Composition for modifying nucleotide sequence, method and application
A nucleotide sequence and composition technology, which is applied in the field of nucleotide sequence modified compositions, can solve problems such as cumbersome methods, limited application scope of single-base gene editing systems, inability to target CBE, etc., and achieves a wide working window , deletions, and low off-target effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] vector construction
[0046] (1) Construction of the first carrier
[0047] The first set of expression elements on the first vector such as figure 1 as shown ( figure 1 In PW-CBE-AID), it includes: cytosine deaminase (AID) expression element, wild-type adenine deaminase (TadA) expression element, mutant adenine deaminase (TadAE59A, which compared with TadA, its 59th amino acid residue is mutated from E to A) expression element and mutant Cas enzyme (SpCas9n) expression element; each expression element is connected by Linker.
[0048] Wherein, the amino acid sequence of AID is shown in 1-182 of SEQ ID NO.6, the amino acid sequence of Linker1 is shown in 183-198 of SEQ ID NO.6, and the amino acid sequence of TadA is shown in SEQ ID NO.6 The amino acid sequence of Linker2 is shown in the 365-396 of SEQ ID NO.6, the amino acid sequence of TadAE59A is shown in the 397-562 of SEQ ID NO.6, and the amino acid sequence of Linker3 The sequence is shown in No. 563-594 of SEQ ...
Embodiment 2
[0056] Verifying the working window of the genetic modification of the composition of Example 1
[0057] (1) Download the human gene PD-1 and KCNS1 from NCBI, where PD-1 has designed 4 targets, and KCNS1 has designed 1 target (such as Table-1, the underline in the table is PAM), similar to CRISPR / Cas9 target oligo design strategy, sgRNA uses U6 as the promoter, needs G as the transcription start site, adds CACC to the 5' end of the forward oligo for each target, and the reverse oligo is the complementary strand of the target, and Add AAAC to the 5' end (see Table 2).
[0058] The target nucleotide sequence on the gene PD-1 of table 1 people
[0059]
[0060]
[0061] Table 2 Sequences of forward and reverse oligos for different targets
[0062] target name
sequence(5`-3`)
PD-1-sg6-up
CACCGTCCAGGCATGCAGATCCCAC
PD-1-sg6-dn
AAACGTGGGATCTGCATGCCTGGAC
PD-1-sg7-up
CACCGTGCAGATCCCACAGGCGCCC
PD-1-sg7-dn
AAACGGGCGCCTGTGG...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com