231 results about "Indel" patented technology

The invention provides an Indel molecular marker primer pair, a kit and a method for identifying Yichang orange, and belongs to the technical field of biochemistry, the Indel molecular marker primer pair comprises at least one of an InDel-2 primer pair and an InDel-3 primer pair; the sequences of the InDel-2 primer pair are as shown in SEQ ID No. 1 and SEQ ID No. 2, and the sequences of the InDel-3 primer pair are as shown in SEQ ID No. 3 and SEQ ID No. 4. The Indel molecular marker primer pair or the kit disclosed by the invention can specifically recognize the Yichang oranges, realizes efficient and accurate identification of the Yichang oranges and filial generations thereof, and has wide application prospects in the aspects of citrus germplasm resource protection, variety right and interest maintenance, breeding selection, market supervision and the like. The method for identifying the Yichang oranges can accurately identify the Yichang oranges and the filial generations of the Yichang oranges, has high specificity, economical efficiency and high efficiency, is an accurate, economical and efficient hybrid identification means, can effectively identify the variety of the Yichang oranges and the hybrids of the Yichang oranges, and provides powerful technical support for scientific research and breeding work.

The invention discloses a molecular marker related to thousand seed weight of wheat, a detection primer and application of the molecular marker and the detection primer, and belongs to the technical field of molecular marker-assisted breeding. The nucleotide sequence of the molecular marker TaDTX50-STS is as shown in SEQ ID NO. 1; basic groups from the 502 site to the 661 site of the sequence as shown in SEQ ID NO. 1 have insertion / deletion mutation. The InDel molecular marker related to the thousand seed weight character in a wheat genome is identified and named as TaDTX50-STS, and by detecting the polymorphism or genotype of the InDel molecular marker, the InDel molecular marker can be used for identifying or assisting in identifying the thousand seed weight character of wheat, assisting in breeding dominant varieties with high thousand seed weight of wheat and improving the wheat breeding efficiency.

The invention provides an Indel molecular marker primer combination for identifying different populations of sargassum and a detection method and application of the Indel molecular marker primer combination, and belongs to the technical field of germplasm identification and genetic diversity analysis of macroalgae. The Indel molecular marker primer combination disclosed by the invention comprises an Indel-F1 / R1 and an Indel-F2 / R2, wherein the Indel molecular marker primer combination comprises an Indel molecular marker primer and an Indel molecular marker primer; the sequence of the Indel-F1 is as shown in SEQ ID NO. 1, and the sequence of the Indel-R1 is as shown in SEQ ID NO. 2; the sequence of the Indel-F2 is as shown in SEQ ID NO.3, and the sequence of the Indel-R2 is as shown in SEQ ID NO.4. The Indel molecular marker primer combination disclosed by the invention can be used for accurately identifying a creeping branch population and a guede population of a guede line and quickly distinguishing from other common sargassum, and has important significance in the aspects of resource protection, research and utilization of the sargassum.

The invention discloses a muskmelon fruit length molecular marker and application thereof. According to the method, two methods of BSA-seq and GPS-seq are utilized to perform preliminary positioning on the muskmelon fruit length related QTL, a reference genome Mel (DHL92) gene 3.6. 1 and a re-sequencing result are utilized to perform comparative analysis, two algorithms of SNP-index and InDel-index are comprehensively utilized to perform correlation analysis, the results of the two analysis methods are respectively counted, and the results of the two analysis methods are compared with those of the QTL. The larger segment is used as a candidate region associated with the length of the melon fruit, KASP06-3880 and KASP06-3606 are obtained, and the KASP06-3880 is located at the 34305438th basic group of the No.6 chromosome; the KASP06-3606 is located at the base at the 18936169th site of the chromosome 11; the two KASP markers KASP06-3880 and KASP11-3606 are subjected to genotype detection in extreme materials of F2 and RIL populations, and the two KASP markers determine the length of the muskmelon fruits, so that a new way is provided for breeding of the muskmelon fruits with different lengths.

The invention provides for systems, methods, and compositions for targeting nucleic acids. In particular, the invention provides non-naturally occurring or engineered DNA-targeting systems comprising a novel DNA-targeting CRISPR effector protein and at least one targeting nucleic acid component like a guide RNA.

The invention discloses an InDel marker closely linked with the sweet-glutinous homograin character of corn ears, a corn B73-V4 genome is used as a reference genome, the marker is a <-> / insertion sequence of 73 bp located at the position of 12126328 bp of a No.9 chromosome, and the nucleotide sequence of the insertion sequence is as shown in SEQ ID NO.1. The InDel marker closely linked with the sweet-glutinous homograin character of the corn ears has the advantages that the InDel marker closely linked with the sweet-glutinous homograin character of the corn ears is obtained; the InDel marker provided by the invention can be used for rapidly screening out a corn material containing a sweet-waxy homograin gene in the early growth stage of corn, and can also be used for molecular marker-assisted breeding of fresh corn. By adopting the InDel marker and the screening method provided by the invention, the screening accuracy is high, and by using the marker and the screening method, the production cost is saved, and the breeding efficiency is improved.

The invention discloses an InDel molecular marker related to wheat yield traits and application of the InDel molecular marker, and belongs to the technical field of molecular genetics. The InDel molecular marker is a molecular marker InDel 509; the nucleotide sequence of the molecular marker InDel 509 is as shown in SEQ ID No. 1. A wheat TaPRR95-5A gene functional marker InDel 509 is used for carrying out PCR (Polymerase Chain Reaction) amplification, polyacrylamide gel electrophoresis detection is carried out, and a germplasm material carrying a Hap II type is screened out according to the size of a target band. The functional marker can provide an effective marker resource for wheat genetic improvement and molecular marker-assisted breeding.

The invention relates to the technical field of crop molecular breeding and detection, in particular to a sweet waxy corn molecular detection system based on an sh1 gene InDel marker and application of the sweet waxy corn molecular detection system, the sweet waxy corn molecular detection system is composed of a forward primer, a reverse primer and a transposon specific primer, and the sequences are shown as SEQ ID NO: 1-3. The sh1 gene InDel marker-based sweet waxy corn molecular detection system provided by the invention can be used for corn sh1 gene Mu insertion rapid detection and / or corn molecular marker-assisted sweet waxy corn breeding. By adopting a sweet waxy corn molecular detection system based on the sh1 gene InDel marker, the accuracy rate is 98.7%. And the detection cost of each sample is 0.15 dollars, and compared with the traditional SSR marking technology, the cost is reduced to 3% of that of the traditional SSR marking technology. From DNA extraction to final result interpretation, the whole detection process takes 3 hours.

The invention belongs to the technical field of molecular markers, and discloses a molecular marker related to soybean stalk strength and application thereof. GWAS whole genome association analysis is combined with molecular marker development, the soybean stem strength is analyzed, the stable and reliable InDel molecular marker GmChr1739690797 which is closely linked with the stem strength and has polymorphism is obtained, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.4 or SEQ ID NO.5, the molecular marker is obtained by inserting / deleting a fragment TTGTACTAACGGTTTTAATTTTTATAGTTTATCAGGTG on the No.17 chromosome of a soybean, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO.4 or SEQ ID NO.5. In addition, a primer pair corresponding to the molecular marker GmChr1739690797 is designed in the invention. The invention further provides a method for identifying the soybean stalk strength by using the molecular marker, and the method is simple, convenient and rapid, accurate in identification result and has good popularization and application prospects.

The present disclosure provides compositions and methods for prime editing with improved editing efficiency and / or reduced indel formation by inhibiting the DNA mismatch repair path way while conducting prime editing of a target site. Accordingly, the present disclosure provides a method for editing a nucleic acid molecule by prime editing that involves contacting a nucleic acid molecule with a prime editor, a pegRNA, and an inhibitor of the DNA mismatch repair pathway, thereby installing one or more modifications to the nucleic acid molecule at a target site with increased editing efficiency and / or lower indel formation. The present disclosure further provides polynucleotides for editing a DNA target site by prime editing comprising a nucleic acid sequence encoding a napDNAbp, a polymerase, and an inhibitor of the DNA mismatch repair pathway, wherein the napDNAbp and polymerase is capable in the presence of a pegRNA of installing one or more modifications in the DNA target site with increased editing efficiency and / or lower indel formation. The disclosure further provides, vectors, cells, and kits comprising the compositions and polynucleotides of the disclosure. The present disclosure also provides compositions and methods for prime editing with improved editing efficiency and / or reduced indel formation with modified prime editor fusion proteins. The disclosure further provides, vectors, cells, and kits comprising the compositions and polynucleotides of the disclosure.

The invention can be used to provide a more efficient and less error-prone method of detecting variants in DNA, such as SNPs and indels. The invention also provides a method for performing inexpensive multiplex assays.

A genomic data analyzer workflow may be configured to identify, with a variant annotation module, subsets of patient variants which match at least one medical reference variant database entry, even if the variant calling information in genomic data analyzer workflow and the database use different variant representations of SNP, MNP, INDELS and DELINS. In particular, database variants which are included into a subset of patient variants may be identified even if they do not exactly match the corresponding strings. The variant annotation module may be adapted to apply a branch-and-bound-like algorithm to efficiently process all possible subsets of patient variants in a genomic region.

The invention discloses a molecular marker InDel20 for identifying soybean oil content, a primer and application of the molecular marker InDel20. The molecular marker InDel20 is an insertion / deletion variation of 321 bp located at the 20th chromosome Chr20: 31728602-31728922 of the soybean, and the nucleotide sequence of the molecular marker InDel20 is as shown in SEQ ID No. 1; wherein the soybean material containing the insertion fragment is high-oil-content soybean, and the soybean material not containing the insertion fragment is low-oil-content soybean. The invention further provides a primer for detecting the molecular marker InDel20 and a method for identifying the content of soybean oil, and the identification accuracy rate is as high as 90.61%. The molecular marker InDel20 can be used for early-stage molecular marker-assisted selection of soybean high-oil characters, is suitable for germplasm resource screening, variety identification and molecular breeding of high-oil soybeans, and has important application value for accelerating polymerization of high-quality alleles and improving breeding efficiency.

The invention relates to the field of genes, in particular to molecular markers for judging flowering time of brassica napus L. The molecular markers are Indel-282, Indel-326 and Indel-353 respectively and are located on an A02 chromosome of the brassica napus L.. The molecular marker has high specificity and stability, and is significantly related to the flowering time. The markers show high specificity and stability in brassica napus plants under different genetic backgrounds. By detecting the molecular markers through PCR amplification and electrophoresis, the flowering time of different plants can be quickly and accurately identified in the early stage of breeding. Therefore, the flowering time of the plant can be determined in the early stage, so that the breeding efficiency is improved. The molecular markers can be used for molecular marker-assisted selective breeding, and plants with early flowering or late flowering characteristics can be quickly screened by detecting the markers, so that the breeding process of excellent varieties is accelerated, and the functions and regulation mechanisms of related genes are further disclosed.

To develop a molecular marker related to carotenoid accumulation for the Patinopecten yessoensis variety "Haidu Jinbei" and to provide a method for maintaining population quality.SOLUTION: An InDel molecular marker related to carotenoid accumulation of Patinopecten yessoensis and an application thereof are disclosed. A base sequence of the InDel molecular marker in carotenoid accumulating Patinopecten yessoensis and a base sequence of the InDel molecular marker in common Patinopecten yessoensis are disclosed. Furthermore, an upstream primer sequence and a downstream primer sequence of a primer pair for amplifying the InDel molecular marker related to carotenoid accumulation of Patinopecten yessoensis are disclosed. By detecting the InDel molecular marker, homozygous Patinopecten yessoensis individuals capable of accumulating carotenoids can be conveniently and rapidly screened in a seedling stage and from parents, and effective technical support is provided for breeding of "Haidu Jinbei" and optimization of characters.SELECTED DRAWING: Figure 2

The invention discloses a CHRM3 gene InDel molecular marker associated with growth and reproduction traits of a large white pig and application of the CHRM3 gene InDel molecular marker, a 62bp deletion variation is identified in a second intron of the CHRM3 gene, and a breakpoint is positioned in a second intron 521426525142713bp (a pig chromosome 14 reference sequence NC010456.5) of ENSSSCT00000082112.1. The application for detecting / identifying the growth and reproduction traits of the large white pigs is developed on the basis of the molecular marker, and the detection method is simple, rapid and low in cost and can be used for accurately screening individuals with better traits such as backfat thickness, primary birth litter weight, total multiparous litter size and gestation period of multiparous sows in the early stage, so that genetic improvement is carried out on the growth and reproduction traits of the pigs, and the economic benefit is increased. Multiple characters such as growth and reproduction can be selected at the same time, the breeding period of excellent boars can be shortened, and the breeding efficiency and progress are accelerated.

The application discloses a KASP molecular marker of a Nicotiana benthamiana NbSAG101a gene and application thereof. The KASP molecular marker is an InDel insertion and deletion marker of the Nicotiana benthamiana NbSAG101a gene, is located at 256-262 bp of a second exon of the Nicotiana benthamiana NbSAG101a gene, and the nucleic acid sequence of the KASP molecular marker is shown as SEQ ID NO: 4. A wild-type allele of the Nicotiana benthamiana NbSAG101a gene is C, contains a 7 bp sequence shown as SEQ ID NO: 4, and a mutant-type allele is A, and the 7 bp sequence shown as SEQ ID NO: 4 is deleted. The KASP marker provided by the application can accurately and quickly distinguish wild-type homozygotes, heterozygotes and mutant-type homozygotes of the NbSAG101a gene, has high specificity, high accuracy, fast detection speed, low cost and high flux.

The present invention relates to methods of detecting region(s) of interest in a gene comprising a polyA tail. The region(s) of interest can include gene(s), region(s), mutation(s), deletion(s), insertion(s), indel(s), and / or translocation(s). The region(s) can be greater than or less than 1 kilobases from the polyA tail. Methods can include forming a library of single cell transcripts comprising the region(s) in close proximity to a cell barcode and a unique molecular identifier (UMI). Methods for distinguishing cells by genotype can include amplifying the transcripts using PCR methods and detecting the cell barcode and UMI using single cell sequencing methods. Transcripts can be enriched using tagged region-specific PCR primers. Cell barcodes can be brought into close proximity to the region(s) by circularizing the transcripts. Sequencing of the transcripts can include using primer binding sites added during PCR amplification and library indexes for multiplexed sequencing.

The invention relates to the technical field of molecular biology, in particular to a betel nut InDel marker and application thereof in provenance detection. According to the invention, on the basis of the results of re-sequencing of one betel nut germplasm resource and comparative analysis of a reference genome sequence, InDel sites are excavated to develop molecular markers, 46 pairs of InDel molecular marker primer pairs with high polymorphism are obtained, the variation range of Shannon's diversity index is 0.361-1.713, and the variation range of polymorphism information content is 0.201-0.752. The clustering analysis result shows that the genetic similarity coefficient is 0.36, 211 parts of areca-nut materials are divided into four groups, the InDel marker pair provided by the invention can be effectively used for detecting and analyzing the genetic background of areca-nut germplasm resources, the genetic relationship between the tested areca-nut materials is accurately identified, and the method has the advantages of high specificity, high accuracy and high accuracy. And a foundation is laid for genetic diversity analysis of betel nut germplasm resources and detection of seed fruit and seedling sources.

This invention belongs to the field of molecular marker-assisted selection technology for pig breeding and pigs, specifically involving molecular markers related to pork quality traits and their applications. This invention will be located in... PPP3CB 5' flanking promoter region of the gene InDel Polymorphic sites are associated with pork quality traits including water loss rate, water holding capacity, and intramuscular fat. InDel When the genotype at the polymorphic locus is TT, the pork has a lower water loss rate, a higher water holding capacity, and a higher intramuscular fat content. InDel InDel When the genotype of a polymorphic locus is deleted, the pork has a higher water loss rate, lower water holding capacity, and lower intramuscular fat content. This invention enables early prediction and selection of meat quality traits that can only be measured after slaughter, during the early stages of pig growth and development. It not only allows for live detection and screening of pork quality traits but also significantly shortens the generation interval, accelerates the breeding process, and provides technical support for early pig breeding.

The application discloses a PARMS molecular marker significantly related to the tryptophan content of corn root systems and application thereof, the nucleotide sequence of 150 bp upstream and downstream of the molecular marker is shown as SEQ ID NO. 6, and the primer group nucleotide sequence for detecting the PARMS molecular marker is shown as SEQ ID NO. 1-SEQ ID NO. 3. ZmASB1 The application successfully develops a molecular marker based on the natural variation of the 5'UTR region of the (Zm00001eb080510) gene, the marker is significantly related to the tryptophan content of corn root systems, can accurately, efficiently and stably distinguish the InDel + genotype and the InDel ‑ genotype. The molecular marker can be widely applied to the tryptophan content of corn root system germplasm resources and molecular marker assisted breeding, and provides important technical support and theoretical basis for cultivating new corn varieties with high yield, stable yield and drought resistance.

The invention discloses an InDel molecular marker related to soybean grain weight, fat content and isoflavone content and application, and relates to the technical field of molecular detection. The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID NO. 4. Whole genome association analysis finds that insertion / deletion variation of 16bp and 11bp exists in a specific region of a No.13 chromosome of soybean, and an InDel molecular marker related to soybean grain weight, fat content and isoflavone content is provided based on the insertion / deletion variation of 16bp and 11bp. By utilizing the InDel molecular marker, the genotype of a target site can be rapidly and accurately detected, and soybean materials with different genetic backgrounds can be distinguished, so that soybean varieties with excellent grain weight, fat and isoflavone content characters can be effectively screened in an auxiliary manner. According to the method, the breeding selection accuracy and efficiency are remarkably improved, and a powerful tool is provided for accelerating the soybean genetic improvement process.

The invention relates to application of a group of InDel markers for efficiently identifying distant hybridization filial generations of apples and pears. The invention discloses a group of InDel markers for efficiently identifying distant hybridization filial generations of apples and pears. Wherein the InDel-1, the InDel-2, the InDel-3 and the InDel-4 are respectively positioned on a chromosome 3, a chromosome 2, a chromosome 6 and a chromosome 14 of an apple reference genome. Through the combined use, 100%, 80.4%, 72.4% and 82.5% of hybrids can be respectively identified in hybrid populations of 'Jinguan' * 'Zhuangzhuang', 'Jinguan' * 'Jinzhuang', 'Fuji' * 'Zhuangzhuang' and 'Fuji' * 'Jinzhuang'. Therefore, the InDel molecular marker disclosed by the invention can provide a rapid and accurate identification method for distant filial generations of apples and pears, and also provides an important tool for creating new varieties of rosaceae fruit trees.

The invention provides a gene CsDOG1 for controlling preharvest germination traits of cucumber seeds as well as an InDel marker and application of the gene CsDOG1, an InDel site is located on a second exon of the CsDOG1 gene on a No.4 chromosome of a cucumber reference genome Chin ese Long v3Genome, insertion / deletion of 3bp exists, and the deleted 3bp nucleotide sequence is CAA. By applying the InDel marker disclosed by the invention, genotype information can be quickly and accurately identified in a high-throughput manner, and the pre-harvest germination-resistant breeding process of the cucumbers is accelerated.

The invention belongs to the field of gene engineering, and particularly relates to application of an LCORL gene Indel mutant capable of improving the growth speed and size of animals, the Indel site is located at the 37349373-37438248 position of a cattle No.6 chromosome, INDEL with the largest frequency difference is found in Chr6: 37349373-37438248 through local fine positioning, and therefore the INDEL site related to the growth traits of the animals in the area is determined, and the LCORL gene Indel mutant capable of improving the growth speed and size of the animals is obtained. Therefore, the invention provides the application of the INDEL site of the LCORL gene in improvement of animal growth traits.

The present invention provides an SNP locus related to the maize bract width regulatory gene RHW1 and its application, which relates to the technical field of plant molecular breeding. The SNP locus includes one or more loci among SNP1 to SNP8, and they form a haplotype marker. The haplotype marker is related to the genotype of the functional locus InDel-4337 related to the maize bract width gene RHW1 and can be used to predict or assist in predicting the maize bract width trait.

The present application relates to the technical field of bioinformatics, in particular to a method for detecting microbial structural variation, mutation and insertion deletion based on second-generation sequencing. The present application is based on the short read Illumina second-generation sequencing strategy, through testing, using the current mainstream biological tools and combining the self-developed program, the automatic analysis of microbial metagenome structural variation (SV), single nucleotide variation (SNV / mutation) and small fragment insertion deletion (Indel) is realized, and the problems of low sensitivity, high false positive rate and low efficiency in the prior art for detecting variation under the metagenome background are significantly solved.

The application discloses a long-read data robust variant detection method and system based on data quality improvement, and belongs to the technical field of gene sequencing and biological information analysis. The method of the application is aimed at the characteristics of long-read data, and first, preprocessing is completed through sequence filtering and base correction, and a three-dimensional outlier feature system of sequencing support intensity, mapping quality reliability and strand-specific bias is constructed. Based on the median absolute deviation algorithm, the features are standardized and outlier scores are generated, a double-threshold dynamic optimization mechanism is constructed, and high-confidence data is screened. The variant candidate regions are identified through multi-tool joint comparison, the SNP and Indel are typed through a deep learning model, and the reliability of the results is ensured through triple cross-validation. The method does not need to manually set a fixed threshold, effectively suppresses interference factors, balances detection accuracy, robustness and scene universality, and provides high-quality variant data support for clinical diagnosis and genomics research.

This invention discloses the agronomic traits, InDel-labeled fingerprint, and construction method of the *Dictyophora indicum* strain YZS021, belonging to the field of *Dictyophora indicum* detection technology. The fingerprint is obtained by PCR amplification and electrophoresis detection using 10 pairs of InDel-labeled primers developed based on the whole genome of *Dictyophora indicum*. The InDel marker fingerprint spectrum detection of the *Dictyophora indicum* strain YZS021 of this invention is fast, accurate, and reproducible, and can specifically identify the strain, enabling precise identification of the fungal species and protection of intellectual property rights. In addition, this invention also discloses the agronomic traits of the *Dictyophora indicum* strain YZS021. The *Dictyophora indicum* strain 'YZS021' has a long and thick stipe, a high edible ratio, and good commercial characteristics. It can stably produce fruiting under both forest and facility cultivation modes, adapting to different cultivation scenarios and significantly improving planting efficiency. The above agronomic traits have consistency and stability, and can stably cultivate and obtain asexual reproduction lines with the above traits in both forest and facility fruiting rooms.

The invention discloses an InDel molecular marker for identifying pink and red peach blossoms, a primer pair and application of the InDel molecular marker. An insertion / deletion marker associated with the peach petal pink / red character is found in the 1195107 bp region to the 1195114 bp region of the sixth chromosome of a peach genome, PCR amplification is performed on different peach germplasm resources by using specific primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, the petal color of a single plant with a stripe of about 159 bp is pink, the accuracy rate can reach 96.7%, and the detection result shows that the peach petal pink / red character associated with the peach petal pink / red character is obtained. The petals of a single plant without amplified bands are red, and the accuracy rate is 66.7%. When the InDel marker is used for rapidly identifying the petal color character of the peach hybrid offspring in the seedling stage, the breeding workload is reduced, and the InDel marker has the advantages of convenience, low cost and the like, and can be applied to production in a large scale.