72 results about "Structural variation" patented technology

The invention relates to the technical field of bioinformatics, and discloses a method, a system, equipment and a medium for searching for base mutation aiming at third-generation full-length transcript sequencing data, the base mutation is accurately positioned to a specific transcript by directly processing the third-generation full-length transcript sequencing data, and the method and the system for searching for the base mutation aiming at the third-generation full-length transcript sequencing data are provided. The co-occurrence relation of a plurality of mutations on the same transcript is accurately analyzed, and the defects of calculation redundancy, function misjudgment and the like caused by the fact that a mutation transcript source cannot be determined due to fragmentation splicing and the co-occurrence is simulated by depending on permutation and combination in a second-generation short-read-long sequencing technology are effectively overcome; the recall rate of transcripts which are not mapped due to a high-variation region is improved through mapping correction assisted by structural variation, and false positive is effectively inhibited through a multi-dimensional filtering condition, so that the sensitivity and reliability of mutation detection are remarkably improved; particularly, mutation events with function remodeling due to reading frame change can be accurately recognized in scenes such as neoantigen prediction where mutation function consequences need to be accurately evaluated, and the method has important value in application in the fields of precision medical treatment and the like.

The invention discloses an application of PtoERD3 gene structure variation in evaluation of poplar lignin content, the structure variation is located in an upstream promoter region of a poplar PtoERD3 gene, is a 54bp chromosome structure variation SV fragment, and has a nucleotide sequence as shown in SEQ ID NO.1. The invention also discloses an application of the PtoERD3 gene structure variation in evaluation of poplar lignin content. By measuring the structural variation, the lignin content of the poplar can be accurately judged, superior plants with high-quality wood quality characters can be accurately and efficiently screened in the early growth stage of the poplar, the breeding period is effectively shortened, and a theoretical support is provided for molecular design breeding of the poplar wood quality.

Compositions and methods for detecting structural variations (SVs) in target genes or for genetic mapping of movable transposable elements are disclosed, the target genes relating to disease pathologies commonly found in large Mendelian genomics projects, and the movable transposable elements relating to genetic diseases, cancer, and aging. The method comprises: (i) contacting a sample containing genomic DNA with a DNA endonuclease for an effective amount of time to cleave the genomic DNA into fragments, the genomic DNA being uncrosslinked; (ii) subjecting the fragments obtained from step (b) to a DNA ligase to obtain circularized DNA; (iii) subjecting the circularized DNA to reverse PCR amplification containing a reverse primer, wherein the reverse primer is designed to match a expected wild-type sequence near a suspected mutant locus in the gene; and (iv) sequencing the amplified products. Exemplary conditions include Bardet-Biedel syndrome; severe upper and lower limb defects; retinitis pigmentosa; syndromic microcephaly; spastic paraplegia; and atypical hemolytic uremic syndrome.

This invention relates to a method for structural variant (SV) identification and genotyping in long-read family pedigree samples. The invention pertains to the field of vegetative variant (SV) detection in families, specifically focusing on methods for identifying and genotyping structural variants. The aim of this invention is to address the problems of existing family-based SV detection methods, which heavily rely on high-coverage sequencing, resulting in insufficient utilization of genetic characteristics and inaccurate SV detection and genotyping, as well as the high cost of sequencing multiple samples. This invention uses individual sequencing data from all family members as input, extracts variant features from each member, performs cluster analysis on the family feature set, assigns features to their respective members, and then uses three family feature signal correction methods to correct detection errors. Finally, SVs are located and anchored using Mendelian inheritance laws, and haplotype genotyping of SVs is completed using linkage information from long-read sequencing fragments.

The invention discloses a detection system and method for identifying mycobacteria and drug resistance genes of the mycobacteria based on nanopore sequencing, and relates to the field of biological medicine, the detection system comprises a specific targeted enrichment module, a nanopore sequencing module and a biological information analysis module; the specific targeted enrichment module comprises a probe combination, and the probe combination covers a mycobacterium tuberculosis complex conservative identification gene, species-specific genes of common nontuberculous mycobacteria and mycobacterium leprosy, and full-length or partial sequences of drug resistance related genes in a targeted manner; by utilizing the characteristics of nanopore length reading length and real-time sequencing and a tuberculosis specific targeted enrichment strategy, accurate identification of a mycobacterium tuberculosis complex group, synchronous typing of 42 mycobacteria, analysis of 24 drug-resistant genes, and efficient detection of structural variation and low-abundance heterogeneity drug-resistant mutation are realized, the detection period is shortened, the detection cost is reduced, and the detection efficiency is improved. And a comprehensive and reliable technical basis is provided for accurate diagnosis and treatment of mycobacterium infection.

This application belongs to the field of molecular biological breeding and provides molecular markers for chicken weight-related structural variations and their applications. The molecular markers for chicken weight-related structural variations are: SV1 located at position 29007968 on chromosome 3, based on the chicken reference genome GRCg7b, with a reference allele of SEQ ID NO.1 and a substitute allele of A; or SV2 located at position 65895344 on chromosome 1, with a reference allele of G and a substitute allele of SEQ ID NO.2; SV3 located at position 1199450 on chromosome 12, with a reference allele of C and a substitute allele of SEQ ID NO.3; or SV4 located at position 37121335 on chromosome Z, with a reference allele of C and a substitute allele of SEQ ID NO.4. Experiments and verification have demonstrated that the above markers are significantly correlated with chicken weight, providing new molecular marker resources for the genetic improvement of broiler weight traits.

The invention provides methods for identifying rare variants near a structural variation in a genetic sequence, for example, in a nucleic acid sample taken from a subject. The invention additionally includes methods for aligning reads (e.g., nucleic acid reads) to a reference sequence construct accounting for the structural variation, methods for building a reference sequence construct accounting for the structural variation or the structural variation and the rare variant, and systems that use the alignment methods to identify rare variants. The method is scalable, and can be used to align millions of reads to a construct thousands of bases long, or longer.

The invention discloses a resequencing-based space mutagenesis peanut population genotype variation map and a construction method thereof, and belongs to the technical field of plant biotechnology and plant molecular breeding, and the technical key points are as follows: a space mutagenesis peanut mutant plant is utilized, based on a whole genome resequencing technology, genetic variation sites in a genome are systematically detected, and the genotype variation map of the space mutagenesis peanut population is obtained. A variation map of a space mutagenesis peanut population genome is constructed, the map comprises no less than 500,000 mononucleotide variations (SNP), 100,000-200,000 insertion and deletion (InDel), about 3000 copy number variations (CNV) and about more than 3000 structural variations (SV), and 66 genes related to peanut grease anabolism are screened out. The construction method comprises the following steps: obtaining a mutant plant, extracting DNA, sequencing, detecting and identifying SNP, InDel, CNV and SV variation sites, and the like.

Numerous molecular data points, consisting of numerical values ​​representing label locations, are aligned to a reference genome to detect structural variations. [Solution] When the size of the label interval of a reference nucleic acid sequence or the label interval of a target nucleic acid sequence is less than or equal to a lower limit, the information processing device according to the present invention uses a correction function composed of a polynomial that takes the interval as an argument to correct the interval so that it becomes a value greater than the lower limit.

The invention discloses application of a ZmAAAP64 gene in regulation and control of protein accumulation and nitrogen utilization of a whole corn plant, and belongs to the technical field of biology. The nucleotide sequence of the ZmAAAP64 gene is as shown in SEQ ID NO. 11. A BC2S3 population is constructed based on wild corn Ames21814 and a common corn inbred line B73 for QTL positioning, a key gene ZmAAAP64 for regulating and controlling the protein content and nitrogen utilization efficiency of the whole corn plant is excavated, structural variation analysis finds that in different corn population materials, insertion and deletion variations exist in a plurality of conservative intervals of a ZmAAAP64 gene promoter region, and the ZmAAAP64 gene promoter region has a high expression in the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content. The accumulation amount of Gln and Asn in the stem of the ZmAAAP64 gene overexpression material is increased by about 30-60%, and the protein content of the stem, the protein content of the leaf and the nitrogen accumulation amount of the whole plant are remarkably increased. And a technical means is provided for cultivating corn with high protein and high nitrogen utilization efficiency.

The invention discloses a fluorescence in-situ hybridization probe group for rapidly distinguishing hexaploid oat chromosomes and application thereof, and belongs to the technical field of molecular biology. The fluorescent in-situ hybridization probe group provided by the invention comprises a probe oligo-356 and a probe oligo-898, wherein the nucleotide sequence of the probe oligo-356 is as shown in SEQ ID NO. 1; the nucleotide sequence of the probe oligo-356 is as shown in SEQ ID NO. 2; the provided fluorescence in-situ hybridization probe group can quickly and accurately identify different chromosomes of hexaploid oat through a fluorescence in-situ hybridization method, and has important scientific and practical values for hexaploid oat chromosome structure variation identification, oat genetic relationship identification, oat genetic map construction and oat variety improvement.

The application provides a microsatellite site stability detection method and an electronic device thereof. The microsatellite site stability detection method comprises the following steps: S1, obtaining characteristic data in a preset microsatellite site set by using high-throughput targeted sequencing data of a to-be-detected sample, wherein the characteristic data at least comprises the following: length variation of a short tandem repeat sequence and structural variation occurring at the microsatellite site; S2, establishing a prediction model by using the characteristic data; and S3, outputting a microsatellite stability result of the to-be-detected sample by using the prediction model. The method can solve the limitation problem of the microsatellite instability detection method in the prior art and is suitable for the tumor detection field.

The application belongs to the technical field of bioinformatics, and relates to a method and system for detecting structural variation in transcript data of three-generation whole-exome sequencing, comprising: establishing a transcript set to be searched for structural variation; mapping and annotating transcript information according to TAGET software, cyclically reading the transcript set, and obtaining first structural variation of all transcripts; mapping transcript information according to Hisat2 software, cyclically reading the transcript set, and obtaining second structural variation of all transcripts; filtering and screening the first structural variation and the second structural variation respectively, and generating screened transcripts of the first structural variation and the second structural variation; and comprehensively screening the screened transcripts of the first structural variation and the second structural variation, and obtaining the final structural variation of the transcripts. The application improves the positive rate of structural variation and greatly reduces false positives by cross comparison of results of two kinds of software and strict control of the difference value of exon breakpoints between the transcript and the reference transcript.

This invention relates to the fields of plant genetic engineering and molecular biology, and discloses a molecular detection method for identifying plum species as true plum, apricot, or apricot-plum hybrids. This invention also provides plum blossom... PmBBX24 The first intron of the gene relative to apricot PaBBX24 Structural variations in the first intron of a gene, specifically manifested as plum blossom patterns. PmBBX24 The gene has a 1554bp insertion in its first intron, which is heterozygous in apricot-plum. This site provides a basis and molecular tool for the identification of true plum / apricot-plum / apricot. PmBBX24 Gene expression is involved in the response of plum blossoms to seasonal climate change. There are significant differences in the expression patterns of seasonal climate change in winter between the true plum and apricot plum varieties. This can be used to identify the true plum / apricot plum varieties, enabling rapid and accurate identification of plum blossom varieties during the seedling stage, shortening the breeding cycle and greatly reducing the workload of breeding.

The invention belongs to the technical field of plant breeding, and discloses an SV molecular marker combination for identifying Hongmeiren hybrid citrus, which is characterized by comprising the following two structural variation sites: (1) Chr1: 29803181 site, the sequence of which is as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and (2) a Chr2: 1013046 site, wherein the sequence of the Chr2: 1013046 site is as shown in SEQ ID NO: 3 and SEQ ID NO: 4. The invention further discloses a primer pair for detecting the SV molecular marker combination, a kit comprising the primer pair and application of the kit. The invention provides the SV molecular marker combination for identifying the variety of the citrus reticulata Blanco, the authenticity of the citrus reticulata Blanco can be rapidly identified in the seedling stage, the market counterfeit behavior is restrained, molecular evidence is provided for intellectual property protection, and the application of the molecular marker can assist in filial generation screening and shorten the breeding period.

The invention relates to the technical field of animal breeding, in particular to a structural variation molecular marker related to chicken feed conversion rate characters and application thereof. The molecular marker is located at the 3891127 site of the 23rd chromosome of the chicken, and the polymorphism of the molecular marker is G or GCTGTGGTTCCTCTGCCCCAGCGTGGCACATGGAGCTGTGTCCACAGGTGATCTTCCC. The molecular marker can be used for identifying the chicken disease, the chicken disease, the chicken disease and the chicken disease. A structural variation molecular marker chr233891127SV related to the chicken feed conversion rate is obtained through research and screening, and the feed conversion rate of a corresponding individual chicken can be reflected by detecting the genotype of the molecular marker. The molecular marker provided by the invention can be used for breeding chicken varieties with high feed conversion rate, and has important application value.

The present invention relates to the field of crop breeding, and in particular to an allele of a rice HPS1 gene, a molecular marker, a primer pair, and a use. The present invention provides the allele of a rice HPS1 gene, wherein the allele is a natural and excellent allele of the HPS1 gene and can enhance the multi-disease resistance of rice. Moreover, according to the present invention, in rice resources having excellent agronomic traits, such as 93-11 varieties, it is identified that a promoter of an allele of the HPS1 gene contains a 192bp fragment-deleted natural structural variation; a molecular marker primer for assisting breeding is developed on the basis of the natural structural variation, and is used for screening rice varieties containing an excellent allele of the HPS1 gene having the natural structural variation; and the allele provides a new gene resource for rice germplasm improvement.

The application discloses a maize deep sowing tolerance gene ZmCRK10, a deep sowing tolerance molecular marker and application, a nucleotide sequence of the maize deep sowing tolerance gene ZmCRK10 is shown as SEQ ID No:1; a sequence of a transcript CDS of the application is shown as SEQ ID No:3; the gene ZmCRK10 of the application encodes a cysteine-rich receptor kinase, participates in regulating plant growth and development, overexpression of a T04 transcript can increase the mesocotyl length under deep sowing treatment of corn, and improves the deep sowing tolerance characteristics of corn. Subsequently, through resequencing of a related population, it is found that a large fragment structural variation exists in a maize ZmCRK10 promoter region, and when a transposon with a length of about 121.7kb exists, the expression of a T04 transcript of ZmCRK10 can be significantly improved, the maize mesocotyl elongation is promoted, and the ZmCRK10 Type A can be used as a maize deep sowing tolerance molecular marker.

This invention discloses a method utilizing Breast Milk A method for identifying the red coat color phenotype in cattle using an 8403 bp gene sequence. Analysis of third-generation sequencing data from domestic cattle samples with different coat color phenotypes identified, for the first time, a gene significantly associated with the red coat color phenotype. Breast Milk An 8403bp structural variation in the gene sequence overlaps with a LINE-1 transposon, leading to... Breast Milk Gene transcripts produce different mRNA isoforms. This invention achieves the detection of bovine mRNA using two pairs of primers. Breast Milk Gene detection and accurate genotyping can be performed, enabling marker-assisted selection of the red coat color trait in cattle at the DNA level.

The invention discloses a structural variation molecular marker located on a pig chromosome 6 and related to the lactation ability of a sow. The structural variation molecular marker is a DNA fragment which is deleted behind a 147139167 bp site on a chromosome 6 of an international pig reference genome version 11.1, and the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO: 1 and has the size of 283 bp; the genotypes of the gene are A / A, A / DEL and DEL / DEL. The structural variation molecular marker provided by the invention is remarkably related to the lactation property character of the sow, and by breeding individuals with the genotype of the structural variation molecular marker being A / A and eliminating mutant individuals with deletion type structural variation, namely individuals with the genotypes being A / DEL and DEL / DEL, the frequency of wild individuals of a group can be increased generation by generation, so that the lactation property of offspring pigs is improved, and the lactation property of the offspring pigs is improved. The sow reproductive performance is improved, and the breeding economic effect is improved.

The application discloses a deep learning-based third-generation genome SV detection method, and belongs to the technical field of structural variation detection.The application solves the problem of poor accuracy of the existing structural variation detection method.The application first extracts variation features from the alignment result with a reference genome, obtains a sub-matrix of a fragment according to the extracted variation features, encodes the sub-matrix of the fragment by using a convolutional neural network to obtain coding features, splices the coding features of multiple fragments into a 2000bp feature matrix, and captures the global dependence relationship between the fragments by using a Transformer network, so that the variation region can be accurately identified in a longer sequence; after detecting the variation, the variation site is subjected to clustering analysis, the breakpoint position is accurately positioned, an automatic support read selection strategy is designed, the support reads can be automatically screened according to the alignment quality, the false positive region is further filtered, and the reliability of the detection result is ensured.The method can be applied to SV detection in a third-generation genome.

The invention discloses a chicken population genotyping liquid chip based on a combined site of structural variation and single nucleotide polymorphism and a detection method of the chicken population genotyping liquid chip, and belongs to the technical field of animal molecular markers. The chip integrates 24 chromosome level chicken genomes, 16 HiFi sequencing data sets and 2018 parts of whole genome re-sequencing data (WGS), and 36958 loci, including 5267 SV-GWAS and SNP-GWAS significant loci and 31691 typing background SV loci, are obtained by integrating genome comparison and HiFi data joint identification SV strategies and combining multi-software cross validation screening. According to the detection method, target fragments are enriched through probe hybridization, next-generation sequencing typing is carried out, and high-throughput genotyping of chicken populations is achieved. The blank of the chicken high-density SV chip is filled, and the chicken high-density SV chip has the advantages of accurate typing, controllable cost and high phenotype explanation rate.

The present application relates to a kind of line-elimination method immunochromatography test paper, it is sequentially bonded on base plate by sample pad, binding pad, nitrocellulose membrane, water absorption pad mutual lapping, C line for control and T line for detection are equipped on the nitrocellulose membrane, streptavidin labeled colloidal gold compound and rabbit IgG labeled colloidal gold compound are sprayed on the binding pad;T line on the nitrocellulose membrane is coated with FITC labeled antibody, and C line is coated with anti-IgG.The line-elimination method immunochromatography test paper can eliminate line when probe cutting ratio reaches 50%, thus greatly improve the detection sensitivity, can be applied to the application in CRISPR mode target gene detection product, including pathogenic microorganism genotyping, SNP, insertion and deletion, structural variation, methylation modification site detection, or drug resistance gene identification.

The application discloses application of a PtoERD3 gene structure variation in evaluation of poplar lignin content, wherein the structure variation is located in a promoter region of a poplar PtoERD3 gene, is a 54bp chromosome structure variation SV fragment, and has a nucleotide sequence as shown in SEQ ID NO. 1. The structure variation can be used to accurately determine the lignin content of the poplar, can be used to accurately and efficiently screen excellent plants with high-quality wood quality traits in the early growth stage of the poplar, effectively shortens a breeding cycle, and provides theoretical support for molecular design breeding of poplar wood quality.

The invention is applicable to the technical field of bioinformatics and molecular diagnosis, and provides a TP53 gene heterozygosity deletion and copy number variation detection method based on targeted sequencing, and synchronous and accurate detection of LOH / CNV and mutation of a TP53 gene is realized through core technology innovations such as customized probe design, dynamic reference set correction, HMM model improvement and KDE double-peak judgment; compared with a traditional detection technology, the problems of CN-LOH leak detection and insufficient integrated analysis of mutation and structural variation are effectively solved, and the coincidence rate with whole exon sequencing reaches 100%; the method has the outstanding advantages of high sensitivity, high specificity, rapidness, high efficiency and controllable cost, can accurately judge the multiple strike states of TP53, provides a reliable molecular diagnosis basis for risk stratification, prognosis evaluation and individualized treatment decision of patients with myeloid tumors such as AML / MDS, and is more suitable for clinical conventional popularization and application.

The invention discloses application of a structural variation marker of a goat VRTN gene in goat breeding and a method for detecting goat meat quality traits, and relates to the field of agricultural gene breeding. The sequence of the structure variation marker is SEQ ID No: 01, the structure variation marker is arranged on a goat VRTN gene reference genome ASM170441v1, the NCBI sequence number is NC030817.1, the positions of the structure variation marker are the 17448006th basic group and the 17447632th basic group of the NC030817.1, and the structure variation marker is a replacement marker of a single basic group. In a goat genome, the meat quality character of an individual replacing the structural variation marker is inferior to that of a wild individual, so that the character can provide a potential molecular marker for molecular marker-assisted selection of the goat meat quality character, and the method can be used for goat genetic resource screening or improved breeding.

The invention discloses a corn disease-resistant molecular marker and application. The nucleotide sequence of the corn disease-resistant molecular marker ZmCRK10Type B is as shown in SEQ ID NO: 3. The gene ZmCRK10 disclosed by the invention encodes cysteine-rich receptor kinase, and a T03 transcript of the gene is over-expressed, so that the disease resistance of corn is improved. The gene provides valuable resources for cultivation of maize disease-resistant varieties in a molecular breeding mode. Resequencing of associated populations subsequently finds that when a large-fragment structure variation exists in a corn ZmCRK10 promoter region and a transposon with the length of about 63.3 kb exists, the expression of a T03 transcript of ZmCRK10 can be remarkably improved, the resistance of multiple diseases of corn can be promoted, and the ZmCRK10 gene can be used as a corn disease-resistant molecular marker to cultivate a new variety of disease-resistant corn.

The application is suitable for the field of bioinformatics and molecular diagnosis technology, and provides a TP53 gene heterozygous deletion and copy number variation detection method based on targeted sequencing. Through core technical innovations such as customized probe design, dynamic reference set correction, improved HMM model and KDE bimodal judgment, the application realizes the synchronous and accurate detection of TP53 gene LOH / CNV and mutation. Compared with traditional detection technology, the application effectively solves the problems of CN-LOH missed detection and insufficient integrated analysis of mutations and structural variations, and the coincidence rate with whole exon sequencing reaches 100%. The method has the outstanding advantages of high sensitivity, high specificity, rapid efficiency and controllable cost, can accurately determine the TP53 multiple hit state, and provides reliable molecular diagnosis basis for risk stratification, prognosis evaluation and individualized treatment decision of AML / MDS and other myeloid tumor patients, and is more suitable for clinical routine popularization and application.

The invention discloses a method for predicting fruit color based on structural variation of a strawberry FaMYB10-2 promoter, variation analysis is carried out on FaMYB10-2 promoter regions of 200 strawberry varieties to find that significant structural variation (SV) exists at the position 986bp away from the upstream of an initiation codon (ATG) on the promoter, the SV is in high linkage imbalance with adjacent SNP, and the SV is in high linkage imbalance with adjacent SNP. Promoter variation causes significant difference of FaMYB10-2 gene expression levels, and further influences anthocyanin synthesis and fruit color shade. Ref / Ref genotypes are mainly distributed in strawberry varieties bred in European and North America, and the fruit color is relatively deep; alt / Alt genotypes are mostly found in strawberry varieties bred in China and Japan, and the fruit color is light. Proved by activity analysis of promoter-driven GUS (glucuronidase), the Ref genotype promoter has strong activity, while the Alt genotype promoter has weak activity. The molecular marker is designed by using the structural variation and the related SNP, so that the rapid typing and auxiliary breeding of the fruit color character can be realized. The invention provides a new understanding for a molecular regulation mechanism of strawberry fruit color, and has wide breeding application value.

The invention discloses a method for identifying large-fragment sequence insertion in a target genome region and application of the method, and belongs to the technical field of bioinformatics. In order to solve the problem that large-fragment insertion variation is difficult to accurately identify due to factors such as short sequencing reading length and insufficient coverage in clinical metagenome sequencing, the invention proposes that a reference sequence capable of representing the insertion variation is artificially constructed and is combined with a rapid comparison process based on short reads to realize efficient identification of an insertion event in a target genome region. The method overcomes the dependence of an existing structure variation detection tool on high sequencing depth and long reading length, has the advantages of high identification speed, high sensitivity, high accuracy and the like, and is suitable for rapid screening of large fragment insertion related to a drug resistance mechanism in a clinical sample; meanwhile, the method can be popularized and applied to insertion variation analysis of other pathogen drug resistance related genes or genome areas, and has a good clinical application prospect.