Composition for modifying nucleotide sequence, method and application

A nucleotide sequence and composition technology, which is applied in the field of nucleotide sequence modified compositions, can solve problems such as cumbersome methods, limited application scope of single-base gene editing systems, inability to target CBE, etc., and achieves a wide working window , deletions, and low off-target effects

Active Publication Date: 2019-03-26
EAST CHINA NORMAL UNIV +1
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for bases other than 3-8 within 20bp of the target, it cannot be targeted by spCas9-mediated CBE
The recently reported BE-Plus recruits multiple cytosine deaminases fused with Scfv through 10×GCN4, and can also target cytosine at positions 4-16, and its efficient working window is C at positions 7-13, realizing It realizes the translation of its efficient working window, but its method is relatively cumbersome
This greatly limits the scope of application of the single-base gene editing system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition for modifying nucleotide sequence, method and application
  • Composition for modifying nucleotide sequence, method and application
  • Composition for modifying nucleotide sequence, method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] vector construction

[0046] (1) Construction of the first carrier

[0047] The first set of expression elements on the first vector such as figure 1 as shown ( figure 1 In PW-CBE-AID), it includes: cytosine deaminase (AID) expression element, wild-type adenine deaminase (TadA) expression element, mutant adenine deaminase (TadAE59A, which compared with TadA, its 59th amino acid residue is mutated from E to A) expression element and mutant Cas enzyme (SpCas9n) expression element; each expression element is connected by Linker.

[0048] Wherein, the amino acid sequence of AID is shown in 1-182 of SEQ ID NO.6, the amino acid sequence of Linker1 is shown in 183-198 of SEQ ID NO.6, and the amino acid sequence of TadA is shown in SEQ ID NO.6 The amino acid sequence of Linker2 is shown in the 365-396 of SEQ ID NO.6, the amino acid sequence of TadAE59A is shown in the 397-562 of SEQ ID NO.6, and the amino acid sequence of Linker3 The sequence is shown in No. 563-594 of SEQ ...

Embodiment 2

[0056] Verifying the working window of the genetic modification of the composition of Example 1

[0057] (1) Download the human gene PD-1 and KCNS1 from NCBI, where PD-1 has designed 4 targets, and KCNS1 has designed 1 target (such as Table-1, the underline in the table is PAM), similar to CRISPR / Cas9 target oligo design strategy, sgRNA uses U6 as the promoter, needs G as the transcription start site, adds CACC to the 5' end of the forward oligo for each target, and the reverse oligo is the complementary strand of the target, and Add AAAC to the 5' end (see Table 2).

[0058] The target nucleotide sequence on the gene PD-1 of table 1 people

[0059]

[0060]

[0061] Table 2 Sequences of forward and reverse oligos for different targets

[0062] target name

sequence(5`-3`)

PD-1-sg6-up

CACCGTCCAGGCATGCAGATCCCAC

PD-1-sg6-dn

AAACGTGGGATCTGCATGCCTGGAC

PD-1-sg7-up

CACCGTGCAGATCCCACAGGCGCCC

PD-1-sg7-dn

AAACGGGCGCCTGTGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a composition for modifying a nucleotide sequence, a method and application, and relates to the technical field of gene editing. The composition comprises a first vector and asecond vector, wherein the first vector is provided with the following expression elements, such as a cytosine deaminase expression element, an adenine deaminase expression element and a mutant Cas enzyme expression element; the second vector is provided with the following expression elements, such as a gRNA (guide ribonucleic acid) expression element and a uracil glycosidase inhibitor expressionelement. The composition is used for modifying the C bases at the 1st to 16th sites at the upstream of PAM (protospacer adjacent motif) of the target nucleotide sequence, so that the transformation ofC / G to T / A is realized. Compared with the existing gene editing technique, the composition and the method have the advantages that the working window is broader; the DSB (double-strand break) and indels (insertion / deletion mutations) are not introduced, the off-target effect is very low, the safety is higher, and the like.

Description

technical field [0001] The present invention relates to the technical field of gene editing, in particular to a composition, method and application for nucleotide sequence modification. Background technique [0002] Since 2013, the new generation of gene editing technology represented by CRISPR / Cas9 has entered various experiments in the field of biology and is changing the traditional means of gene manipulation. [0003] In April 2016, the laboratory of David R Liu reported for the first time the single-base gene editing technology (cytosine base editor, CBE) based on the fusion of rat cytosine deaminase (Apobec1) CRISPR / Cas9 (including BE1, BE2, BE3) Genome-directed editing of a single base C / G to T / A transition on the genome. Among them, BE3 is widely used for gene mutation or repair of the genome, production of disease animal models, gene therapy, and gene function screening due to its high efficiency. The classic CBE system (referring to BE3) is modified based on spCa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/10
CPCC12N15/102C12N15/85
Inventor李大力张晓辉陈亮刘明耀
OwnerEAST CHINA NORMAL UNIV