102 results about "Structural variation" patented technology

The invention discloses a somatic cell structure variation detection method based on a monomolecular long-read length sequence chart hybrid model, which comprises the following steps of: extracting a read length local sequence of a target structure variation interval and a flank region thereof, constructing a local chart genome by utilizing a partial sequence alignment chart algorithm, and encoding a multi-sequence alignment result. And then, a multi-category hybrid model is combined with an expectation maximization algorithm, and clustering analysis is performed on the comparison data, so that the somatic cell structure variation category only from the tumor sample is identified. And finally, generating a consensus sequence of a somatic cell structure variation region in the tumor sample, and taking the consensus sequence as an optimization result of a local genome. Compared with an existing short-read-length sequencing method, the method has the advantages that the problems of comparison errors, low-complexity sequences and genome heterogeneity can be effectively solved, and the detection precision of somatic cell structure variation is remarkably improved. Through the application of a single-molecule long-read-length sequencing technology, more comprehensive and accurate genome information can be provided.

The invention belongs to the technical field of livestock and poultry genetic markers and animal genetic breeding, and particularly relates to a structural variation molecular marker related to chicken secondary average feed intake and application of the structural variation molecular marker. The nucleotide sequence of the structural variation molecular marker provided by the invention is as shown in SEQ ID NO: 1, the structural variation molecular marker is located at 14th, 881, 990-14th, 882 and 295bp of a chicken chromosome 12, and the structural variation molecular marker is a deletion marker. The key genetic marker related to the chicken feeding behavior is provided, important information is provided for genetic breeding of the broiler chicken, meanwhile, broiler chicken varieties with different feeding behavior habits can be bred according to different markets and feeding environments, refined feeding management measures are formulated, and therefore the production efficiency and the feed utilization rate are improved, and the economic benefit is increased. And the economic benefit of the broiler industry is improved.

The invention discloses a schizophrenia risk structure variation identification and function evaluation method based on three-generation sequencing, and relates to the field of molecular biology, whole genome sequencing is performed on peripheral blood DNA of a patient through three-generation sequencing, multi-tool joint detection is adopted, multi-sample results are integrated, and a high-confidence SV data set is generated; through cross-queue comparison, the patient specific SV is screened, and the high-risk potential pathogenic SV is identified in combination with an SV priority ordering tool SVJudge. By combining transcription factor binding analysis, SCZ drug target data and histocyte specific expression data, the influence of SV on gene regulation is evaluated, and the potential action mechanism of SV in SCZ is analyzed. The SCZ risk gene is screened based on SVJudge scoring and patient carrying conditions, the genetic risk and pathogenic mechanism of the SCZ are analyzed and verified through pathway enrichment, a protein interaction network and a functional module, and a new technical means and theoretical basis are provided for genetic research of the SCZ.

The invention relates to the technical field of bioinformatics, and discloses a method, a system, equipment and a medium for searching for base mutation aiming at third-generation full-length transcript sequencing data, the base mutation is accurately positioned to a specific transcript by directly processing the third-generation full-length transcript sequencing data, and the method and the system for searching for the base mutation aiming at the third-generation full-length transcript sequencing data are provided. The co-occurrence relation of a plurality of mutations on the same transcript is accurately analyzed, and the defects of calculation redundancy, function misjudgment and the like caused by the fact that a mutation transcript source cannot be determined due to fragmentation splicing and the co-occurrence is simulated by depending on permutation and combination in a second-generation short-read-long sequencing technology are effectively overcome; the recall rate of transcripts which are not mapped due to a high-variation region is improved through mapping correction assisted by structural variation, and false positive is effectively inhibited through a multi-dimensional filtering condition, so that the sensitivity and reliability of mutation detection are remarkably improved; particularly, mutation events with function remodeling due to reading frame change can be accurately recognized in scenes such as neoantigen prediction where mutation function consequences need to be accurately evaluated, and the method has important value in application in the fields of precision medical treatment and the like.

The invention discloses a muskmelon CmACS11 gene promoter structure variation SV352 and application thereof in regulation and control of female development of muskmelons, and relates to the technical field of biology. It is found for the first time that insertion of 352bp exists on the CmACS11 promoter, the CmACS11 promoter is named as SV352, the nucleotide sequence of the CmACS11 promoter is shown as SEQ ID No: 3, and the CmACS11 promoter is closely linked with female complete development characters of muskmelons and has dominant inheritance. Furthermore, through in-situ hybridization and transgenosis verification, the SV352 causes the loss of selective expression characteristics of the CmACS11, so that the CmACS11 is expressed in all flower buds, and the expression is advanced, which is a key variation for controlling complete development of female organs of muskmelons. The SV352 variation provides a new variation resource for creating a muskmelon female line breeding material.

The invention discloses a structure variation detection algorithm, system and equipment based on three-generation sequencing data and a generic genome and a medium, and the detection algorithm comprises the following steps: detecting a snarl structure in a generic genome graph, and extracting reads corresponding to each snarl path from a gam comparison file; calculating the average coverage degree of all edges in each snarl path and the number of the edges with the coverage degree being 0; counting a path and a path direction which are possibly contained in each snarl, and reading information and path coverage information which are compared to the path; screening an optimal path and a second path according to the reads information and the path coverage information; and comparing the optimized optimal path and the second path with the reference path to obtain variation information. According to the method, the reads information corresponding to the path, the base coverage information of the path and the coverage information of the edge of the path are fused to serve as a basis for potential variation path selection, and the accuracy of third-generation sequencing data detection is improved.

The invention discloses an application of PtoERD3 gene structure variation in evaluation of poplar lignin content, the structure variation is located in an upstream promoter region of a poplar PtoERD3 gene, is a 54bp chromosome structure variation SV fragment, and has a nucleotide sequence as shown in SEQ ID NO.1. The invention also discloses an application of the PtoERD3 gene structure variation in evaluation of poplar lignin content. By measuring the structural variation, the lignin content of the poplar can be accurately judged, superior plants with high-quality wood quality characters can be accurately and efficiently screened in the early growth stage of the poplar, the breeding period is effectively shortened, and a theoretical support is provided for molecular design breeding of the poplar wood quality.

Compositions and methods for detecting structural variations (SVs) in target genes or for genetic mapping of movable transposable elements are disclosed, the target genes relating to disease pathologies commonly found in large Mendelian genomics projects, and the movable transposable elements relating to genetic diseases, cancer, and aging. The method comprises: (i) contacting a sample containing genomic DNA with a DNA endonuclease for an effective amount of time to cleave the genomic DNA into fragments, the genomic DNA being uncrosslinked; (ii) subjecting the fragments obtained from step (b) to a DNA ligase to obtain circularized DNA; (iii) subjecting the circularized DNA to reverse PCR amplification containing a reverse primer, wherein the reverse primer is designed to match a expected wild-type sequence near a suspected mutant locus in the gene; and (iv) sequencing the amplified products. Exemplary conditions include Bardet-Biedel syndrome; severe upper and lower limb defects; retinitis pigmentosa; syndromic microcephaly; spastic paraplegia; and atypical hemolytic uremic syndrome.

This invention relates to a method for structural variant (SV) identification and genotyping in long-read family pedigree samples. The invention pertains to the field of vegetative variant (SV) detection in families, specifically focusing on methods for identifying and genotyping structural variants. The aim of this invention is to address the problems of existing family-based SV detection methods, which heavily rely on high-coverage sequencing, resulting in insufficient utilization of genetic characteristics and inaccurate SV detection and genotyping, as well as the high cost of sequencing multiple samples. This invention uses individual sequencing data from all family members as input, extracts variant features from each member, performs cluster analysis on the family feature set, assigns features to their respective members, and then uses three family feature signal correction methods to correct detection errors. Finally, SVs are located and anchored using Mendelian inheritance laws, and haplotype genotyping of SVs is completed using linkage information from long-read sequencing fragments.

The invention discloses a detection system and method for identifying mycobacteria and drug resistance genes of the mycobacteria based on nanopore sequencing, and relates to the field of biological medicine, the detection system comprises a specific targeted enrichment module, a nanopore sequencing module and a biological information analysis module; the specific targeted enrichment module comprises a probe combination, and the probe combination covers a mycobacterium tuberculosis complex conservative identification gene, species-specific genes of common nontuberculous mycobacteria and mycobacterium leprosy, and full-length or partial sequences of drug resistance related genes in a targeted manner; by utilizing the characteristics of nanopore length reading length and real-time sequencing and a tuberculosis specific targeted enrichment strategy, accurate identification of a mycobacterium tuberculosis complex group, synchronous typing of 42 mycobacteria, analysis of 24 drug-resistant genes, and efficient detection of structural variation and low-abundance heterogeneity drug-resistant mutation are realized, the detection period is shortened, the detection cost is reduced, and the detection efficiency is improved. And a comprehensive and reliable technical basis is provided for accurate diagnosis and treatment of mycobacterium infection.

The invention discloses a structural variation molecular marker influencing pig abdomen subcutaneous fat weight on a pig chromosome 5 and application of the structural variation molecular marker. The structural variation molecular marker is a DNA fragment inserted behind a 66120412bp site on a chromosome 5 of an international pig reference genome version 11.1; the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO: 1. The structural variation molecular marker provided by the invention is remarkably related to the pig abdominal subcutaneous fat weight character, the pig abdominal subcutaneous fat weight character can be identified by identifying the structural variation molecular marker, and the pig abdominal subcutaneous fat weight character can be identified by selecting individuals carrying the structural variation molecular marker in the breeding process. The weight of abdominal subcutaneous fat of offspring pigs can be reduced, and the lean meat percentage of the offspring pigs is improved.

This application belongs to the field of molecular biological breeding and provides molecular markers for chicken weight-related structural variations and their applications. The molecular markers for chicken weight-related structural variations are: SV1 located at position 29007968 on chromosome 3, based on the chicken reference genome GRCg7b, with a reference allele of SEQ ID NO.1 and a substitute allele of A; or SV2 located at position 65895344 on chromosome 1, with a reference allele of G and a substitute allele of SEQ ID NO.2; SV3 located at position 1199450 on chromosome 12, with a reference allele of C and a substitute allele of SEQ ID NO.3; or SV4 located at position 37121335 on chromosome Z, with a reference allele of C and a substitute allele of SEQ ID NO.4. Experiments and verification have demonstrated that the above markers are significantly correlated with chicken weight, providing new molecular marker resources for the genetic improvement of broiler weight traits.

The invention discloses a corn drought-resistant gene ZmRVE6 as well as a drought-resistant molecular marker and application. The nucleotide sequence of the drought-resistant gene ZmRVE6 is shown as SEQ ID NO: 1. The nucleotide sequence of the corn drought-resistant molecular marker ZmRVE6Type 3 is as shown in SEQ ID NO: 4. According to the invention, a drought-resistant related gene ZmRVE6 is identified. The gene participates in regulation of expression of biological clock related genes and participates in regulation of plant growth and development. Overexpression of the ZmRVE6 can improve the drought resistance of the corn. The structural variation of the promoter region can be used as a corn drought-resistant molecular marker, and amplification of the molecular marker is used for identifying corn varieties with excellent drought resistance. The practical value and the economic value are realized.

The invention relates to the technical field of molecular markers, and particularly discloses a yak growth trait related structural variation molecular marker and application thereof. The structural variation molecular marker disclosed by the invention is a structural variation located at the 20789206 to the 20789260 site on an 18 # chromosome MAPK15 gene of a yak genome. A yak individual to be detected is detected through PCR amplification and agarose gel electrophoresis, and it is found that the genotype of the SV variation site on the yak MAPK15 gene can be divided into a homozygous insertion type, a heterozygous type and a homozygous deletion type; association analysis results show that different genotypes of the MAPK15 gene are significantly different from yak birth canal girth and 6-month-old body oblique length respectively. According to the present invention, the genotype of the detected SV variation site of the yak MAPK15 gene is adopted to perform association analysis on the target character, such that the early stage selection accuracy is improved, the breeding cost is reduced, and the breeding process of the yak with excellent growth performance is easily promoted.

The invention provides methods for identifying rare variants near a structural variation in a genetic sequence, for example, in a nucleic acid sample taken from a subject. The invention additionally includes methods for aligning reads (e.g., nucleic acid reads) to a reference sequence construct accounting for the structural variation, methods for building a reference sequence construct accounting for the structural variation or the structural variation and the rare variant, and systems that use the alignment methods to identify rare variants. The method is scalable, and can be used to align millions of reads to a construct thousands of bases long, or longer.

The invention discloses a resequencing-based space mutagenesis peanut population genotype variation map and a construction method thereof, and belongs to the technical field of plant biotechnology and plant molecular breeding, and the technical key points are as follows: a space mutagenesis peanut mutant plant is utilized, based on a whole genome resequencing technology, genetic variation sites in a genome are systematically detected, and the genotype variation map of the space mutagenesis peanut population is obtained. A variation map of a space mutagenesis peanut population genome is constructed, the map comprises no less than 500,000 mononucleotide variations (SNP), 100,000-200,000 insertion and deletion (InDel), about 3000 copy number variations (CNV) and about more than 3000 structural variations (SV), and 66 genes related to peanut grease anabolism are screened out. The construction method comprises the following steps: obtaining a mutant plant, extracting DNA, sequencing, detecting and identifying SNP, InDel, CNV and SV variation sites, and the like.

Numerous molecular data points, consisting of numerical values ​​representing label locations, are aligned to a reference genome to detect structural variations. [Solution] When the size of the label interval of a reference nucleic acid sequence or the label interval of a target nucleic acid sequence is less than or equal to a lower limit, the information processing device according to the present invention uses a correction function composed of a polynomial that takes the interval as an argument to correct the interval so that it becomes a value greater than the lower limit.

The invention discloses application of a ZmAAAP64 gene in regulation and control of protein accumulation and nitrogen utilization of a whole corn plant, and belongs to the technical field of biology. The nucleotide sequence of the ZmAAAP64 gene is as shown in SEQ ID NO. 11. A BC2S3 population is constructed based on wild corn Ames21814 and a common corn inbred line B73 for QTL positioning, a key gene ZmAAAP64 for regulating and controlling the protein content and nitrogen utilization efficiency of the whole corn plant is excavated, structural variation analysis finds that in different corn population materials, insertion and deletion variations exist in a plurality of conservative intervals of a ZmAAAP64 gene promoter region, and the ZmAAAP64 gene promoter region has a high expression in the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content. The accumulation amount of Gln and Asn in the stem of the ZmAAAP64 gene overexpression material is increased by about 30-60%, and the protein content of the stem, the protein content of the leaf and the nitrogen accumulation amount of the whole plant are remarkably increased. And a technical means is provided for cultivating corn with high protein and high nitrogen utilization efficiency.

A system for providing structural variation or phasing information is provided. The system accesses a nucleic acid sequence dataset corresponding to a target nucleic acid in a sample. The dataset comprises a header, synopsis, and data section. The data section comprises a plurality of sequencing reads. Each sequencing read comprises a first portion corresponding to a subset of the target nucleic acid and a second portion that encodes an identifier for the sequencing read from a plurality of identifiers. One or more programs in the memory of the system use a microprocessor of the system to provide a haplotype visualization tool that receives a request for structural variation or phasing information from the dataset. The request is evaluated against the synopsis thereby identifying portions of the data section. Structural variation or phasing information is formatted for display in the haplotype visualization tool using the identified portions of the data section.

The invention discloses a fluorescence in-situ hybridization probe group for rapidly distinguishing hexaploid oat chromosomes and application thereof, and belongs to the technical field of molecular biology. The fluorescent in-situ hybridization probe group provided by the invention comprises a probe oligo-356 and a probe oligo-898, wherein the nucleotide sequence of the probe oligo-356 is as shown in SEQ ID NO. 1; the nucleotide sequence of the probe oligo-356 is as shown in SEQ ID NO. 2; the provided fluorescence in-situ hybridization probe group can quickly and accurately identify different chromosomes of hexaploid oat through a fluorescence in-situ hybridization method, and has important scientific and practical values for hexaploid oat chromosome structure variation identification, oat genetic relationship identification, oat genetic map construction and oat variety improvement.

The invention provides a genetic structure variation at the upstream of a GHR gene and application of the genetic structure variation. Specifically, the invention provides a structural variation molecular marker related to duck growth and development, the structural variation molecular marker is located at the upstream 80kb of a GHR gene on a chromosome ChrZ, and the nucleotide sequence of the structural variation molecular marker is as shown in SEQ ID NO: 1. The structural variation molecular marker can regulate and control the expression of the GHR gene so as to regulate and control the growth and development of ducks, provides a theoretical basis and a genetic basis for breeding or cultivating duck varieties with excellent growth traits, and is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

The application provides a microsatellite site stability detection method and an electronic device thereof. The microsatellite site stability detection method comprises the following steps: S1, obtaining characteristic data in a preset microsatellite site set by using high-throughput targeted sequencing data of a to-be-detected sample, wherein the characteristic data at least comprises the following: length variation of a short tandem repeat sequence and structural variation occurring at the microsatellite site; S2, establishing a prediction model by using the characteristic data; and S3, outputting a microsatellite stability result of the to-be-detected sample by using the prediction model. The method can solve the limitation problem of the microsatellite instability detection method in the prior art and is suitable for the tumor detection field.

The application belongs to the technical field of bioinformatics, and relates to a method and system for detecting structural variation in transcript data of three-generation whole-exome sequencing, comprising: establishing a transcript set to be searched for structural variation; mapping and annotating transcript information according to TAGET software, cyclically reading the transcript set, and obtaining first structural variation of all transcripts; mapping transcript information according to Hisat2 software, cyclically reading the transcript set, and obtaining second structural variation of all transcripts; filtering and screening the first structural variation and the second structural variation respectively, and generating screened transcripts of the first structural variation and the second structural variation; and comprehensively screening the screened transcripts of the first structural variation and the second structural variation, and obtaining the final structural variation of the transcripts. The application improves the positive rate of structural variation and greatly reduces false positives by cross comparison of results of two kinds of software and strict control of the difference value of exon breakpoints between the transcript and the reference transcript.

This invention relates to the fields of plant genetic engineering and molecular biology, and discloses a molecular detection method for identifying plum species as true plum, apricot, or apricot-plum hybrids. This invention also provides plum blossom... PmBBX24 The first intron of the gene relative to apricot PaBBX24 Structural variations in the first intron of a gene, specifically manifested as plum blossom patterns. PmBBX24 The gene has a 1554bp insertion in its first intron, which is heterozygous in apricot-plum. This site provides a basis and molecular tool for the identification of true plum / apricot-plum / apricot. PmBBX24 Gene expression is involved in the response of plum blossoms to seasonal climate change. There are significant differences in the expression patterns of seasonal climate change in winter between the true plum and apricot plum varieties. This can be used to identify the true plum / apricot plum varieties, enabling rapid and accurate identification of plum blossom varieties during the seedling stage, shortening the breeding cycle and greatly reducing the workload of breeding.

The present application relates to a method, device and equipment for filtering structural variations based on multimodal fusion. The method comprises: encoding the variable information of the structural variation site and generating a characteristic image of the structural variation site. After calculating the ESF value of the variable information, a label is set for the image-text pair consisting of the characteristic image of the structural variation site and the ESF value according to the structural variation type to obtain a labeled image-text pair. The CLIP multimodal model is trained according to preset configuration parameters to obtain a trained multimodal fusion model. The pre-processed structural variation data and the labeled image-text pairs are filtered for variation sites by the trained multimodal fusion model to obtain filtered result data. The use of this method can improve the accuracy of structural variation detection in gene sequences.

The invention belongs to the technical field of plant breeding, and discloses an SV molecular marker combination for identifying Hongmeiren hybrid citrus, which is characterized by comprising the following two structural variation sites: (1) Chr1: 29803181 site, the sequence of which is as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and (2) a Chr2: 1013046 site, wherein the sequence of the Chr2: 1013046 site is as shown in SEQ ID NO: 3 and SEQ ID NO: 4. The invention further discloses a primer pair for detecting the SV molecular marker combination, a kit comprising the primer pair and application of the kit. The invention provides the SV molecular marker combination for identifying the variety of the citrus reticulata Blanco, the authenticity of the citrus reticulata Blanco can be rapidly identified in the seedling stage, the market counterfeit behavior is restrained, molecular evidence is provided for intellectual property protection, and the application of the molecular marker can assist in filial generation screening and shorten the breeding period.

The invention provides a genetic structure variation at the upstream of an FER gene and application thereof. Specifically, the invention provides a structural variation molecular marker, the structural variation molecular marker is located at the upstream 30kb of an FER gene on a chromosome ChrZ, and the nucleotide sequence of the structural variation molecular marker is as shown in SEQ ID NO: 1. The structural variation molecular marker mainly exists in domesticated ducks, can reduce expression of FER genes in livers, and can be used as a marker for distinguishing the domesticated ducks and wild ducks, so that the molecular marker provides a theoretical basis and a genetic basis for breeding or cultivating duck varieties with excellent economic characters, and is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

The invention relates to the technical field of animal breeding, in particular to a structural variation molecular marker related to chicken feed conversion rate characters and application thereof. The molecular marker is located at the 3891127 site of the 23rd chromosome of the chicken, and the polymorphism of the molecular marker is G or GCTGTGGTTCCTCTGCCCCAGCGTGGCACATGGAGCTGTGTCCACAGGTGATCTTCCC. The molecular marker can be used for identifying the chicken disease, the chicken disease, the chicken disease and the chicken disease. A structural variation molecular marker chr233891127SV related to the chicken feed conversion rate is obtained through research and screening, and the feed conversion rate of a corresponding individual chicken can be reflected by detecting the genotype of the molecular marker. The molecular marker provided by the invention can be used for breeding chicken varieties with high feed conversion rate, and has important application value.

The present invention relates to the field of crop breeding, and in particular to an allele of a rice HPS1 gene, a molecular marker, a primer pair, and a use. The present invention provides the allele of a rice HPS1 gene, wherein the allele is a natural and excellent allele of the HPS1 gene and can enhance the multi-disease resistance of rice. Moreover, according to the present invention, in rice resources having excellent agronomic traits, such as 93-11 varieties, it is identified that a promoter of an allele of the HPS1 gene contains a 192bp fragment-deleted natural structural variation; a molecular marker primer for assisting breeding is developed on the basis of the natural structural variation, and is used for screening rice varieties containing an excellent allele of the HPS1 gene having the natural structural variation; and the allele provides a new gene resource for rice germplasm improvement.

The application discloses a maize deep sowing tolerance gene ZmCRK10, a deep sowing tolerance molecular marker and application, a nucleotide sequence of the maize deep sowing tolerance gene ZmCRK10 is shown as SEQ ID No:1; a sequence of a transcript CDS of the application is shown as SEQ ID No:3; the gene ZmCRK10 of the application encodes a cysteine-rich receptor kinase, participates in regulating plant growth and development, overexpression of a T04 transcript can increase the mesocotyl length under deep sowing treatment of corn, and improves the deep sowing tolerance characteristics of corn. Subsequently, through resequencing of a related population, it is found that a large fragment structural variation exists in a maize ZmCRK10 promoter region, and when a transposon with a length of about 121.7kb exists, the expression of a T04 transcript of ZmCRK10 can be significantly improved, the maize mesocotyl elongation is promoted, and the ZmCRK10 Type A can be used as a maize deep sowing tolerance molecular marker.