94 results about "Indel" patented technology

A genomic data analyzer workflow may be configured to identify, with a variant annotation module, subsets of patient variants which match at least one medical reference variant database entry, even if the variant calling information in genomic data analyzer workflow and the database use different variant representations of SNP, MNP, INDELS and DELINS. In particular, database variants which are included into a subset of patient variants may be identified even if they do not exactly match the corresponding strings. The variant annotation module may be adapted to apply a branch-and-bound-like algorithm to efficiently process all possible subsets of patient variants in a genomic region.

The invention discloses a molecular marker InDel20 for identifying soybean oil content, a primer and application of the molecular marker InDel20. The molecular marker InDel20 is an insertion / deletion variation of 321 bp located at the 20th chromosome Chr20: 31728602-31728922 of the soybean, and the nucleotide sequence of the molecular marker InDel20 is as shown in SEQ ID No. 1; wherein the soybean material containing the insertion fragment is high-oil-content soybean, and the soybean material not containing the insertion fragment is low-oil-content soybean. The invention further provides a primer for detecting the molecular marker InDel20 and a method for identifying the content of soybean oil, and the identification accuracy rate is as high as 90.61%. The molecular marker InDel20 can be used for early-stage molecular marker-assisted selection of soybean high-oil characters, is suitable for germplasm resource screening, variety identification and molecular breeding of high-oil soybeans, and has important application value for accelerating polymerization of high-quality alleles and improving breeding efficiency.

The invention relates to the field of genes, in particular to molecular markers for judging flowering time of brassica napus L. The molecular markers are Indel-282, Indel-326 and Indel-353 respectively and are located on an A02 chromosome of the brassica napus L.. The molecular marker has high specificity and stability, and is significantly related to the flowering time. The markers show high specificity and stability in brassica napus plants under different genetic backgrounds. By detecting the molecular markers through PCR amplification and electrophoresis, the flowering time of different plants can be quickly and accurately identified in the early stage of breeding. Therefore, the flowering time of the plant can be determined in the early stage, so that the breeding efficiency is improved. The molecular markers can be used for molecular marker-assisted selective breeding, and plants with early flowering or late flowering characteristics can be quickly screened by detecting the markers, so that the breeding process of excellent varieties is accelerated, and the functions and regulation mechanisms of related genes are further disclosed.

The invention discloses a CHRM3 gene InDel molecular marker associated with growth and reproduction traits of a large white pig and application of the CHRM3 gene InDel molecular marker, a 62bp deletion variation is identified in a second intron of the CHRM3 gene, and a breakpoint is positioned in a second intron 521426525142713bp (a pig chromosome 14 reference sequence NC010456.5) of ENSSSCT00000082112.1. The application for detecting / identifying the growth and reproduction traits of the large white pigs is developed on the basis of the molecular marker, and the detection method is simple, rapid and low in cost and can be used for accurately screening individuals with better traits such as backfat thickness, primary birth litter weight, total multiparous litter size and gestation period of multiparous sows in the early stage, so that genetic improvement is carried out on the growth and reproduction traits of the pigs, and the economic benefit is increased. Multiple characters such as growth and reproduction can be selected at the same time, the breeding period of excellent boars can be shortened, and the breeding efficiency and progress are accelerated.

The application discloses a KASP molecular marker of a Nicotiana benthamiana NbSAG101a gene and application thereof. The KASP molecular marker is an InDel insertion and deletion marker of the Nicotiana benthamiana NbSAG101a gene, is located at 256-262 bp of a second exon of the Nicotiana benthamiana NbSAG101a gene, and the nucleic acid sequence of the KASP molecular marker is shown as SEQ ID NO: 4. A wild-type allele of the Nicotiana benthamiana NbSAG101a gene is C, contains a 7 bp sequence shown as SEQ ID NO: 4, and a mutant-type allele is A, and the 7 bp sequence shown as SEQ ID NO: 4 is deleted. The KASP marker provided by the application can accurately and quickly distinguish wild-type homozygotes, heterozygotes and mutant-type homozygotes of the NbSAG101a gene, has high specificity, high accuracy, fast detection speed, low cost and high flux.

The present invention relates to methods of detecting region(s) of interest in a gene comprising a polyA tail. The region(s) of interest can include gene(s), region(s), mutation(s), deletion(s), insertion(s), indel(s), and / or translocation(s). The region(s) can be greater than or less than 1 kilobases from the polyA tail. Methods can include forming a library of single cell transcripts comprising the region(s) in close proximity to a cell barcode and a unique molecular identifier (UMI). Methods for distinguishing cells by genotype can include amplifying the transcripts using PCR methods and detecting the cell barcode and UMI using single cell sequencing methods. Transcripts can be enriched using tagged region-specific PCR primers. Cell barcodes can be brought into close proximity to the region(s) by circularizing the transcripts. Sequencing of the transcripts can include using primer binding sites added during PCR amplification and library indexes for multiplexed sequencing.

The invention relates to the technical field of molecular biology, in particular to a betel nut InDel marker and application thereof in provenance detection. According to the invention, on the basis of the results of re-sequencing of one betel nut germplasm resource and comparative analysis of a reference genome sequence, InDel sites are excavated to develop molecular markers, 46 pairs of InDel molecular marker primer pairs with high polymorphism are obtained, the variation range of Shannon's diversity index is 0.361-1.713, and the variation range of polymorphism information content is 0.201-0.752. The clustering analysis result shows that the genetic similarity coefficient is 0.36, 211 parts of areca-nut materials are divided into four groups, the InDel marker pair provided by the invention can be effectively used for detecting and analyzing the genetic background of areca-nut germplasm resources, the genetic relationship between the tested areca-nut materials is accurately identified, and the method has the advantages of high specificity, high accuracy and high accuracy. And a foundation is laid for genetic diversity analysis of betel nut germplasm resources and detection of seed fruit and seedling sources.

This invention belongs to the field of molecular marker-assisted selection technology for pig breeding and pigs, specifically involving molecular markers related to pork quality traits and their applications. This invention will be located in... PPP3CB 5' flanking promoter region of the gene InDel Polymorphic sites are associated with pork quality traits including water loss rate, water holding capacity, and intramuscular fat. InDel When the genotype at the polymorphic locus is TT, the pork has a lower water loss rate, a higher water holding capacity, and a higher intramuscular fat content. InDel InDel When the genotype of a polymorphic locus is deleted, the pork has a higher water loss rate, lower water holding capacity, and lower intramuscular fat content. This invention enables early prediction and selection of meat quality traits that can only be measured after slaughter, during the early stages of pig growth and development. It not only allows for live detection and screening of pork quality traits but also significantly shortens the generation interval, accelerates the breeding process, and provides technical support for early pig breeding.

The application discloses a PARMS molecular marker significantly related to the tryptophan content of corn root systems and application thereof, the nucleotide sequence of 150 bp upstream and downstream of the molecular marker is shown as SEQ ID NO. 6, and the primer group nucleotide sequence for detecting the PARMS molecular marker is shown as SEQ ID NO. 1-SEQ ID NO. 3. ZmASB1 The application successfully develops a molecular marker based on the natural variation of the 5'UTR region of the (Zm00001eb080510) gene, the marker is significantly related to the tryptophan content of corn root systems, can accurately, efficiently and stably distinguish the InDel + genotype and the InDel ‑ genotype. The molecular marker can be widely applied to the tryptophan content of corn root system germplasm resources and molecular marker assisted breeding, and provides important technical support and theoretical basis for cultivating new corn varieties with high yield, stable yield and drought resistance.

The invention relates to application of a group of InDel markers for efficiently identifying distant hybridization filial generations of apples and pears. The invention discloses a group of InDel markers for efficiently identifying distant hybridization filial generations of apples and pears. Wherein the InDel-1, the InDel-2, the InDel-3 and the InDel-4 are respectively positioned on a chromosome 3, a chromosome 2, a chromosome 6 and a chromosome 14 of an apple reference genome. Through the combined use, 100%, 80.4%, 72.4% and 82.5% of hybrids can be respectively identified in hybrid populations of 'Jinguan' * 'Zhuangzhuang', 'Jinguan' * 'Jinzhuang', 'Fuji' * 'Zhuangzhuang' and 'Fuji' * 'Jinzhuang'. Therefore, the InDel molecular marker disclosed by the invention can provide a rapid and accurate identification method for distant filial generations of apples and pears, and also provides an important tool for creating new varieties of rosaceae fruit trees.

The application discloses a long-read data robust variant detection method and system based on data quality improvement, and belongs to the technical field of gene sequencing and biological information analysis. The method of the application is aimed at the characteristics of long-read data, and first, preprocessing is completed through sequence filtering and base correction, and a three-dimensional outlier feature system of sequencing support intensity, mapping quality reliability and strand-specific bias is constructed. Based on the median absolute deviation algorithm, the features are standardized and outlier scores are generated, a double-threshold dynamic optimization mechanism is constructed, and high-confidence data is screened. The variant candidate regions are identified through multi-tool joint comparison, the SNP and Indel are typed through a deep learning model, and the reliability of the results is ensured through triple cross-validation. The method does not need to manually set a fixed threshold, effectively suppresses interference factors, balances detection accuracy, robustness and scene universality, and provides high-quality variant data support for clinical diagnosis and genomics research.

This invention discloses the agronomic traits, InDel-labeled fingerprint, and construction method of the *Dictyophora indicum* strain YZS021, belonging to the field of *Dictyophora indicum* detection technology. The fingerprint is obtained by PCR amplification and electrophoresis detection using 10 pairs of InDel-labeled primers developed based on the whole genome of *Dictyophora indicum*. The InDel marker fingerprint spectrum detection of the *Dictyophora indicum* strain YZS021 of this invention is fast, accurate, and reproducible, and can specifically identify the strain, enabling precise identification of the fungal species and protection of intellectual property rights. In addition, this invention also discloses the agronomic traits of the *Dictyophora indicum* strain YZS021. The *Dictyophora indicum* strain 'YZS021' has a long and thick stipe, a high edible ratio, and good commercial characteristics. It can stably produce fruiting under both forest and facility cultivation modes, adapting to different cultivation scenarios and significantly improving planting efficiency. The above agronomic traits have consistency and stability, and can stably cultivate and obtain asexual reproduction lines with the above traits in both forest and facility fruiting rooms.

The invention discloses an InDel molecular marker for identifying pink and red peach blossoms, a primer pair and application of the InDel molecular marker. An insertion / deletion marker associated with the peach petal pink / red character is found in the 1195107 bp region to the 1195114 bp region of the sixth chromosome of a peach genome, PCR amplification is performed on different peach germplasm resources by using specific primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, the petal color of a single plant with a stripe of about 159 bp is pink, the accuracy rate can reach 96.7%, and the detection result shows that the peach petal pink / red character associated with the peach petal pink / red character is obtained. The petals of a single plant without amplified bands are red, and the accuracy rate is 66.7%. When the InDel marker is used for rapidly identifying the petal color character of the peach hybrid offspring in the seedling stage, the breeding workload is reduced, and the InDel marker has the advantages of convenience, low cost and the like, and can be applied to production in a large scale.

This invention relates to an identification method and kit for overlapping PCR with enzyme digestion. The method includes selecting a corresponding restriction endonuclease using N4N5X or N4N5Y as the last three bases of the introduced restriction site; if no corresponding restriction endonuclease is available, selecting a corresponding restriction endonuclease using N5X or N5Y as the last two bases of the introduced restriction site; amplifying to obtain a universal fragment primary PCR product; designing PCR amplification primers based on the restriction endonuclease and universal primers to obtain the primary PCR product of the template to be tested; and performing enzyme digestion and genotyping on the final product of the overlapping PCR amplification. This invention utilizes the DOPCR method to identify SNPs / InDels. Compared with existing methods that create restriction sites, it adds an overlapping PCR step, resulting in significant differences in the digested fragments. It eliminates the need for PAGE electrophoresis; detection can be completed using ordinary electrophoresis, making it low-cost and rapid.

The invention discloses an InDel molecular marker for detecting black spot resistance of broccoli, a method and application, and relates to the field of molecular biology. The site is located at 56724071bp-56724089bp of a broccoli chromosome 5, and the site has insertion / deletion variation of 18bp basic groups (the nucleotide sequence is as shown in SEQ ID NO. 1). When the site has a 18bp basic group (the sequence of an amplification product is shown as SEQ ID NO.2), the broccoli is a black spot resistant plant; otherwise, the plants are black spot sensitive plants. The invention also discloses a pair of specific primers for detecting the InDel molecular marker, and the nucleotide sequences of the specific primers are respectively shown as SEQ ID NO. 4 and SEQ ID NO. 5. The InDel molecular marker can rapidly and accurately detect the black spot resistance of broccoli germplasm resources at low cost, does not need field inoculation identification, can be used for early screening of broccoli black spot resistance varieties and molecular marker-assisted breeding, significantly improves the breeding efficiency, and shortens the breeding period.

The present disclosure provides bovine animals and methods to create recipient bovine animals for spermatogenic stem cell transplantation / complementation through modulation of the NANOS2 gene. In one embodiment genome editing was used to create bovine animals with insertions or deletions (indels) that inactivate or otherwise modulate NANOS2 gene activity so that resulting male bovines lack functional germ cells yet retain functional testicular somatic cells, and bovine females are fertile. These bovine males can then be transplanted or complemented with donor cells capable of giving rise to cells of the spermatogenic lineage, or spermatogenic stem cells and used for breeding.

The application discloses a base editor ACGBEmax realizing simultaneous replacement of purine and pyrimidine, relates to the technical field of gene editing, and comprises, from N end to C end, an HMCES protein, a bifunctional deaminase TadDual, an nCas9(D10A) protein and an engineered N-methyl purine DNA glycosylase eMPG. The base editor can realize simultaneous replacement of purine and pyrimidine, significantly increases the diversity of mutants after targeted editing, has the advantages of high editing efficiency and low Indels rate, and has great application value in aspects of in vitro and in vivo protein mutation screening and identification of oncogenic amino acid mutations.

The invention provides a construction method of a Chongqing walnut germplasm DNA fingerprint spectrum based on an InDel marker. According to the invention, an InDel marker is combined with a whole genome re-sequencing technology, effective polymorphic markers of walnuts are obtained through screening, and an optimal core marker is selected through Chongqing walnut resources to construct a DNA fingerprint spectrum. The research result provides an efficient technical means for accurate identification and genetic diversity analysis of Chongqing walnut germplasm resources, breaks the current bottlenecks of chaos of germplasm management and insufficient excavation of excellent resources, can directly support local high-quality high-resistance walnut variety breeding, and assists quality improvement, efficiency improvement and healthy sustainable development of the Chongqing walnut industry; meanwhile, a key theoretical basis and a practical reference are provided for construction of a national walnut germplasm resource molecular identification technology system and fingerprint spectrum standardization research, and the technical blank in the walnut InDel marker application field is filled.

The invention discloses a molecular marker linked with southern corn rust resistance and application of the molecular marker, and belongs to the technical field of molecular breeding. The invention provides a molecular marker closely linked with southern corn rust resistance, the molecular marker is an Indel marker, a susceptible corn strain does not contain a nucleotide sequence of the Indel, and a disease-resistant corn strain contains the nucleotide sequence of the Indel; the invention also provides a primer pair for detecting the molecular marker closely linked with the southern corn rust resistance, and the sequences of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2. The invention also provides a primer pair for detecting the molecular marker closely linked with the southern corn rust resistance. The method has the advantages of being convenient to use and good in stability and repeatability, and the southern rust resistance of corn plants can be rapidly and reliably identified; the method is simple to operate, the identification result is not interfered by environmental factors, the accuracy is better, the identification time can be effectively shortened, the identification cost is reduced, and the method has important significance for accelerating the breeding process and reducing the breeding workload and cost.

The invention provides a method of characterising a DNA sample obtained from a tumour, the method including the steps of: determining the presence or absence of a plurality of base substitution signatures, rearrangement signatures and indel signatures in the sample and copy number profiles for the sample; generating, from the presence or absence of said plurality of base substitution signatures, rearrangement signatures and indel signatures and the copy number profile for the sample, a probabilistic score; and based on said probabilistic score, identifying whether said sample has a high or low likelihood of being homologous recombination (HR)-deficient. Identification of a tumour as HR-deficient may be used to inform treatment choices, for example treatment with a PARP inhibitor or platinum therapy or an anthracycline.

The invention relates to application of an excellent haplotype of a corn drought-resistant gene DT1, and verifies that three linkage sites on a promoter of the corn DT1 gene are remarkably related to drought resistance and the expression level of the gene, and insertion of a 6.3 kb large fragment of an InDel (-401) site inhibits the activity of the promoter DT1, so that the transcriptional level of the promoter DT1 is reduced, and the drought resistance of the promoter DT1 is improved. Finally, the survival rate of the corn is reduced under the drought condition, DT1 which does not contain InDel (-401) site large fragment insertion is an excellent haplotype, and the corn inbred line containing the excellent haplotype has a certain drought resistance advantage. The identification of the excellent allelic variation of the DT1 gene provides important gene resources and theoretical guidance for the cultivation of new varieties of drought-resistant corn.

The application discloses a blueberry salt-tolerant related molecular marker and application. The application provides application of a substance for detecting whether a ProVcHKT1;1-InDel is contained in a VcHKT1;1 gene promoter in a blueberry genome in any one of the following: 1) detecting or assisting in detecting blueberry salt tolerance; 2) breeding salt-tolerant blueberries; the nucleotide sequence of the ProVcHKT1;1-InDel is ATTGATAA; and the coding region of the VcHKT1;1 gene is a DNA molecule as shown in SEQ ID NO:1. The application identifies a nucleotide fragment located in the promoter and linked to blueberry salt tolerance, and the insertion or deletion of the fragment can be used as a blueberry salt-tolerant molecular marker. The application also provides a primer pair and a kit for detecting the blueberry salt-tolerant molecular marker and a method for detecting whether a blueberry is salt-tolerant.

The invention discloses an Indel molecular marker related to the browning character of towel gourd pulp, a detection primer and application of the Indel molecular marker and the detection primer, and belongs to the field of molecular assisted genetic breeding. The Indel molecular marker is located at the 8045208 site of the No. 5 chromosome of a luffa cylindrica reference genome, the site has a 15bp insertion / deletion variation, and the genotype (homozygous insertion type / heterozygous vs. Homozygous deletion type) is highly consistent with the browning-resistant phenotype. A detection primer pair developed on the basis of the marker can accurately predict the browning characteristic of the fruit of the towel gourd through DNA detection in the early growth stage of the towel gourd, and transformation from phenotype selection to genotype selection is achieved. The invention provides a brand-new, accurate and reliable molecular tool for browning-resistant breeding of towel gourds.

The application provides a Lin5 gene molecular marker related to sugar content of tomato fruits and a detection method thereof, wherein the detection method of the sugar content of the tomato fruits comprises the following steps: S1, using total DNA of the tomato to be detected as a template, performing PCR amplification on a primer pair and performing electrophoresis identification; wherein the primer pair comprises a forward primer Indel-F, a nucleotide sequence of the forward primer Indel-F is shown in SEQ ID No. 1; and a reverse primer Indel-R, a nucleotide sequence of the reverse primer Indel-R is shown in SEQ ID No. 2; S2, when a band of 333 bp appears in the electrophoresis result, the tomato shows low sugar content of fruits, and when a band of 272 bp appears, the tomato shows high sugar content of fruits. The detection method provided by the application can quickly and efficiently identify the sugar content of the tomato fruits, and can be well applied to screening of the high and low sugar content of the tomato germplasm resources.

The application provides an INDEL molecular marker linked with peanut kernel weight QTL qHKWA05 and application thereof. The nucleotide sequence of the molecular marker is ATGCATAATATTCCTCCATCT / A, qHKWA05.INDEL molecular marker is located at 106411957 bp of chromosome 106 of peanut cultivar Arahy05, and genotype identification of the INDEL molecular marker is carried out through a PCR method. The molecular marker qHKWA05.INDEL obtained by the application can effectively identify the kernel weight of peanuts, and is used for genetic improvement of peanut kernel traits, so that the selection accuracy of kernel weight and size of hybrid offspring is effectively improved, breeding cost is reduced, breeding efficiency is improved, and the breeding process of breeding new peanut varieties with high yield and processing speciality is accelerated.

The invention relates to a method for screening InDel labeled primers by using transcriptome data and application of the method, and belongs to the technical field of genetics and molecular biology. The invention provides a method for screening an InDel labeled primer by using transcriptome data, which comprises the following steps: (1) acquiring the transcriptome data of a target variety, and carrying out parameter-free assembly to generate a transcript sequence; (2) comparing transcriptome data, detecting InDel variation, and screening out an InDel site; (3) screening transcript fragments according to the InDel site; and (4) designing primers according to transcript fragments, and screening specific primers to obtain InDel labeled primers. The screening method is suitable for genetic analysis and diversity research of the reference-free genome species, is low in cost, wide in applicability and simple and convenient to operate, and provides a basis for molecular marker development of the reference-free genome species.

The invention discloses an InDel molecular marker related to fragrance of non-heading Chinese cabbage and application of the InDel molecular marker. The molecular marker is located in Chr7: 28389774-28389951 of a whole genome of the non-heading Chinese cabbage, and the molecular marker has insertion / deletion of a 6bp fragment which is related to whether leaves have aroma or not. The primer is designed based on an insertion / deletion fragment of a sequence and is used for identifying the fragrance of the non-heading Chinese cabbage. The technology can be used for rapidly detecting a plurality of samples, is simple to operate and high in accuracy, shortens the breeding period, remarkably improves the breeding selection efficiency, and provides technical support for genetic improvement of aroma character regulation and control of the non-heading Chinese cabbages.

The invention discloses a 44 InDel genetic marker system for highly degraded sample typing, a detection primer and application of the 44 InDel genetic marker system and the detection primer, and belongs to the technical field of medical identification. Through bioinformatics screening and experimental verification, an insertion and deletion (InDel) genetic marker system which is composed of 44 autosomal InDel and a sex identification gene AMEL site and has amplicon length not exceeding 125 bp is constructed, and the genetic marker system is suitable for capillary electrophoresis typing and is specially designed for highly degradable detection materials. The system is simple and convenient to operate, economical and efficient, can remarkably improve the complete typing success rate of the degraded sample, and is convenient to popularize and apply in forensic medicine laboratories. The invention provides a novel technical scheme which is efficient and compatible with a capillary electrophoresis platform for forensic practice.

The invention relates to the technical field of agriculture, in particular to a rice Sdd7-CGBE base editor and application thereof. A gene sequence of the rice Sdd7-CGBE base editor provided by the invention at least comprises (1) a nucleotide sequence as shown in SEQ ID NO.1; or (2) a nucleotide sequence which replaces one or more nucleotide sequences in the nucleotide sequence as shown in SEQ ID NO.1 and can be used for rice genome shearing; or (3) a nucleotide sequence which is obtained by adding one or more nucleotide sequences into the nucleotide sequence as shown in SEQ ID NO.1 and can be used for rice genome shearing; or (4) a nucleotide sequence which is obtained by deleting one or more nucleotide sequences in the nucleotide sequence as shown in SEQ ID NO.1 and can be used for rice genome shearing. According to the editor, through the efficient deamination activity of Sdd7 and the uracil excision function of coUNG, a specific site is targeted under the guidance of nSpCas9, and the Indeels and bystander effects can be reduced while C-G transversion is induced.

Provided herein are gene editing systems and compositions relating to enabling in vivo editing in the LPA gene. Disclosed herein are treatment or prevention of cardiovascular diseases by disruption of apo (a) production and reduction of blood lipoprotein (a) [Lp (a)] concentration via genetic editing. A nickase-based gene editing system is disclosed that aims to enable insertion and / or deletion (insertion deletion variants) and / or installation of non-synonymous variants in the coding sequence of the LPA. Nicking enzyme-based gene editing systems generally comprise one or more mRNAs encoding one or more nicking enzymes and a plurality of guide oligonucleotides (e.g., gRNAs), and may be delivered in vivo to a mammalian subject in need thereof via a suitable delivery system, such as lipid nanoparticles (LNPs) with or without a GalNAc targeting moiety, such as a GalNAc targeting moiety. The delivery system is administered intravenously or otherwise as a potential disposable therapy to a patient. Preparation, use and formulation of the gene editing system and composition are also disclosed.