170 results about "Indel" patented technology

The invention discloses a molecular marker related to thousand seed weight of wheat, a detection primer and application of the molecular marker and the detection primer, and belongs to the technical field of molecular marker-assisted breeding. The nucleotide sequence of the molecular marker TaDTX50-STS is as shown in SEQ ID NO. 1; basic groups from the 502 site to the 661 site of the sequence as shown in SEQ ID NO. 1 have insertion / deletion mutation. The InDel molecular marker related to the thousand seed weight character in a wheat genome is identified and named as TaDTX50-STS, and by detecting the polymorphism or genotype of the InDel molecular marker, the InDel molecular marker can be used for identifying or assisting in identifying the thousand seed weight character of wheat, assisting in breeding dominant varieties with high thousand seed weight of wheat and improving the wheat breeding efficiency.

The invention relates to the technical field of crop molecular breeding and detection, in particular to a sweet waxy corn molecular detection system based on an sh1 gene InDel marker and application of the sweet waxy corn molecular detection system, the sweet waxy corn molecular detection system is composed of a forward primer, a reverse primer and a transposon specific primer, and the sequences are shown as SEQ ID NO: 1-3. The sh1 gene InDel marker-based sweet waxy corn molecular detection system provided by the invention can be used for corn sh1 gene Mu insertion rapid detection and / or corn molecular marker-assisted sweet waxy corn breeding. By adopting a sweet waxy corn molecular detection system based on the sh1 gene InDel marker, the accuracy rate is 98.7%. And the detection cost of each sample is 0.15 dollars, and compared with the traditional SSR marking technology, the cost is reduced to 3% of that of the traditional SSR marking technology. From DNA extraction to final result interpretation, the whole detection process takes 3 hours.

The present disclosure provides compositions and methods for prime editing with improved editing efficiency and / or reduced indel formation by inhibiting the DNA mismatch repair path way while conducting prime editing of a target site. Accordingly, the present disclosure provides a method for editing a nucleic acid molecule by prime editing that involves contacting a nucleic acid molecule with a prime editor, a pegRNA, and an inhibitor of the DNA mismatch repair pathway, thereby installing one or more modifications to the nucleic acid molecule at a target site with increased editing efficiency and / or lower indel formation. The present disclosure further provides polynucleotides for editing a DNA target site by prime editing comprising a nucleic acid sequence encoding a napDNAbp, a polymerase, and an inhibitor of the DNA mismatch repair pathway, wherein the napDNAbp and polymerase is capable in the presence of a pegRNA of installing one or more modifications in the DNA target site with increased editing efficiency and / or lower indel formation. The disclosure further provides, vectors, cells, and kits comprising the compositions and polynucleotides of the disclosure. The present disclosure also provides compositions and methods for prime editing with improved editing efficiency and / or reduced indel formation with modified prime editor fusion proteins. The disclosure further provides, vectors, cells, and kits comprising the compositions and polynucleotides of the disclosure.

A genomic data analyzer workflow may be configured to identify, with a variant annotation module, subsets of patient variants which match at least one medical reference variant database entry, even if the variant calling information in genomic data analyzer workflow and the database use different variant representations of SNP, MNP, INDELS and DELINS. In particular, database variants which are included into a subset of patient variants may be identified even if they do not exactly match the corresponding strings. The variant annotation module may be adapted to apply a branch-and-bound-like algorithm to efficiently process all possible subsets of patient variants in a genomic region.

The invention discloses a molecular marker InDel20 for identifying soybean oil content, a primer and application of the molecular marker InDel20. The molecular marker InDel20 is an insertion / deletion variation of 321 bp located at the 20th chromosome Chr20: 31728602-31728922 of the soybean, and the nucleotide sequence of the molecular marker InDel20 is as shown in SEQ ID No. 1; wherein the soybean material containing the insertion fragment is high-oil-content soybean, and the soybean material not containing the insertion fragment is low-oil-content soybean. The invention further provides a primer for detecting the molecular marker InDel20 and a method for identifying the content of soybean oil, and the identification accuracy rate is as high as 90.61%. The molecular marker InDel20 can be used for early-stage molecular marker-assisted selection of soybean high-oil characters, is suitable for germplasm resource screening, variety identification and molecular breeding of high-oil soybeans, and has important application value for accelerating polymerization of high-quality alleles and improving breeding efficiency.

The invention relates to the field of genes, in particular to molecular markers for judging flowering time of brassica napus L. The molecular markers are Indel-282, Indel-326 and Indel-353 respectively and are located on an A02 chromosome of the brassica napus L.. The molecular marker has high specificity and stability, and is significantly related to the flowering time. The markers show high specificity and stability in brassica napus plants under different genetic backgrounds. By detecting the molecular markers through PCR amplification and electrophoresis, the flowering time of different plants can be quickly and accurately identified in the early stage of breeding. Therefore, the flowering time of the plant can be determined in the early stage, so that the breeding efficiency is improved. The molecular markers can be used for molecular marker-assisted selective breeding, and plants with early flowering or late flowering characteristics can be quickly screened by detecting the markers, so that the breeding process of excellent varieties is accelerated, and the functions and regulation mechanisms of related genes are further disclosed.

The invention discloses a CHRM3 gene InDel molecular marker associated with growth and reproduction traits of a large white pig and application of the CHRM3 gene InDel molecular marker, a 62bp deletion variation is identified in a second intron of the CHRM3 gene, and a breakpoint is positioned in a second intron 521426525142713bp (a pig chromosome 14 reference sequence NC010456.5) of ENSSSCT00000082112.1. The application for detecting / identifying the growth and reproduction traits of the large white pigs is developed on the basis of the molecular marker, and the detection method is simple, rapid and low in cost and can be used for accurately screening individuals with better traits such as backfat thickness, primary birth litter weight, total multiparous litter size and gestation period of multiparous sows in the early stage, so that genetic improvement is carried out on the growth and reproduction traits of the pigs, and the economic benefit is increased. Multiple characters such as growth and reproduction can be selected at the same time, the breeding period of excellent boars can be shortened, and the breeding efficiency and progress are accelerated.

The application discloses a KASP molecular marker of a Nicotiana benthamiana NbSAG101a gene and application thereof. The KASP molecular marker is an InDel insertion and deletion marker of the Nicotiana benthamiana NbSAG101a gene, is located at 256-262 bp of a second exon of the Nicotiana benthamiana NbSAG101a gene, and the nucleic acid sequence of the KASP molecular marker is shown as SEQ ID NO: 4. A wild-type allele of the Nicotiana benthamiana NbSAG101a gene is C, contains a 7 bp sequence shown as SEQ ID NO: 4, and a mutant-type allele is A, and the 7 bp sequence shown as SEQ ID NO: 4 is deleted. The KASP marker provided by the application can accurately and quickly distinguish wild-type homozygotes, heterozygotes and mutant-type homozygotes of the NbSAG101a gene, has high specificity, high accuracy, fast detection speed, low cost and high flux.

The present invention relates to methods of detecting region(s) of interest in a gene comprising a polyA tail. The region(s) of interest can include gene(s), region(s), mutation(s), deletion(s), insertion(s), indel(s), and / or translocation(s). The region(s) can be greater than or less than 1 kilobases from the polyA tail. Methods can include forming a library of single cell transcripts comprising the region(s) in close proximity to a cell barcode and a unique molecular identifier (UMI). Methods for distinguishing cells by genotype can include amplifying the transcripts using PCR methods and detecting the cell barcode and UMI using single cell sequencing methods. Transcripts can be enriched using tagged region-specific PCR primers. Cell barcodes can be brought into close proximity to the region(s) by circularizing the transcripts. Sequencing of the transcripts can include using primer binding sites added during PCR amplification and library indexes for multiplexed sequencing.

The invention relates to the technical field of molecular biology, in particular to a betel nut InDel marker and application thereof in provenance detection. According to the invention, on the basis of the results of re-sequencing of one betel nut germplasm resource and comparative analysis of a reference genome sequence, InDel sites are excavated to develop molecular markers, 46 pairs of InDel molecular marker primer pairs with high polymorphism are obtained, the variation range of Shannon's diversity index is 0.361-1.713, and the variation range of polymorphism information content is 0.201-0.752. The clustering analysis result shows that the genetic similarity coefficient is 0.36, 211 parts of areca-nut materials are divided into four groups, the InDel marker pair provided by the invention can be effectively used for detecting and analyzing the genetic background of areca-nut germplasm resources, the genetic relationship between the tested areca-nut materials is accurately identified, and the method has the advantages of high specificity, high accuracy and high accuracy. And a foundation is laid for genetic diversity analysis of betel nut germplasm resources and detection of seed fruit and seedling sources.

This invention belongs to the field of molecular marker-assisted selection technology for pig breeding and pigs, specifically involving molecular markers related to pork quality traits and their applications. This invention will be located in... PPP3CB 5' flanking promoter region of the gene InDel Polymorphic sites are associated with pork quality traits including water loss rate, water holding capacity, and intramuscular fat. InDel When the genotype at the polymorphic locus is TT, the pork has a lower water loss rate, a higher water holding capacity, and a higher intramuscular fat content. InDel InDel When the genotype of a polymorphic locus is deleted, the pork has a higher water loss rate, lower water holding capacity, and lower intramuscular fat content. This invention enables early prediction and selection of meat quality traits that can only be measured after slaughter, during the early stages of pig growth and development. It not only allows for live detection and screening of pork quality traits but also significantly shortens the generation interval, accelerates the breeding process, and provides technical support for early pig breeding.

The application discloses a PARMS molecular marker significantly related to the tryptophan content of corn root systems and application thereof, the nucleotide sequence of 150 bp upstream and downstream of the molecular marker is shown as SEQ ID NO. 6, and the primer group nucleotide sequence for detecting the PARMS molecular marker is shown as SEQ ID NO. 1-SEQ ID NO. 3. ZmASB1 The application successfully develops a molecular marker based on the natural variation of the 5'UTR region of the (Zm00001eb080510) gene, the marker is significantly related to the tryptophan content of corn root systems, can accurately, efficiently and stably distinguish the InDel + genotype and the InDel ‑ genotype. The molecular marker can be widely applied to the tryptophan content of corn root system germplasm resources and molecular marker assisted breeding, and provides important technical support and theoretical basis for cultivating new corn varieties with high yield, stable yield and drought resistance.

The invention discloses an InDel molecular marker related to soybean grain weight, fat content and isoflavone content and application, and relates to the technical field of molecular detection. The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID NO. 4. Whole genome association analysis finds that insertion / deletion variation of 16bp and 11bp exists in a specific region of a No.13 chromosome of soybean, and an InDel molecular marker related to soybean grain weight, fat content and isoflavone content is provided based on the insertion / deletion variation of 16bp and 11bp. By utilizing the InDel molecular marker, the genotype of a target site can be rapidly and accurately detected, and soybean materials with different genetic backgrounds can be distinguished, so that soybean varieties with excellent grain weight, fat and isoflavone content characters can be effectively screened in an auxiliary manner. According to the method, the breeding selection accuracy and efficiency are remarkably improved, and a powerful tool is provided for accelerating the soybean genetic improvement process.

The invention relates to application of a group of InDel markers for efficiently identifying distant hybridization filial generations of apples and pears. The invention discloses a group of InDel markers for efficiently identifying distant hybridization filial generations of apples and pears. Wherein the InDel-1, the InDel-2, the InDel-3 and the InDel-4 are respectively positioned on a chromosome 3, a chromosome 2, a chromosome 6 and a chromosome 14 of an apple reference genome. Through the combined use, 100%, 80.4%, 72.4% and 82.5% of hybrids can be respectively identified in hybrid populations of 'Jinguan' * 'Zhuangzhuang', 'Jinguan' * 'Jinzhuang', 'Fuji' * 'Zhuangzhuang' and 'Fuji' * 'Jinzhuang'. Therefore, the InDel molecular marker disclosed by the invention can provide a rapid and accurate identification method for distant filial generations of apples and pears, and also provides an important tool for creating new varieties of rosaceae fruit trees.

The present application relates to the technical field of bioinformatics, in particular to a method for detecting microbial structural variation, mutation and insertion deletion based on second-generation sequencing. The present application is based on the short read Illumina second-generation sequencing strategy, through testing, using the current mainstream biological tools and combining the self-developed program, the automatic analysis of microbial metagenome structural variation (SV), single nucleotide variation (SNV / mutation) and small fragment insertion deletion (Indel) is realized, and the problems of low sensitivity, high false positive rate and low efficiency in the prior art for detecting variation under the metagenome background are significantly solved.

The application discloses a long-read data robust variant detection method and system based on data quality improvement, and belongs to the technical field of gene sequencing and biological information analysis. The method of the application is aimed at the characteristics of long-read data, and first, preprocessing is completed through sequence filtering and base correction, and a three-dimensional outlier feature system of sequencing support intensity, mapping quality reliability and strand-specific bias is constructed. Based on the median absolute deviation algorithm, the features are standardized and outlier scores are generated, a double-threshold dynamic optimization mechanism is constructed, and high-confidence data is screened. The variant candidate regions are identified through multi-tool joint comparison, the SNP and Indel are typed through a deep learning model, and the reliability of the results is ensured through triple cross-validation. The method does not need to manually set a fixed threshold, effectively suppresses interference factors, balances detection accuracy, robustness and scene universality, and provides high-quality variant data support for clinical diagnosis and genomics research.

This invention discloses the agronomic traits, InDel-labeled fingerprint, and construction method of the *Dictyophora indicum* strain YZS021, belonging to the field of *Dictyophora indicum* detection technology. The fingerprint is obtained by PCR amplification and electrophoresis detection using 10 pairs of InDel-labeled primers developed based on the whole genome of *Dictyophora indicum*. The InDel marker fingerprint spectrum detection of the *Dictyophora indicum* strain YZS021 of this invention is fast, accurate, and reproducible, and can specifically identify the strain, enabling precise identification of the fungal species and protection of intellectual property rights. In addition, this invention also discloses the agronomic traits of the *Dictyophora indicum* strain YZS021. The *Dictyophora indicum* strain 'YZS021' has a long and thick stipe, a high edible ratio, and good commercial characteristics. It can stably produce fruiting under both forest and facility cultivation modes, adapting to different cultivation scenarios and significantly improving planting efficiency. The above agronomic traits have consistency and stability, and can stably cultivate and obtain asexual reproduction lines with the above traits in both forest and facility fruiting rooms.

The invention discloses an InDel molecular marker for identifying pink and red peach blossoms, a primer pair and application of the InDel molecular marker. An insertion / deletion marker associated with the peach petal pink / red character is found in the 1195107 bp region to the 1195114 bp region of the sixth chromosome of a peach genome, PCR amplification is performed on different peach germplasm resources by using specific primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, the petal color of a single plant with a stripe of about 159 bp is pink, the accuracy rate can reach 96.7%, and the detection result shows that the peach petal pink / red character associated with the peach petal pink / red character is obtained. The petals of a single plant without amplified bands are red, and the accuracy rate is 66.7%. When the InDel marker is used for rapidly identifying the petal color character of the peach hybrid offspring in the seedling stage, the breeding workload is reduced, and the InDel marker has the advantages of convenience, low cost and the like, and can be applied to production in a large scale.

The invention relates to the technical field of molecular marker identification, and discloses a set of InDel molecular markers for identifying a wide-peel citrus variety and application of the InDel molecular markers, the InDel molecular markers comprise 42 InDel sites, each site is in two states, and each marker represents a chromosome site; 42 pairs of InDel molecular marker primers are correspondingly arranged on the 42 InDel sites, and the nucleotide sequences of the primers are shown as SEQ ID NO. 1 to SEQ ID NO. 84 in a sequence table. The 42 citrus InDel loci provided by the invention are stable in typing, have space-time crossing performance and can be used for constructing a citrus InDel fingerprint database. The method is beneficial to citrus variety identification, classification, germplasm resource protection and genetic diversity research.

The application belongs to the technical field of molecular markers, and discloses a molecular marker Ms_Chr4_73090327 related to stoma density of Medicago sativa and application. The application uses GWAS whole genome association analysis combined with molecular marker development to analyze the stoma density of Medicago sativa, and obtains an InDel molecular marker Ms_Chr4_73090327 which is closely linked to the stoma density, has polymorphism, is stable and reliable, at the 73090327 locus on the 4th chromosome of Medicago sativa, an insertion / deletion fragment TTTTCTTTCTTTGTTAGTAGAGTGTTTGGGA, and a primer pair corresponding to the molecular marker Ms_Chr4_73090327 is designed. The application further provides a method for rapidly identifying the stoma density of Medicago sativa by using the InDel molecular marker, which is simple and fast, accurate in identification result, and has a good application prospect.

A targeted panel with low sample input requirements from a tumor only sample may be processed to estimate mutation load in a tumor sample. The method may include: detecting variants in nucleic acid sequence reads corresponding to targeted locations in the tumor sample genome; annotating detected variants with an annotation information from a population database; filtering the detected variants, wherein the filtering retains the somatic variants and removes germline variants; calculating an initial TMB; and applying a calibration to the initial TMB level to produce a final TMB level for the mutation load of the tumor sample genome. The filtering may also include retaining nonsynonymous SNVs and indels for the analysis.

This invention relates to an identification method and kit for overlapping PCR with enzyme digestion. The method includes selecting a corresponding restriction endonuclease using N4N5X or N4N5Y as the last three bases of the introduced restriction site; if no corresponding restriction endonuclease is available, selecting a corresponding restriction endonuclease using N5X or N5Y as the last two bases of the introduced restriction site; amplifying to obtain a universal fragment primary PCR product; designing PCR amplification primers based on the restriction endonuclease and universal primers to obtain the primary PCR product of the template to be tested; and performing enzyme digestion and genotyping on the final product of the overlapping PCR amplification. This invention utilizes the DOPCR method to identify SNPs / InDels. Compared with existing methods that create restriction sites, it adds an overlapping PCR step, resulting in significant differences in the digested fragments. It eliminates the need for PAGE electrophoresis; detection can be completed using ordinary electrophoresis, making it low-cost and rapid.

The application relates to an application of a maize potassium high-efficiency gene NKT1 excellent haplotype. It is found that six linkage sites located on a maize NKT1 gene promoter are significantly related to the expression level of the gene. The 7.1 kb large fragment insertion of an InDel(-1592) site inhibits the activity of the NKT1 promoter, reduces the transcription level, and finally leads to the reduction of the potassium content and the nitrogen content in maize leaves. The NKT1 without the large fragment insertion of the InDel(-1592) site is an excellent haplotype, and a maize inbred line containing the excellent haplotype has a certain yield advantage. The identification of the excellent allelic variation of the NKT1 gene provides important gene resources and theoretical guidance for cultivating new maize varieties with high efficiency of potassium and nitrogen nutrients.

This invention discloses an InDel marker, Pmct3, for cold tolerance during rice budding, along with its identification method and applications, belonging to the field of molecular marker technology. This invention develops an InDel molecular marker from the insertion / deletion sequence between the Dongxiang wild rice introgression line D2 (background of the cold-tolerant rice 9311) and the cold-sensitive rice 9311 at the Chr1:28249918 and Chr1:28249919 sites in the O. sativa reference genome. Primers are then developed based on this molecular marker for identifying cold tolerance during rice budding. The detection cycle of this invention is only 2-3 hours, does not rely on subjective experience in traditional detection methods, and can obtain accurate and objective detection and identification results in a short time. It is low-cost, high-throughput, and highly specific, making it suitable for rice breeding and production practices.

The invention discloses an InDel molecular marker closely linked with soybean protein content characters, a detection primer and application, and belongs to the technical field of molecular biology. The nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO.5, the 96th site to the 106th site of the SEQ ID NO.5 are insertion or deletion variation, and the soybean containing the 96th site to the 106th site insertion sequence of the SEQ ID NO.5 is a variety with high protein content; and the soybean containing the 96th-106th deletion sequence of the SEQ ID NO.5 is a variety with low protein content. According to the invention, 11bp insertion / deletion variation at 377 and 973bp positions of the soybean 14 # chromosome is found, and experiments show that the 11bp insertion / deletion variation has remarkable relevance with the soybean protein content. When the gene is applied to molecular assisted breeding, the protein content expression of a soybean candidate material can be predicted at an early stage.

The invention discloses an InDel molecular marker for detecting black spot resistance of broccoli, a method and application, and relates to the field of molecular biology. The site is located at 56724071bp-56724089bp of a broccoli chromosome 5, and the site has insertion / deletion variation of 18bp basic groups (the nucleotide sequence is as shown in SEQ ID NO. 1). When the site has a 18bp basic group (the sequence of an amplification product is shown as SEQ ID NO.2), the broccoli is a black spot resistant plant; otherwise, the plants are black spot sensitive plants. The invention also discloses a pair of specific primers for detecting the InDel molecular marker, and the nucleotide sequences of the specific primers are respectively shown as SEQ ID NO. 4 and SEQ ID NO. 5. The InDel molecular marker can rapidly and accurately detect the black spot resistance of broccoli germplasm resources at low cost, does not need field inoculation identification, can be used for early screening of broccoli black spot resistance varieties and molecular marker-assisted breeding, significantly improves the breeding efficiency, and shortens the breeding period.

The present disclosure provides bovine animals and methods to create recipient bovine animals for spermatogenic stem cell transplantation / complementation through modulation of the NANOS2 gene. In one embodiment genome editing was used to create bovine animals with insertions or deletions (indels) that inactivate or otherwise modulate NANOS2 gene activity so that resulting male bovines lack functional germ cells yet retain functional testicular somatic cells, and bovine females are fertile. These bovine males can then be transplanted or complemented with donor cells capable of giving rise to cells of the spermatogenic lineage, or spermatogenic stem cells and used for breeding.

The invention relates to the technical field of bioinformatics, in particular to a method for detecting microbial structure variation, mutation and insertion and deletion based on next-generation sequencing. On the basis of a short-read-length Illumina next-generation sequencing strategy, a current mainstream biological tool is tested, and automatic analysis of microbial metagenome structure variation (SV), single nucleotide variation (SNV / mutation) and small fragment insertion and deletion (Indel) is realized by applying and combining a self-developed program; the problems of low sensitivity, high false positive and low efficiency during variation detection under the metagenome background in the prior art are obviously solved.

The present application relates to the technical field of goat molecular marker screening, and particularly relates to a goat ACSL5 associated with growth traits and application thereof. The present application amplifies fragments containing Indel1 site by using typing primers, and the amplification product is 216 bp for insertion type II, which contains a deletion marker sequence; the amplification product is 191 bp and 216 bp for hybrid type ID. The goat ACSL5 gene insertion-deletion variation detection method can be used for early selection of goats, and even selection can be performed as soon as lambs are born. The Indel1 site has a relatively obvious selection effect on Fuqing goats, and by selecting the ACSL5 advantageous alleles of the goat Indel1 site, the genetic progress of growth traits can be accelerated, the selection time can be shortened, and the economic benefits of effective goat individuals can be improved.

The present invention discloses a method for constructing a molecular identification card for plum germplasm and its application. The present invention uses 10 pairs of InDel-labeled core primers to effectively distinguish 72 plum germplasms. Bands amplified by the 10 pairs of InDel-labeled core primers, ID1-ID10, are then separated by the numbers 0-9, and sequentially arranged and combined to construct a QR-coded molecular identification card for plum germplasm. This method helps address the resource confusion caused by frequent hybridization and the presence of numerous transitional types among plum germplasms. It can quickly and accurately identify and authenticate specific plum germplasm species, and is of great significance for germplasm conservation, variety selection, and genetic diversity research.