAACA, as shown in SEQ ID No: 13;
[0061] CJ_Gene2_R1:TCCGCTTTCATTTCACCC, as shown in SEQ ID No: 14;
[0062] The primer pair (b) is specifically:
[0063] CJ_Gene1_F1: GGACACCCTTGATAGCAGAAA, as shown in SEQ ID No: 15;
[0064] CJ_Gene1_R1: TGTGGGCGGAGAAGTGAA, as shown in SEQ ID No: 16;
[0065] (2) Selected from the following primer pair (c) or primer pair (d);
[0066] The primer pair (c) is specifically:
[0067] CP_Gene2_F1: CTGGTTCTAGGATATGCGATTT, as shown in SEQ ID No: 17;
[0068] CP_Gene2_R1: CGTTCTGGCATCCATTTGTC, as shown in SEQ ID No: 18;
[0069] The primer pair (d) is specifically:
[0070] CP_Gene2_F2: CTGAACGATGCGGGAGTC, as shown in SEQ ID No: 19;
[0071] CP_Gene2_R2: CAAGCATGAAGTTATCGAGCC, as shown in SEQ ID No: 20;
[0072] (3) Selected from the following primer pairs (e) or primer pairs (f);
[0073] The primer pair (e) is specifically as follows:
[0074] CM_Gene2_F1: TTTGAATTGGTTGACTCGGTAA, as shown in SEQ ID No: 21;
[0075] CM_Gene2_R1: TCGTTGATTGTGGTAGGTGC, as shown in SEQ ID No: 22;
[0076] The primer pair (f) is specifically as follows:
[0077] CM_Gene2_F2: CAACAGCGGCTCTTCCTC, as shown in SEQ ID No: 23;
[0078] CM_Gene2_R2: GTCTCCATAGCACCCATCGT, as shown in SEQ ID No: 24;
[0079] (4) Selected from the following primer pairs (g), primer pairs (h), or primer pairs (i);
[0080] The primer pair (g) is specifically as follows:
[0081] CH_Gene2_F1:ACCTTCTCGCTCCAGTTCTTT, as shown in SEQ ID No: 25;
[0082] CH_Gene2_R1:CGATCACGCTCATCCATTTC, as shown in SEQ ID No: 26;
[0083] The primer pair (h) is specifically as follows:
[0084] CH_Gene1_F1: CTTAGCGACTTTGATACTGCG, as shown in SEQ ID No: 27;
[0085] CH_Gene1_R1:ACCGGCTTCGATGACCTG, as shown in SEQ ID No: 28;
[0086] The primer pair (i) is specifically:
[0087] CH_Gene1_F2: AACCCAAGTTCAAGTCACGG, as shown in SEQ ID No: 29;
[0088] CH_Gene1_R2: CAAAGTCGCTAAGGGAAATAAA, as shown in SEQ ID No: 30.
[0089] This invention also protects the use of the primer set described above in the preparation of reagents for the detection and species identification of coin spot disease.
[0090] Thirdly, this invention protects a kit for detecting and identifying species of *Cryptotympany* based on a multiplex PCR method, comprising the primer set described above.
[0091] As a preferred embodiment of this application, the kit further includes multiplex PCR reaction reagents.
[0092] Fourthly, the present invention also protects a multiplex PCR method for detecting and identifying species of coin spot bacteria, which uses the primer set described above, or the kit described above.
[0093] Specifically, the multiplex PCR method includes the following steps:
[0094] 1) Extract DNA from the sample to be tested and use it as a DNA template;
[0095] 2) Perform multiplex PCR using the primer set described above;
[0096] 3) The amplified products were detected and identified by gel electrophoresis.
[0097] Fifthly, the present invention also protects the use of the primer set described above, or the kit described above, or the method described above, in multiplex PCR detection of coin spot disease and identification of its species.
[0098] As a preferred technical solution of this application, the detection and identification are applied to a large number of coin spot strains or field samples.
[0099] As a preferred technical solution of this application, the present invention also protects the primer set described above, or the reagent kit described above, or the method described above for detecting and identifying single or multiple species of coin spot pathogens.
[0100] Beneficial effects
[0101] Compared with the prior art, the outstanding effect of the present invention is as follows:
[0102] This invention provides a method for constructing a multiplex PCR system for the detection and species identification of *Cryptocoryne coinneri*. The method utilizes the whole genome sequences of various *Cryptocoryne coinneri* species for multiple sequence alignment to obtain multiple sequence alignment files. Primers are designed based on specific genes to verify gene specificity. Primer pairs are randomly combined and excluded based on the size of the target sequence product, eliminating those that do not meet screening criteria or have low specificity and sensitivity. The multiplex PCR reaction conditions are optimized to design a multiplex PCR system with high specificity and sensitivity to the target strain, achieving the effect of simultaneously detecting and identifying single or multiple *Cryptocoryne coinneri* species. This invention is of great significance for field disease diagnosis and species identification. Attached Figure Description
[0103] Figure 1 A flowchart illustrating the construction and application of a multiplex PCR system for the detection and species identification of coin spot pathogens;
[0104] Figure 2 To illustrate the amplification effect of a multiplex PCR reaction system at different annealing temperatures for the detection and species identification of coin spot pathogens;
[0105] Figure 3 To demonstrate the specificity of each primer in a multiplex PCR reaction system for detecting and identifying common lawn pathogens;
[0106] Figure 4 To assess the sensitivity of primers at different dilution gradients in a multiplex PCR reaction system used for the detection and species identification of coin spot pathogens;
[0107] Figure 5 To verify the effectiveness of the multiplex PCR reaction system for the detection and species identification of coin spot pathogens on a large number of strain DNAs;
[0108] Figure 6 The effect of a multiplex PCR reaction system for detecting and identifying the species of coin spot fungus on leaves infected by various species strains;
[0109] Figure 7 The effect of using a multiplex PCR reaction system for the detection and species identification of coin spot pathogens on leaves collected in the field.
[0110] Specific implementation methods
[0111] The following description, in conjunction with the accompanying drawings and specific embodiments, further illustrates the construction and application of a multiplex PCR method for detecting and identifying species of *Coin Spot* fungus according to the present invention. The following embodiments will further illustrate the present invention, but do not limit the scope of the invention.
[0112] Example 1
[0113] Combination Figure 1 As shown, a method for constructing a multiplex PCR system for the detection and species identification of coin spot pathogens is described, with the following specific steps:
[0114] (1) Seven C. jacksonii, two C. paspali, three C. monteithiana and two C. hainanense were selected for whole genome sequencing and assembly. Based on the sequencing results, the protein sequences were Blast aligned (E value < 1e-5) to screen for species-specific genes.
[0115] (2) Determine the location and distribution of specific genes on the genome of each species based on the genome annotation file, thereby screening genes within the specific gene cluster.
[0116] (3) Using genes within the gene cluster as templates, primers were designed using Primer 5 software according to standard principles (see Table 1). Full-length gene clones were cloned using the 2×Rapid Taq Master Mix (Novozymes, P222-2) enzyme to screen for species-specific genes. The specific steps are as follows:
[0117] 1) The primer powder was prepared to 10 μM using ddH2O. The primer concentration in this study is 10 μM.
[0118] 2) Prepare the reaction system in the PCR tube:
[0119] 2 x Rapid Taq Master Mix 12.5μl Primer 1 (10μM) 0.5μl Primer 2 (10μM) 0.5μl Template DNA 1ul <![CDATA[ddH2O]]> 10.5μl Total 25ul
[0120] 3) PCR reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s / kb, 35 cycles; 72℃ extension for 5 min. 4) The PCR products were subjected to 1.5% agarose gel electrophoresis. The target species showed a band consistent with the size of the gene fragment, while the other three species did not show any amplified bands, indicating that this gene is a species-specific gene sequence.
[0121] (4) Using the species-specific gene verified in step 3 as a template, design multiple primer pairs using Primer 5 software. The primer design principles are: fragment size <800bp; primer length 18–24bp; Tm≈58℃, upstream and downstream primer ΔTm<3℃; avoid the formation of stable dimers or hairpin structures between primers (see Table 2). Use Primer-BLAST (Primerdesigning tool (nih.gov)) online to detect primer specificity. The specific steps for determining gene fragment specificity are the same as in step 3.
[0122] (5) Using the species-specific gene fragment primers obtained in step 4 as a reference (see Table 2), primers were randomly combined according to fragment size, with the principle that adjacent fragments differed in size by more than 50 bp. The primer pairs selected for subsequent multiplex PCR reactions are as follows:
[0123]
[0124]
[0125] (6) Determine the optimal annealing temperature for the multiplex PCR reaction system. The specific steps are as follows:
[0126] 1) Prepare 100 ng / μl solutions of DNA from the four bacterial strains using ddH2O:
[0127] 2) Prepare the reaction system in the PCR tube:
[0128] 2 x Rapid Taq Master Mix 12.5μl Primer 1 (10μM) 0.5μl / piece Primer 2 (10μM) 0.5μl / piece Template DNA 1ul / each <![CDATA[ddH2O]]> Add to 25μl Total 25ul
[0129] 3) Gradient PCR reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃ / 58℃ / 60℃ / 62℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 7 min.
[0130] 4) Perform PCR products on a 1.5% agarose gel at 155V for 30 minutes. Analyze the bands accordingly. Figure 2 Annealing at 58℃ was used for subsequent experiments.
[0131] (7) Determine the specificity of multiplex PCR reactions. The specific steps are as follows:
[0132] 1) DNA from 15 common turfgrass pathogenic fungi was added as a template, and water was used as a negative control. Figure 3 ).
[0133] 2) Prepare the reaction system in the PCR tube as in step 6.
[0134] 3) PCR reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 7 min.
[0135] 4) Perform PCR products on a 1.5% agarose gel at 155V for 30 minutes. Analyze the bands accordingly. Figure 3 Adding a single coin-shaped fungal species resulted in a single band; adding a mixture of DNA from four coin-shaped fungal species resulted in four bands; 15 other pathogenic fungal species and those in water showed no specific amplification or bands.
[0136] (8) To test the sensitivity of each primer in the multiplex PCR reaction system, the DNA concentrations were diluted to 30 ng / μl, 10 ng / μl, 1 ng / μl, 500 pg / μl, 100 pg / μl, and 10 pg / μl. The PCR reaction system was the same as in step 7, and the results are as follows. Figure 4 As shown.
[0137] (9) Validation of the multiplex PCR system on a large number of strains. Forty-six *Avicennia marina* strains previously isolated and purified in the laboratory were selected. Their species identity was detected by ITS amplification and sequencing. The specific validation method was the same as in step 7. The results showed that the species identity identified by the multiplex PCR reaction was consistent with the ITS sequencing identification results. Figure 5 This demonstrates the accuracy of the multiplex PCR reaction system in this invention.
[0138] Example 2
[0139] The multiplex PCR method for detecting and identifying *Cephalotaxus fortunei*, constructed in Experiment 1, was applied to the identification of leaf samples. The specific steps are as follows:
[0140] (1) The coin spot pathogen isolated and purified in the laboratory was used to infect the turfgrass *Paspalum notatum*. DNA was extracted from the infected leaves and identified by multiplex PCR. The specific steps are as follows:
[0141] 1) Four species of *Aureobasidium* were identified, and two strains of each species were cultured. Twenty mycelial cakes were punched using a 5mm diameter punch and placed in 100ml of PDB. The cakes were incubated at 25℃ and 100rpm for 3 days. Mycelial suspensions were collected and inoculated onto *Aureobasidium* turfgrass, and cultured in a 26℃ light incubator for 3 days.
[0142] 2) Collect the infected leaves of each strain of *Aeonium argenteum* into 2 ml centrifuge tubes, and randomly mix the infected leaves into 2 ml centrifuge tubes, and record the species of the mixed samples.
[0143] 3) DNA was extracted from leaves infected with *Cephalotaxus fortunei* using the traditional CTAB method. The DNA was dissolved in sterile water and used as a template. Multiplex PCR was then performed. The reaction system was as follows:
[0144] 2 x Rapid Taq Master Mix 12.5μl Primer 1 (10μM) 0.5μl / piece Primer 2 (10μM) 0.5μl / piece Template DNA >1ng / piece <![CDATA[ddH2O]]> Add to 25μl Total 25ul
[0145] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 7 min.
[0146] 4) Perform PCR products on a 1.5% agarose gel electrophoresis at 155V for 30 minutes. Analyze the agarose gel electrophoresis bands as shown ( Figure 6 The appearance of bands with the same size as the designed specific primers, the appearance of a single band in leaves infected with a single strain, and the appearance of the same band in leaves infected with a mixture of multiple strains, demonstrates the correctness of the specific primers designed for multiplex PCR by the method of the present invention.
[0147] (2) DNA was extracted from leaves collected directly from golf courses affected by dollar spot disease in different regions and identified by multiplex PCR. The specific steps are as follows:
[0148] 1) Samples were collected from the following golf courses: Hainan: West Coast (XHA), Meilang Bay (MLW), Mission Hills (GLH), Meilan (ML), Three Kilometers (SGL), Boao Forum (BALT), Boao Country (BAXC), Shenzhou Peninsula (SZBD); Shanghai: Dongzhuang (DZ); Yunnan: Yulong Bay (YLW). Each golf course sample was mixed into two aliquots, and genomic DNA was extracted from the leaves and identified using multiplex PCR, following the same steps as in Example 2, Step 1.
[0149] 2) Field samples are complex; the same sports field can be infected by multiple species of coin spot pathogens. Due to varying degrees of infection, some samples may not reach the lower limit of the detection sensitivity of this invention. This can be seen from the agarose gel electrophoresis images. Figure 7 The study found that almost all samples from the sports fields tested positive for the coin spot pathogen, and the pathogen was identified as a specific species. In summary, the multiplex PCR method for detecting and identifying the species of the coin spot pathogen, as described in this invention, can be applied to the diagnosis of coin spot disease in the field and is of great significance for disease control.
[0150] Table 1
[0151]
[0152] Table 2
[0153]
[0154] The scope of protection of this invention is not limited to the above embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims. sequence list <110> Nanjing Agricultural University <120> A method for constructing a multiplex PCR reaction system for the detection and species identification of coin spot pathogens and its application. <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 395 <212> DNA <213> Artificial Sequence <400> 1 atgaaaaacc ttctcagtac aattttcctc gctgccgtag caaccggcgt ttacgctgta 60 cccgtatctc cggacaccct tgatagcaga aacctcgcgg ctaagacggc ctatactgtt 120 aatgcatatg gaaaagagat tgcagctgcg gatgaggtcg aggtacttgg cagaactctc 180 gcggctaaga cagcctacac tgttgatgca tatggaaaag atattgcagc tgcggatgcg 240 gtcaaggtac ttggctgaat tctcgctggt aagacggcct atattgttaa tacatatggg 300 atttaaaatg gtgcacgcgc tagggtagat tatattacag ttatcataat ggatattctt 360 cacttctccg cccacaacaa ctgcaaagtt cttga 395 <210> 2 <211> 633 <212> DNA <213> Artificial Sequence <400> 2 atggcccaaa gaacacatcc agcccaccaa aactctccgt ggcgtaacac gttccctgaa 60 accattttcg atattgatcc gctcaccacg cctggagaag tccccatatc acctcatgac 120 aatactcata atcatttcgc ttctacgagt tcaaacctat ttccaggaca agagaatccc 180 aattataacg ataggccaca ccttaatccc acaatacaaa atggcaggat cgaaatcgac 240 aatgaaacaa attcccctat ccacgtccag agccaacagc ttttcgcata tttagtagag 300 gctgcagccc ctacgaaaaa gcaaatggca gagggtatca gagaggacat tcaaagagag 360 atggaggagg gaaacaagag aactcttgag cagatggaag agaggatcat aaacaaggtt 420 gggggtgaaa tgaaagcgga cataaagaag atggagatgc agatagtgca gatagcagaa 480 catatgagga aactcgggga atatctcaaa cagcaggcgc agcagtaagt ttcctgaata 540 taaaaagtat tcagtattta gctaattcga tgcaggcaac aaggaccata cattctcaca 600 ccatacaatg ctgaggccga ccagagagtg taa 633 <210> 3 <211> 1727 <212> DNA <213> Artificial Sequence <400> 3 atggcgtccc cagctcagac atcagaactt gccaatagca gcacacttga tctctcagag 60 tatgattcca atgaacaatt gttcttgaat tttccgatgc acactggaat agaactagat 120 acgctgatag acaggttctt ccctcgggac agcatcttta acaacaatat tttatcagct 180 agagaagtat tattagctcc tagcatttct tccgattgtt gtgtgctaga gttgactatg 240 gaattagcct gaagtagttt ctttaccgta ttttccagga tatgcagtca ataacctttt 300 tgctcatgga tctgagcctc ttctaaacaa tctgcagggt tcagtctcag gagtggttac 360 tgacaacctg cgactttgga gctattccag accagtcgga ctccccagta gtagctgttt 420 acataaccct cgaatcaaaa ccttcggaat cagtagttgt atctatgcaa tgttcagtaa 480 gcccctccat caacttgacc gagtcaagta acgaagaacc aacgccattg ataagcatcc 540 aaggatcacg aaagcttgga agtatacact catctagtaa gttttgaact ctattgactt 600 agctatactt gatctgacat attacagaaa gttctataaa ctcaactaca ctacaaagca 660 agcagcgaaa gttttctgag acatatgatt ctatctccag taagctctgc ctaatctgtc 720 ttcatacaaa atccttacta aaatgtaaaa gcacctgcaa gccagaataa gaagtcaccc 780 agtggtcgac gtacaagacc aaaaacttct tttcagaa catctcagca attagaaac 840 gtattataag gcatgtgcaa acacccttt aagactagct taaatcatat agtatatag 900 ggactagctc ccacttagtt ttaagaatgg catgactatt tacccctt tgagaccaa 960 gtagtgtagt actggattac taccccagga tctccttcta cacgtgctat tgggatgcac 1020 gtactctcac ttcgaccatc ttacaata tgactcgat attagaggat atacatggc 1080 tgcttgagga aaataccaa gaatggtat taatacaaa aagagagaa ggattgattg 1140 tatcgaggga caacgctta gcctggggtg ctcagatga aaggtgaca agagaatagg 1200 aagggagt ctagtcgatg tttgaagacc cattttctgt aattccgtag tttgtatcta 1260 gtttaaactt caacagata ttttcagatc ctacagctgt aagagaga gatacaggat 1320 acggcagttgg cccggtggaa gcgattgcgc agcgtgagca tccacgctgt gttgaagaat 1380 atgttgtgga gcgaggcacg tttccgggga tttcaggaac ccgtattgca agccatcatg 1440 aagcaccaga gccccatcgt ggcagtcatg ggcaccgggg cggggaagtc gttgttgttc 1500 cagttgcccg ccaagagcat gagttcgggg acgacagtgg tcatcagccc attagtatca 1560 ttgcaggacc atatggtaga gcaatatcag caggccaaca ttgcgtgtat caagtaggat 1620 ccccgccagt gccattcccc cagccagatt gtcatcgtca cgccgtcttc cgccgtcagc 1680 aagacgtttg ggacgttttg gaccgattgc aaggaataca ttgttag 1727 <210> 4 <211> 1087 <212> DNA <213> Artificial Sequence <400> 4 atgtcttcat cataccaaat cgctgacttg ttggtgatca gcttgcagaa actcgcatcc 60 tctgacttgc aagaaataca aagactactc gaggcctgtg agaaacatgg ctttttttac 120 ctcgacctga aaggatcaga agggtttacg aaggactgga aaagtattct cgcactcatg 180 aaaacctact tttctcaacc attggcgctg aagatgcaag atgcctacca aagcgacgtt 240 tgggggtaag atatctttgt ttgcattgac tggtgtggct tttaaagcag gtattgacta tcgatctaga tttgagccgg tcgggacatc aagtggagtg aatcagaaag tagatgacta tgaatcatta aaggttggta agtacatcca gctgctagaa atatgctaaa gaggatctta gataccacga gaggaata agtcttcgga tcagtttttt cgaacagagt tcgccaagga gattccaa ctcttcaggc gattcat cgaagcacat aattcctgc aaatgattct tgctagcttg tctgctgggt tgaagctcga tgaaaattct gcacttgga attackcacag cgatgaagag ccatctcgaa ccacattatc tatgtttcgc tacccgaaaa tagaacccac 720. gacattgggt gagacaca ataagcacac tgatctcggt acactgactc tcttgctcac caagcaatgg ggactcgagg ttctctcgcc cgacggcagc gggtggaaat cagtacagcc gagcggtgac cacgccatca tcaacgttgg tgacagcctg cgtttcctca ccggagca 840 gctcaaatct gctgtgcacc gcgtggtacc gaccgaagag cttaagcacg aagatcgcta cagcatagcg tactttctac gtgctgcaga taacgtgagg tatcatgata gcaaagggag gagtttctcg gcaaaagact ggcatgatgt caagtttgat gtctttcgac aaagtcacga 1020 agaacaggag gctgacgcgt tcctcacagg tggcatggag aagggcgatg tcccgttgac 1080 agtttag 1087 <210> 5 <211> 1873 <212> DNA <213> Artificial Sequence <400> 5 atgaacccca acgatatcgg aacctactta cccttatgtg ctttcatttt atacctcttg 60 ttgctctaca atcttgctat caagccactt ttccttggtc ccctttccaa aataccgaat 120 gctcattgga ccagtccaat ttcatcagca tggattttat ggacacgcta tcaacatcaa 180 gagctcaaag tccttcacaa aatgcaccaa gaatatggcc cggttatcag gcttggtccg 240 aaggacctta gcgtcagctc ttttgaaaat ggtgtaaagc tgatttacac tggtggttat 300 gaaaagcctt catactatga ctttttcaaa tactatgggt aagttcaaaa tgtttgtgcg 360 taagtgttaa gaaggaagca ttactgactt aaaaatggaa taataggaaa gccaacgcat 420 tttgtagtct cacaagaaaa gaccattcct tctaccgccg aagactctcg agcgtctatt 480 cgaagtcttc cttgatgcat tctgagcatc tgaaggatat caccctcagc atcatcaacc 540 acagtttaag gaacttactg catcaacgag cagaggaagc tacccctgtt throw agctgagcta tgccttgagt cttgatgttg tcaactcttt catttttgga caagcgagca gcaccaaatt tttgctgaac gatgcgggag tcacagagtt tttagaacaa tacgagctcc 780. ggttttgcga tgaaagcttc tgggaacaag aacttccttt tgccactcga atgttaaaaa gcatcggaat atcgatgcta cccaattcct atttcatgtc gagagactgg ctcgataact tcatgcttga catgtgcgac agagcagagc atattctaag tactacgaag gaattgtgtc ctgctgacat tccggttgtt tatcagaaag tgaaagaagc cgcggataag gattctagtg atatgtctcc tttagataga cgtcttcatg ttggaagcga actgtttgat catatgtgta tgtacctcaa ggttcatctt ccctagtttg gtcatactaa ctgatggaat attagccagt tctcgagaag tgctcggtca gtcaaagtat aatgttcgaa aagagcgaaa tgaaagctaa ttcagcctag gactggttct aggatatgcg atttactata tttcacagag cccagataca caagcacgac ttttcacaga gctctcttct ttgcctttag aagtccgtca gcagcttgat 1260 gggtcaacag gatcaaaaca gggcagttt gcctctgccc ttgacaagct cccatatctc 1320 gatgccgtta tcaaggaagc tcttcgaatg cgtcctaaca gcacaccttt gcctcgaatc 1380 acgcccagtg attgtgctgt tagtctaggt ggatatgatg acatcccgcc caaaacacga 1440 gtgaacactt accaatggtt catccatcgg aactcggaca agtggagata tgtagaacaa 1500 tggatgccag aacgttggct tcaggaacat ggccatctga tgcagtcaaa gagagaaaat 1560 ggggttcttt ggcctttgg cagcggttca agaggttgcg tcggcaatca tctcgcaggt 1620 tacagtatgc aaccccttct caagttaagc tttcagaaca attgtctcta tcttggttga 1680 ccttcaacgc tcaagagttg aatatggtag tgctaatata ttttgcaata cagtaatgag 1740 gattgtactc gctgtcatct actataattt caacacaa ggcattccgg atgagcagtt 1800 tggtttccat actccaggct ctccccagga caggctgatg gtatcattca aaacactggt 1860 gccacgcaag go to 1873 <210> 6 <211> 975 <212> DNA <213> Artificial Sequence <400> 6 atgtcctcat ttgacaaaag caaagtaagg caatcaattc cggccgaaaa caacaaata tgggctgtgg agcgaagacg aagtcaaaat cgggtggccc agaaaatta tcgtacgtcc cacacagcac agttcgagtg gtggtcgcgc agctgcat gatttaggtc aaaacatcaa aaatagactc aacagccttg aggaatca tcggtcactc atccataaca aaattgtttc cgcaataccg ccaagcatac cgccaagcat atcgccaagt ataccgggga ttggggtagc 360. tacatatcac gagctacatc tttctaacgc ctctaccggt gcattcccat cccctcaaaa ctctacagcc aataccaaca acactgagtt atgggatgac tttgacctag aagacattaa tcaactgttg gatgtgagca tgaaatttc tattggtctc tgagagccgc aattttaagt atgataagat tactcattcg tcgacggtga cagatctcat ccccaacgga cgcacatcaa 600. aacacaacca ccaatggctt cccaaccacc attagctcct atccatcctc tcagtccctt gtgttgcctc ggttcgccgt ggatctcaac ttagacatgc accctacttc ccaatcgacc 660 ttcaccgaca gtctctccat tgctaagtcg ggcacagcgc tacatttagc cgtcaggaaa 720 aaccacgaat ctacagcccg cgtgctgatt gaaaacggtg cggacgtggg ggctctcgat 780 gaagagggtc gcacgccttt gcatgtcgct gccgaaatgg ggagctatga ttgcgtacag 840 ctgttgatta acaagggggc tcagctggaa ttgttggatc acaaaaatat gtcggctgtg 900 aagttggcag ctatgaacgg gttggtggat gtcgtgaccc tattattgga gcatggcgcg 960 aatgcaaatt cgtag 975 <210> 7 <211> 271 <212> DNA <213> Artificial Sequence <400> 7 atgaaatact tcactctttg cggtagcgtt cttgcgctgg tatctttcgt attggcccag 60 cagcagccat gctataacca ggccgatcca gacgggtacg ttgtccaatt cccctgagaa 120 tcgtgtaact gcgctaacaa ataatagcgg cctgcctaac tattgctatt gcaacgacgg 180 ttcctgctgg gctatatcgg acaacgattg cagcccaccg tcatcggaac agctctaccc 240 atgcccggtc ggagatcccg ttctcggcta a 271 <210> 8 <211> 1127 <212> DNA <213> Artificial Sequence <400> 8 atggttatgg attccctcat tccaaatgac ccccgggtcg aacacaagta ctctaatgtt 60 gaagacggca tcacatatca ctacatgcta gcaaagccaa aaggaaaagc aattgccacc 120 gtcgtacttc ttcatggctg gtaagtaaat ttcatatcag gctccctgag atgtcaaata 180 tctgactgta ttcacttttg caggccggat ctaggaatgg gctggcgttt ccaagtcccc 240 catctcctct ccttgaatct ccaagtagtc attccagata tgctcggata cggtcaaacc 300 tcttcaccct tagcccctca aggatattct atgaaaaaaa catcaagtca tatagctcac 360 atcgtccgcg aagtaactac tgagcccatt attctgggcg gtcatgactg gggagctttt 420 cttgcttggc ggacagccat ttactaccct tcacttatcc gtggtgtttt cacattctgc 480 gtccctttct ttccacctcg acccactgtt atcactctgg aacagttcgt cgagcaactt 540 ccggatttca aatatcaatt gcagcttgct agtccggttg ctgagactgt ggctgaaaaa 600 tcagaagcta cgttgagggg ctttttgagt agtatgtttg ggggtgttac tcctgaggga 660 ttacctgggt ttgatctctc tactggagtc atcgcagaaa gacttgagaa gattatttct 720 acacctctca tgacctctga gattttagat cactatggta tctatatcta tatctaactt 780 gtcaacgaaa agctaacctt tttttaccaa tttcagtcca ggaatattct cggaatggtc 840 ttcatggccc aatgaattgg tatcggacca tgtcgataaa cagcgaagaa gaactcccac 900 tggctgaaaa aatgcctgat ttcaagttcc aaataccggg aatgattgtt atggctggag 960 aggaccctgc attacggcca gttatggctg agggtcaaga gatatatttt gctgcagggt 1020 tgaaaaaagg acttatacca ggagcatctc attgggtctt gacccatttc cctaaggagg 1080 caaataagta tatcgaagag tttgtgaaag agttactcca agcataa 1127 <210> 9 <211> 984 <212> DNA <213> Artificial Sequence <400> 9 atggccgaac aaacagttgt ttttatttct ggagttagtt caggtatgta aatagcttag 60 atattcttaa aaaacggaat aatccacaag gttcagagct cactagtaat ctaggaatcg 120 gaaaaggatt agctgaatac tatctctcga aatcaaacca cacagtcatc ggaagtatcc 180 gcaacagcgg ctcttcctcc gtagaagagt taaagtcaac taagcctgca agcggttcca 240 agctacttct cgtacacatc gaaagtacct cacctgatga cccaaagaaa gcattaaccg 300 atacgaagc cgccggcatt ggacacatcg atacgtctt cgccaatgca ggaggaagtc 360 cacccgtcgt gggtattgaa gatgtttcta gcaaggacat gatttccagc tatcaaacaa 420 acgctcttgg tccccttgta cttttccaaa cacttagacc attgcttcag aagtcaaaga 480 atccgaagtg ggcttctatt acttcgatca gtggttcaat tgctacgatg ggtgctatgg 540 agacttggat tactcctgct tatggtgctt ccaaagctgc tttgaattgg ttgactcggt 600 aagtctaacg ttatgtcaga atttctttc aaatcatact aattcatcga taaagtgcaa 660 ttcactgcag tcagccatgg cttgttacag ttgctttgca tcctgggtaa ttccccttc 720 gaataattt aaattgagga attctaataa aatatagtct tgtccaaact ggtccaggta 780 actggatcgc tcgtcatatc gggatggaac aagcacctac cacaatcaac gatagcgttt 840 tgactttagc tgagaaagta agtagctcac tatattataa agtcatgttc taatcacaat 900 tctttctagg ttgaggaagc tacccgcgat aactattctg gcaaatacat aagcgttatg 960 gaaggtaatg agattccttg gtaa 984 <210> 10 <211> 1770 <212> DNA <213> Artificial Sequence <400> 10 atggctagat tctctagctt cgcaacattc ggtcttctgc ttttgcagtc tttggtggct 60 gcttctcccc aaccatgcat caatggtctt tgtgatttta ctcgcagcaa tctgtcaact 120 gagaatgttg ttcgtgagct aggcccgcaa atttccaata gctccagcat ttatggtccc 180 gatgatcctc gtttcgccaa cgatacagca agataccaag catacaagcc acctgttatt 240 agaatggtcg tccagcctgg atctgaagcg gacattccta aaatagtatg tataacgcag 300 ctctttgaag aacagcaaag aaggcaactg acactcctat aacaggtcaa atatgccaac 360 gccaatagca tcccttttct cacagtcaac cgtgctcatg gcttgactag tactttggga 420 aaattttctg gtatgcaaat tgacatggga ctgttgagaa acatcgacat tcaaccagga 480 ggaaagacag ctatattcca aggaggacc tatgatggac aggtcatcga ttatctttgg gataaaggct acgttgccag tatgtaattc aaggccatct gaaatcttta gtcatcatgg aagctgattg atatagccac tggaagttgt gcctgtgtcg gtatgcttgg tccgggtctt 660 ggtggcggtc acggtcgcta ccaaggatta tacggatga tcagcgacaa tgttgtcaaa ttgaacgtgg ttttagcaaa cggttcagct ataactgtct cagaaagtc taaccctgat ttgctctggg ctatgaaagg tgctggtcac aactttggta ttgtcactag ctttgagctc 840 aagattcatc cacgtcttgt tgatacatgg tactacaaaa acttcgtctg gaagcaagac aagctcgaga ctgtattcgg ggcgttgaac gagctgcaca aaaatggcag aaatgtcagc gagctggccg tcaattatgg cactattggg gtaaatgcaa gcatcagcgc aactgaagta agctaccaga actctccaat tattttgagg tagaatacta acttttatta ggcggttatc tggtggtcat ttacatatgc tggacctgaa aaagatggta aaaagtggtt cgacgctttc 1140 gataaattc catccgaata cgttgaaga ggaaatgtac cgtataccca gattgccgat gtaaccggaa gcggaatgaa ccaacctctc tgcgccaaag gattagaaca tgttcactca 1260 accacctatc tcaacacatg gaatattacc acccagcgac agctctacaa tctcttccaa 1320 cataagatca cccagcaacc tttactgata aactctattg tgatgctcga ggactactca 1380 acagttggtg tgcgagcggt cgatgcgaaa acatctgctt ttccctggcg taatcgcgag 1440 ctcctcacgt aagtacctcc aaaaaatttc tacgattcta ggctgataaa atgcattcaa 1500 agtgttaccg ctatcaacta tccacccaat tcttctctcg atgcgtttgc taccgaatgg 1560 gcaaaccaaa gtctaaatct gatgaatgaa ggctctggtc ttgagccttc tacttatgtt 1620 aattatgcga ctggagacga gccacttgag cagatgtacg gaaaggaacc atggcgcctt 1680 cagagacttc gttcgttaaa agctaagtac gatcctttcg gaagattcaa ctactacaac 1740 ccaattactt atggctatgg ccataaatag 1770 <210> 11 <{211}> 2486 <212> DNA <213> Artificial Sequence <400> 11 atggctgagc ccgacgcgcg gcgtagacga ccagcagtgt aggttgagat cccctgtcgg 60 cgttctttga actgattgta ggaccttagg tcatgttctc tctgtaggcg acgcaagatc 120 cgatgcaatc gagaacgcc ctgcagcaat tgtctgcggt ccaaaaccga ggcttgtgtc 180 tatgagaatc ccaatcatcc tccatctccc cggcaccatc ttggccatgg tcagatagct 240 ggctctggct tagctccgag gccccgagag ccaatgccta ttgatagtgc atccagcacg 300 agcgggtcga tactccaaag ccatctatca agctcactgg tcactggttc aacaaaggta 360 tcgactccta tgagtcagtc atccactcag gataccgaga cgatgaaatt gaagcttagg 420 attcaacagc ttgaagacca gctatctaag tcgacactga agcccattca gtttcctgtt 480 tcaactccaa actcggatat cgagacgaca agctcacgtc tgggtggaac ctttcacatc 540 cattgtgaga gaggttcgtt tggcaaacct caggccattg cccgtaacat tacacataa 600 acacgcttat tcggccaaag ccattgggg gtcaatggag ttcttctggt gagagtttac 660 ctgctgtcca gccattgagc ttcattaaat aaggaaatgg gctaacaagc atcagattcg 720 cgacattttt gggacgattg agccccatgt acgagaagag acatcaaaca cctggtccgg 780 catagagaag tgtaaatcct tggcaaggga tattaaagcg ctgagagcac ccttgtggcc 840 ctcgccaccc actccaaaat taccacctaa agaggttgcc gatacgctag ttgattgcta 900 cctccggaca actgaggcta tctatcgaat actgcacgtt cctacctttc gcagggacta 960 tgaagcgctc tgggtgtcga attcggcgtc cgacatggcc ttcttggttc aattaaagct 1020 cgtgcttgct atcggtgcga tcacgtatga tcaacagttt tcactgagag tctcagctat 1080 ccaatgggtt tacgaggcgc aaatttggat ttcagaaccc aagttcaagt cacggctaga 1140 cattcaatct ctacagacca atctccttct tttacttgct caggaaggag tgggagtcag 1200 cggagacttg atgtggattt cggtaggcgc actgcttagg aaagcagtgt acatgggcct 1260 acatagagac cccagtcgtc tacctcaaag aacagctttc gctgctgaga tgcgtcgaag 1320 gctctggaac acaattctgg aagtgactct acagtccagt ttgtcctccg ggggacctcc 1380 ttttattc cttagcgact ttgatactgc gcctcccggt aactttgacg acgaccagct 1440 tgtaactgac gatcctgtac cgaagccaga agatgaattc acgcaggtgt ctatcgcaat 1500 tgcactccgc aagacttttc cacaacgtct tgctggggtc aagtttttga acgatcttgc 1560 ctcttctggc acatacgagg aaactcttcg gctcgacagt gagctgcgcg cggcatacaa 1620 agctctgagt caaaccctgc aggcatgcag ccgctcgagt actcaatcct caccatctaa 1680 atttgaagtt cacgtggtag atttcattat gcaccgctat ctatcgtctc ttcatattcc 1740 atatttcggt ctggcgctgc atgagacggc ctacgcgttt tctcggaaag tggtggttga 1800 gtcatcgctc aaaatctggc gtgcggctta cccctcctca tctctcatga ccgaccagcc 1860 ccatggcaat gcggcactgc ccgactggga tgatctgccg cgacttgtga tctgcagttc 1920 aggcttctac ccaactgttg ccatacatgc tgcgtttctc attgcagtag agctcaggac 1980 acagctgcag gaggaagaaa gtctgggtcc tgtcattttg cggccggatc tgctttccgt 2040 cctagacgat gttcaggcat ggtgcttgca ggtcatcgaa gccggtgaaa ccaacgttaa 2100 aggctatatg ctcatgagcc tggttgcagc acaaattgaa gggctcatgg atagactgag 2160 aaaggataag gtcaccgagt tgttggtcaa agctgtggat aacgttggaa agagatgctt 2220 gccaatttta gaaggaatgg cggtggcggc tcaaggaaag ggagagagag ccacagatgg 2280 ccttcagcaa gtgtcgttag ccaccccaat cgaggaaatg gaggactggg ggtttatggt 2340 aagtacaaac gtatcttcgt atatacctac ttacccgtcg ctcatgattt tctcagacgt 2400 cagataccct atttaatcca ggtaacacag agccaataag ctggatgttc aatgacctca 2460 acccaggggt gccatcgctt tggtaa 2486 <210> 12 <211> 1601 <212> DNA <213> Artificial Sequence <400> 12 atggataata ttaacaatat catcagtgtg tacaatataa acattcctct gctccttcta 60 tcatcaagct tcgctgccat cttgctaggc agacttttca gaggcgataa gagcgatgcc 120 aacagtgacg ctgacggctg ccagcccgct ccgcggctct ggcagtggga tccattccta 180 ggactcgaca ctgtcatcag ccaggtgcga gcgctgcgac gcgactatta cctcgactgg 240 ctgcgcaacc tgcacactaa cagacctaag accttctcgc tccagttctt tagcaatcgt 300 tggttctact cgaccgaacc cgagattctc aaggccgttt atgccaccaa cttcaaagat 360 tttggcgttg agcccattcg ccgtaactcc aaaataacta tgccattcgc cgacaagggt 420 gtgaacacga ccgacggcga tgactgggca tttagccgca ccttgatcaa gcccttcttc 480 gagcgcgacg tctaccataa taccgaccgc attgcgtcat ttgccgaccg ctttctggct 540 ttgttcccag aggatggcga gacttttgac gtccagcccc tgctccagcg ctggttcctt 600 gacctcaata cagacttcat ttttggcaag tctgtagatt cactactgga accgtcgcaa 660 gctaaattcg cgtggaacat gatgacggcg ctgcgtgggg cgcggctgcg cacgcaagcg 720 catcgcttcc tgtgggcctt caactggaac tggtggctca cggctgttaa tgagatacac 780 gccttcgtca atgagcacat ccgcaaaaca tttgcagaaa tggatgagcg tgatcggagg 840 ctgaagcaga ggctggaggt ggagcccgag cgtaccgacc tgctgtggtc catggccagc 900 cagatgcgtg gcgacgaaga ggggctgcgt tcgcaagtat gccttattat cgtacccacc 960 aacgacacaa cgtccatctt catcagtaat tgtatctggt atctggcgcg ccacccggaa 1020 gcctgggaga agctccgcca ggaggtcgcg gctctgggtg acaacgcccc actgaccttt 1080 aacaccttgc gcaatatgtc ttacctcaat ggtgttatga acgagagtga gtacccctgt aatagacaa aggcaaaccc ctggctgacc attackacccac aatagcgcac cgcctgattc ccaacaacgc cacgcaggtg cgtgcctgtt tgcgagatac ggtgctgccc attggcggtg 1260 gtcctgacgg cagcgcgcct ctgcgagtgc ggaaggcaa catcgtatcg gtgaccaaga cggtcatgta ccgcgaccct gatcactggg gggccgacgc cgaggagtac cgtcctgaac 1380 gcttcgacgg tctgcatggc acatggggct tcttaccgta cggtggcggt ccacgtcgct gcccggccca gatgatggtg cagactgaat gctagcgcgc atagctcgga agtaccgccg tctcgaggcg cgtgacacgg agccttaccg cgccgtcatg cgcattggtc 1560 cgtccaacaa gaacggcgtg cgcattgcgc tgtataaatg a <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <400> 13 tccacgtcca 19th <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <400> 14 tccgctttca tttcaccc 18 <210> 15 <211> twenty one <212> DNA <213> Artificial Sequence <400> 15 ggacaccctt gatagcagaa a 21 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <400> 16 tgtgggcgga gaagtgaa 18 <210> 17 <211> twenty two <212> DNA <213> Artificial Sequence <400> 17 ctggttctag gatatgcgat tt 22 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 cgttctggca tccatttgtc 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <400> 19 ctgaacgatg cgggagtc 18 <210> 20 <211> twenty one <212> DNA <213> Artificial Sequence <400> 20 caagcatgaa gttatcgagc c 21 <210> twenty one <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty one tttgaattgg ttgactcggt aa 22 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <400> twenty two tcgttgattg tggtaggtgc 20 <210> twenty three <211> 18 <212> DNA <213> Artificial Sequence <400> twenty three caacagcggc tcttcctc 18 <210> twenty four <211> 20 <212> DNA <213> Artificial Sequence <400> twenty four gtctccatag cacccatcgt 20 <210> 25 <211> twenty one <212> DNA <213> Artificial Sequence <400> 25 accttctcgc tccagttctt t 21 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <400> 26 cgatcacgct catccatttc 20 <210> 27 <211> twenty one <212> DNA <213> Artificial Sequence <400> 27 cttagcgact ttgatactgc g 21 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <400> 28 accggcttcg atgacctg 18 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <400> 29 aacccaagtt caagtcacgg 20 <210> 30 <211> twenty two <212> DNA <213> Artificial Sequence <400> 30 caaagtcgct aagggaaata aa 22
Claims
1. A primer set for detecting and identifying *Mortica coinleaf* species based on multiplex PCR, characterized in that, It consists of the following (1), (2), (3) and (4), wherein (1), (2), (3) and (4) are respectively for C. jacksonii Primer pairs for specific gene fragments, targeting C. paspali Primer pairs for specific gene fragments, targeting C. monteithiana Primer pairs for specific gene fragments, targeting C. hainanense Primer pairs for specific gene fragments; among which, (1) Selected from the following primer pair (a): The primer pair (a) is specifically: CJ_Gene2_F1: TCCACGTCCAGAGCCAACA, as shown in SEQ ID No: 13; CJ_Gene2_R1:TCCGCTTTCATTTCACCC, as shown in SEQ ID No: 14; (2) Selected from the following primer pair (c); The primer pair (c) is specifically: CP_Gene2_F1: CTGGTTCTAGGATATGCGATTT, as shown in SEQ ID No: 17; CP_Gene2_R1: CGTTCTGGCATCCATTTGTC, as shown in SEQ ID No: 18; (3) Selected from the following primer pair (e); The primer pair (e) is specifically as follows: CM_Gene2_F1: TTTGAATTGGTTGACTCGGTAA, as shown in SEQ ID No: 21; CM_Gene2_R1: TCGTTGATTGTGGTAGGTGC, as shown in SEQ ID No: 22; (4) Selected from the following primer pairs (g); The primer pair (g) is specifically as follows: CH_Gene2_F1:ACCTTCTCGCTCCAGTTCTTT, as shown in SEQ ID No: 25; CH_Gene2_R1: CGATCACGCTCATCCATTTC, as shown in SEQ ID No:
26. The currency spot bacteria are selected from C. jacksonii , C. paspali , C. monteithiana and C. hainanense At least one of them.
2. The application of the primer set described in claim 1 for detecting and identifying species of *Cryptotympany* based on multiplex PCR in the preparation of reagents for detecting and identifying *Cryptotympany*.
3. A kit for detecting and identifying species of *Cryptotympany* based on multiplex PCR, characterized in that, Includes the primer set as described in claim 1.
4. The reagent kit according to claim 3, characterized in that, The kit also includes multiplex PCR reaction reagents.
5. A multiplex PCR method for detecting and identifying species of *Cryptotympany*, using the primer set of claim 1 or the kit of claim 3.
6. The multiplex PCR method for detecting and identifying species of *Cryptotympany* according to claim 5, characterized in that, Includes the following steps: 1) Extract DNA from the sample to be tested and use it as a DNA template; 2) Perform multiplex PCR using the primer set as described in claim 1 or the kit as described in claim 3; 3) Perform electrophoretic detection and identification on the amplified products.
7. The application of the primer set of claim 1, the kit of any one of claims 3-4, or the method of any one of claims 5-6 in the detection of coin spot disease and identification of its species by multiplex PCR.
8. The application according to claim 7, characterized in that, The detection and identification are applied to large-scale applications of spotted fungus strains or field samples.
Citation Information
Patent Citations
Three specific genes capable of generating fumonisins fusarium microspecies and application thereof
CN108456685A