Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

42 results about "Structural variation" patented technology

Structural variation (also genomic structural variation) is the variation in structure of an organism's chromosome. It consists of many kinds of variation in the genome of one species, and usually includes microscopic and submicroscopic types, such as deletions, duplications, copy-number variants, insertions, inversions and translocations. Originally, a structure variation affects a sequence length about 1Kb to 3Mb, which is larger than SNPs and smaller than chromosome abnormality (though the definitions have some overlap). However, the operational range of structural variants has widened to include events >50bp. The definition of structural variation does not imply anything about frequency or phenotypical effects. Many structural variants are associated with genetic diseases, however many are not. Recent research about SVs indicates that SVs are more difficult to detect than SNPs. Approximately 13% of the human genome is defined as structurally variant in the normal population, and there are at least 240 genes that exist as homozygous deletion polymorphisms in human populations, suggesting these genes are dispensable in humans. Rapidly accumulating evidence indicates that structural variations can comprise millions of nucleotides of heterogeneity within every genome, and are likely to make an important contribution to human diversity and disease susceptibility.

Compositions and methods for rapid targeted amplification of genomic regions, sequencing thereof, and analysis

PendingCN122319249AGenomicsRetinitis pigmentosa syndrome
Compositions and methods for detecting structural variations (SVs) in target genes or for genetic mapping of movable transposable elements are disclosed, the target genes relating to disease pathologies commonly found in large Mendelian genomics projects, and the movable transposable elements relating to genetic diseases, cancer, and aging. The method comprises: (i) contacting a sample containing genomic DNA with a DNA endonuclease for an effective amount of time to cleave the genomic DNA into fragments, the genomic DNA being uncrosslinked; (ii) subjecting the fragments obtained from step (b) to a DNA ligase to obtain circularized DNA; (iii) subjecting the circularized DNA to reverse PCR amplification containing a reverse primer, wherein the reverse primer is designed to match a expected wild-type sequence near a suspected mutant locus in the gene; and (iv) sequencing the amplified products. Exemplary conditions include Bardet-Biedel syndrome; severe upper and lower limb defects; retinitis pigmentosa; syndromic microcephaly; spastic paraplegia; and atypical hemolytic uremic syndrome.
Owner:KING ABDULLAH UNIV OF SCI & TECH

A method for structural variation calling and typing suitable for long read family sample sequencing

PendingCN122290708AAccurate detectionAccurate typingSignal correctionMendelian inheritance
This invention relates to a method for structural variant (SV) identification and genotyping in long-read family pedigree samples. The invention pertains to the field of vegetative variant (SV) detection in families, specifically focusing on methods for identifying and genotyping structural variants. The aim of this invention is to address the problems of existing family-based SV detection methods, which heavily rely on high-coverage sequencing, resulting in insufficient utilization of genetic characteristics and inaccurate SV detection and genotyping, as well as the high cost of sequencing multiple samples. This invention uses individual sequencing data from all family members as input, extracts variant features from each member, performs cluster analysis on the family feature set, assigns features to their respective members, and then uses three family feature signal correction methods to correct detection errors. Finally, SVs are located and anchored using Mendelian inheritance laws, and haplotype genotyping of SVs is completed using linkage information from long-read sequencing fragments.
Owner:HARBIN INST OF TECH

Mycobacterium based on nanopore sequencing and detection system and method for identifying drug resistance gene of mycobacterium

PendingCN121896381AMicrobiological testing/measurementMicroorganism based processesMycobacterium InfectionsTarget enrichment
The invention discloses a detection system and method for identifying mycobacteria and drug resistance genes of the mycobacteria based on nanopore sequencing, and relates to the field of biological medicine, the detection system comprises a specific targeted enrichment module, a nanopore sequencing module and a biological information analysis module; the specific targeted enrichment module comprises a probe combination, and the probe combination covers a mycobacterium tuberculosis complex conservative identification gene, species-specific genes of common nontuberculous mycobacteria and mycobacterium leprosy, and full-length or partial sequences of drug resistance related genes in a targeted manner; by utilizing the characteristics of nanopore length reading length and real-time sequencing and a tuberculosis specific targeted enrichment strategy, accurate identification of a mycobacterium tuberculosis complex group, synchronous typing of 42 mycobacteria, analysis of 24 drug-resistant genes, and efficient detection of structural variation and low-abundance heterogeneity drug-resistant mutation are realized, the detection period is shortened, the detection cost is reduced, and the detection efficiency is improved. And a comprehensive and reliable technical basis is provided for accurate diagnosis and treatment of mycobacterium infection.
Owner:THE THIRD PEOPLES HOSPITAL OF KUNMING

Chicken weight-related structural variation molecular marker and application thereof

PendingCN122357743AChromosome localisationChromosome 12
This application belongs to the field of molecular biological breeding and provides molecular markers for chicken weight-related structural variations and their applications. The molecular markers for chicken weight-related structural variations are: SV1 located at position 29007968 on chromosome 3, based on the chicken reference genome GRCg7b, with a reference allele of SEQ ID NO.1 and a substitute allele of A; or SV2 located at position 65895344 on chromosome 1, with a reference allele of G and a substitute allele of SEQ ID NO.2; SV3 located at position 1199450 on chromosome 12, with a reference allele of C and a substitute allele of SEQ ID NO.3; or SV4 located at position 37121335 on chromosome Z, with a reference allele of C and a substitute allele of SEQ ID NO.4. Experiments and verification have demonstrated that the above markers are significantly correlated with chicken weight, providing new molecular marker resources for the genetic improvement of broiler weight traits.
Owner:CHINA AGRI UNIV

Methods and systems for detecting sequence variants

ActiveUS12633378B2Sequence analysisInstrumentsSequence variationBioinformatics
The invention provides methods for identifying rare variants near a structural variation in a genetic sequence, for example, in a nucleic acid sample taken from a subject. The invention additionally includes methods for aligning reads (e.g., nucleic acid reads) to a reference sequence construct accounting for the structural variation, methods for building a reference sequence construct accounting for the structural variation or the structural variation and the rare variant, and systems that use the alignment methods to identify rare variants. The method is scalable, and can be used to align millions of reads to a construct thousands of bases long, or longer.
Owner:SEVEN BRIDGES GENOMICS INC

Information processing device

Numerous molecular data points, consisting of numerical values ​​representing label locations, are aligned to a reference genome to detect structural variations. [Solution] When the size of the label interval of a reference nucleic acid sequence or the label interval of a target nucleic acid sequence is less than or equal to a lower limit, the information processing device according to the present invention uses a correction function composed of a polynomial that takes the interval as an argument to correct the interval so that it becomes a value greater than the lower limit.
Owner:HITACHI HIGH TECH CORP

Application of ZmAAAP64 gene in regulating and controlling protein accumulation and nitrogen utilization of whole corn plant

The invention discloses application of a ZmAAAP64 gene in regulation and control of protein accumulation and nitrogen utilization of a whole corn plant, and belongs to the technical field of biology. The nucleotide sequence of the ZmAAAP64 gene is as shown in SEQ ID NO. 11. A BC2S3 population is constructed based on wild corn Ames21814 and a common corn inbred line B73 for QTL positioning, a key gene ZmAAAP64 for regulating and controlling the protein content and nitrogen utilization efficiency of the whole corn plant is excavated, structural variation analysis finds that in different corn population materials, insertion and deletion variations exist in a plurality of conservative intervals of a ZmAAAP64 gene promoter region, and the ZmAAAP64 gene promoter region has a high expression in the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content and the nitrogen utilization efficiency of the whole corn plant protein content. The accumulation amount of Gln and Asn in the stem of the ZmAAAP64 gene overexpression material is increased by about 30-60%, and the protein content of the stem, the protein content of the leaf and the nitrogen accumulation amount of the whole plant are remarkably increased. And a technical means is provided for cultivating corn with high protein and high nitrogen utilization efficiency.
Owner:SICHUAN AGRI UNIV

Method for detecting microsatellite site stability and electronic device thereof

ActiveCN122067600BGeneticsFeature data
The application provides a microsatellite site stability detection method and an electronic device thereof. The microsatellite site stability detection method comprises the following steps: S1, obtaining characteristic data in a preset microsatellite site set by using high-throughput targeted sequencing data of a to-be-detected sample, wherein the characteristic data at least comprises the following: length variation of a short tandem repeat sequence and structural variation occurring at the microsatellite site; S2, establishing a prediction model by using the characteristic data; and S3, outputting a microsatellite stability result of the to-be-detected sample by using the prediction model. The method can solve the limitation problem of the microsatellite instability detection method in the prior art and is suitable for the tumor detection field.
Owner:BEIJING NOVOGENE TECH CO LTD

A molecular detection method for identifying prunus plants as true mei, apricot or aprumei hybrids

This invention relates to the fields of plant genetic engineering and molecular biology, and discloses a molecular detection method for identifying plum species as true plum, apricot, or apricot-plum hybrids. This invention also provides plum blossom... PmBBX24 The first intron of the gene relative to apricot PaBBX24 Structural variations in the first intron of a gene, specifically manifested as plum blossom patterns. PmBBX24 The gene has a 1554bp insertion in its first intron, which is heterozygous in apricot-plum. This site provides a basis and molecular tool for the identification of true plum / apricot-plum / apricot. PmBBX24 Gene expression is involved in the response of plum blossoms to seasonal climate change. There are significant differences in the expression patterns of seasonal climate change in winter between the true plum and apricot plum varieties. This can be used to identify the true plum / apricot plum varieties, enabling rapid and accurate identification of plum blossom varieties during the seedling stage, shortening the breeding cycle and greatly reducing the workload of breeding.
Owner:BEIJING FORESTRY UNIVERSITY

Structural variation molecular marker related to chicken feed conversion rate character and application thereof

The invention relates to the technical field of animal breeding, in particular to a structural variation molecular marker related to chicken feed conversion rate characters and application thereof. The molecular marker is located at the 3891127 site of the 23rd chromosome of the chicken, and the polymorphism of the molecular marker is G or GCTGTGGTTCCTCTGCCCCAGCGTGGCACATGGAGCTGTGTCCACAGGTGATCTTCCC. The molecular marker can be used for identifying the chicken disease, the chicken disease, the chicken disease and the chicken disease. A structural variation molecular marker chr233891127SV related to the chicken feed conversion rate is obtained through research and screening, and the feed conversion rate of a corresponding individual chicken can be reflected by detecting the genotype of the molecular marker. The molecular marker provided by the invention can be used for breeding chicken varieties with high feed conversion rate, and has important application value.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Structural variation molecular marker located on chromosome 6 of sow and related to lactation ability of sow and application of structural variation molecular marker

The invention discloses a structural variation molecular marker located on a pig chromosome 6 and related to the lactation ability of a sow. The structural variation molecular marker is a DNA fragment which is deleted behind a 147139167 bp site on a chromosome 6 of an international pig reference genome version 11.1, and the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO: 1 and has the size of 283 bp; the genotypes of the gene are A / A, A / DEL and DEL / DEL. The structural variation molecular marker provided by the invention is remarkably related to the lactation property character of the sow, and by breeding individuals with the genotype of the structural variation molecular marker being A / A and eliminating mutant individuals with deletion type structural variation, namely individuals with the genotypes being A / DEL and DEL / DEL, the frequency of wild individuals of a group can be increased generation by generation, so that the lactation property of offspring pigs is improved, and the lactation property of the offspring pigs is improved. The sow reproductive performance is improved, and the breeding economic effect is improved.
Owner:SOUTH CHINA AGRICULTURAL UNIVERSITY

Chicken population genotyping liquid chip based on combined site of structural variation and single nucleotide polymorphism and detection method of chicken population genotyping liquid chip

PendingCN121555654ANucleotide librariesMicrobiological testing/measurementHigh throughput genotypingGenome alignment
The invention discloses a chicken population genotyping liquid chip based on a combined site of structural variation and single nucleotide polymorphism and a detection method of the chicken population genotyping liquid chip, and belongs to the technical field of animal molecular markers. The chip integrates 24 chromosome level chicken genomes, 16 HiFi sequencing data sets and 2018 parts of whole genome re-sequencing data (WGS), and 36958 loci, including 5267 SV-GWAS and SNP-GWAS significant loci and 31691 typing background SV loci, are obtained by integrating genome comparison and HiFi data joint identification SV strategies and combining multi-software cross validation screening. According to the detection method, target fragments are enriched through probe hybridization, next-generation sequencing typing is carried out, and high-throughput genotyping of chicken populations is achieved. The blank of the chicken high-density SV chip is filled, and the chicken high-density SV chip has the advantages of accurate typing, controllable cost and high phenotype explanation rate.
Owner:HENAN AGRICULTURAL UNIVERSITY

Elimination method immunochromatography test strip and its application in CRISPR detection typing

The present application relates to a kind of line-elimination method immunochromatography test paper, it is sequentially bonded on base plate by sample pad, binding pad, nitrocellulose membrane, water absorption pad mutual lapping, C line for control and T line for detection are equipped on the nitrocellulose membrane, streptavidin labeled colloidal gold compound and rabbit IgG labeled colloidal gold compound are sprayed on the binding pad;T line on the nitrocellulose membrane is coated with FITC labeled antibody, and C line is coated with anti-IgG.The line-elimination method immunochromatography test paper can eliminate line when probe cutting ratio reaches 50%, thus greatly improve the detection sensitivity, can be applied to the application in CRISPR mode target gene detection product, including pathogenic microorganism genotyping, SNP, insertion and deletion, structural variation, methylation modification site detection, or drug resistance gene identification.
Owner:GUANGZHOU WONDFO BIOTECH

TP53 gene heterozygosity deletion and copy number variation detection method based on targeted sequencing

The invention is applicable to the technical field of bioinformatics and molecular diagnosis, and provides a TP53 gene heterozygosity deletion and copy number variation detection method based on targeted sequencing, and synchronous and accurate detection of LOH / CNV and mutation of a TP53 gene is realized through core technology innovations such as customized probe design, dynamic reference set correction, HMM model improvement and KDE double-peak judgment; compared with a traditional detection technology, the problems of CN-LOH leak detection and insufficient integrated analysis of mutation and structural variation are effectively solved, and the coincidence rate with whole exon sequencing reaches 100%; the method has the outstanding advantages of high sensitivity, high specificity, rapidness, high efficiency and controllable cost, can accurately judge the multiple strike states of TP53, provides a reliable molecular diagnosis basis for risk stratification, prognosis evaluation and individualized treatment decision of patients with myeloid tumors such as AML / MDS, and is more suitable for clinical conventional popularization and application.
Owner:SHANGHAI TISSUEBANK GENE TECH CO LTD +3

Corn disease-resistant molecular marker and application

The invention discloses a corn disease-resistant molecular marker and application. The nucleotide sequence of the corn disease-resistant molecular marker ZmCRK10Type B is as shown in SEQ ID NO: 3. The gene ZmCRK10 disclosed by the invention encodes cysteine-rich receptor kinase, and a T03 transcript of the gene is over-expressed, so that the disease resistance of corn is improved. The gene provides valuable resources for cultivation of maize disease-resistant varieties in a molecular breeding mode. Resequencing of associated populations subsequently finds that when a large-fragment structure variation exists in a corn ZmCRK10 promoter region and a transposon with the length of about 63.3 kb exists, the expression of a T03 transcript of ZmCRK10 can be remarkably improved, the resistance of multiple diseases of corn can be promoted, and the ZmCRK10 gene can be used as a corn disease-resistant molecular marker to cultivate a new variety of disease-resistant corn.
Owner:HUAZHONG AGRI UNIV

A method for detecting TP53 gene heterozygous deletion and copy number variation based on targeted sequencing

The application is suitable for the field of bioinformatics and molecular diagnosis technology, and provides a TP53 gene heterozygous deletion and copy number variation detection method based on targeted sequencing. Through core technical innovations such as customized probe design, dynamic reference set correction, improved HMM model and KDE bimodal judgment, the application realizes the synchronous and accurate detection of TP53 gene LOH / CNV and mutation. Compared with traditional detection technology, the application effectively solves the problems of CN-LOH missed detection and insufficient integrated analysis of mutations and structural variations, and the coincidence rate with whole exon sequencing reaches 100%. The method has the outstanding advantages of high sensitivity, high specificity, rapid efficiency and controllable cost, can accurately determine the TP53 multiple hit state, and provides reliable molecular diagnosis basis for risk stratification, prognosis evaluation and individualized treatment decision of AML / MDS and other myeloid tumor patients, and is more suitable for clinical routine popularization and application.
Owner:SHANGHAI TISSUEBANK GENE TECH CO LTD +3

Method for identifying large-fragment sequence insertion in target genome region and application of method

ActiveCN121260248AProteomicsGenomicsGenomic sequencingSequence Insertions
The invention discloses a method for identifying large-fragment sequence insertion in a target genome region and application of the method, and belongs to the technical field of bioinformatics. In order to solve the problem that large-fragment insertion variation is difficult to accurately identify due to factors such as short sequencing reading length and insufficient coverage in clinical metagenome sequencing, the invention proposes that a reference sequence capable of representing the insertion variation is artificially constructed and is combined with a rapid comparison process based on short reads to realize efficient identification of an insertion event in a target genome region. The method overcomes the dependence of an existing structure variation detection tool on high sequencing depth and long reading length, has the advantages of high identification speed, high sensitivity, high accuracy and the like, and is suitable for rapid screening of large fragment insertion related to a drug resistance mechanism in a clinical sample; meanwhile, the method can be popularized and applied to insertion variation analysis of other pathogen drug resistance related genes or genome areas, and has a good clinical application prospect.
Owner:BEIJING GOLDEN KEY MEDICAL LAB CO LTD +2

Allele, molecular marker, and primer pair of rice HPS1 gene, and applications thereof

An allele, a molecular marker, a primer pair of rice HPS1 gene, and applications thereof are provided. An allele of the rice HPS1 gene is provided. The allele is a natural excellent allele of the HPS1 gene. Furthermore, a natural structural variation of 192 bp fragment deletion in the promoter of the allele of HPS1 gene is identified from rice resources with excellent agronomic traits, such as 93-11 variety. Based on this, a molecular marker primer for assisted breeding is developed.
Owner:SICHUAN AGRI UNIV

Method for screening specific sequence of genome and related device

The invention relates to the technical field of biology, in particular to a method for screening specific sequences of genomes and a related device. According to the method, high-precision re-sequencing data and long-fragment genome data are integrated, so that the accuracy of structural variation detection between related strains is remarkably improved, false positive is effectively reduced, the verification cost is greatly saved, and the method is suitable for multi-species strain identification and molecular marker development and has a wide application prospect in the fields of precision breeding, biodiversity protection and the like.
Owner:FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI

Application of Gossypium barbadense GbUNE12 gene in regulating resistance of cotton to verticillium wilt

PendingCN122588145ABiotechnologyGermplasm
This invention discloses a sea island cotton GbUNE12 The application of genes in regulating cotton resistance to Verticillium wilt, the aforementioned GbUNE12 Genes negatively regulate cotton's resistance to Verticillium wilt, specifically by reducing or inhibiting... GbUNE12 Gene expression or activity to enhance resistance to Verticillium wilt in cotton, the aforementioned GbUNE12 The coding sequence of the gene is shown in SEQ ID NO:1, and its encoded amino acid sequence is shown in SEQ ID NO:2. This invention is the first to identify transcription factors in the whole genome of sea island cotton and discover the bHLH transcription factor gene with a 66 bp structural variation in its promoter region. GbUNE12 ,based on GbUNE12 Molecular markers developed for gene research can effectively distinguish between marine and terrestrial orthologous genes and can be used for marker-assisted screening of disease-resistant germplasm.
Owner:HEBEI AGRICULTURAL UNIV.

Application of gene PTHLH as target point in auxiliary diagnosis, prognosis judgment and treatment of esophageal squamous carcinoma

ActiveCN114990219BMicrobiological testing/measurementDNA/RNA fragmentationIMPACT geneSuper-enhancer
The application belongs to the technical field of biological medicine, and provides application of gene PTHLH as a target point in auxiliary diagnosis, prognosis judgment and treatment of esophageal squamous carcinoma. The target point PTHLH is an esophageal squamous carcinoma driving target point accumulated based on structural variation TD, that is, a potential target point of a super enhancer accumulated by TD; the super enhancer is an upstream regulation region of PTHLH. The application research finds that the enhancer region of the ESCC driving gene is frequently amplified by TD. These results suggest that the TD event can regulate the related expression of the cancer gene by affecting the gene ontology and the regulation element. Meanwhile, the esophageal squamous carcinoma driving target point accumulated based on the structural variation TD is found to be the potential target point PTHLH of the super enhancer accumulated by TD.
Owner:SHENZHEN PKU HKUST MEDICAL CENT

Chromosome spatial structure variation detection method based on liquid-phase gene chip

The invention discloses a chromosome spatial structure variation detection method based on a liquid-phase gene chip. The method comprises the following steps: detecting wheat to be detected by using a chip comprising the probe composition; the probe composition comprises probes A-F; the nucleotide sequences of the probes A-F are respectively shown as sequences 1-6. According to the method, a liquid phase chip technology is combined with a high-throughput sequencing method of specific probe capture, multiple gene editing sites and flanking areas can be captured at the same time in one-time detection, and the method is suitable for parallel detection of large-fragment editing events and single-base editing events in wheat MLO gene editing materials. The method disclosed by the invention not only effectively improves the detection efficiency of a plurality of editing events, but also greatly reduces the analysis cost, and is of great significance to the detection of wheat with chromosome space structure change caused by large fragment deletion of the MLO gene and the breeding of powdery mildew-resistant and high-yield wheat.
Owner:INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI

A low-memory multi-genome alignment and structural variation integration method for super large-scale closely related genome set

PendingCN122337307AGenome alignmentDynamic programming
This invention relates to a low-memory multi-genome alignment and structural variation integration method for ultra-large-scale closely related genome sets. It solves the problems of existing multi-sequence / multi-genome alignment methods, which suffer from unacceptable time and space overhead on ultra-long sequences, large errors, and inefficiency in identification and integration. It includes S1, sequence input, output, and center sequence preprocessing; S2, direction determination and anchor point retrieval; S3, main strand construction, loop divide-and-conquer, and banded dynamic programming for fine alignment; and S4, structural difference strand identification, block output, and consistent integration. The advantages of this invention are: it can losslessly preserve and integrate structural variation fragments related to inversions and rearrangements during global alignment, ensuring that the output meets the "column consistency" requirements of downstream analysis while expressing strand direction and rearrangement information, and avoiding the extremely slow or even unworkable problems of traditional multiple merging processes in ultra-large file scenarios.
Owner:YANGTZE DELTA REGION INST (QUZHOU) UNIV OF ELECTRONIC SCI & TECH OF CHINA

Macaca mulatta skin squamous carcinoma cell line MCSCC14397 and application thereof

ActiveCN121718496AMicrobiological testing/measurementMicroorganism based processesCarcinoma cell lineGenomic Stability
The invention discloses a macaque skin squamous carcinoma cell line MCSCC14397 and application of the macaque skin squamous carcinoma cell line MCSCC14397. The macaque skin squamous carcinoma cell line is named as macaque skin squamous carcinoma cell line MCSCC14397, and the preservation number of the macaque skin squamous carcinoma cell line is CCTCC (China Center For Type Culture Collection) NO: C2025156. The cell line disclosed by the invention has similar protein expression with primary tumor tissues, has chromosome abnormal karyotype, in-vitro tumor formation capability and stable proliferation characteristics, and simultaneously shows remarkable genome instability (such as high-frequency Cgt, T mutation and structural variation) and inflammation signal activation. The MYO10 gene expression in the cell line is up-regulated and drives DNA damage reaction and inflammatory factor expression, and unique advantages are provided for application of the cell line in skin squamous cell carcinoma mechanism research, drug screening and drug efficacy evaluation. The cell line disclosed by the invention can be used as an effective cell model, can be used for establishing a xenotransplantation animal model, and can provide a research basis for deeply researching the occurrence, development, metastasis mechanism and drug resistance mechanism of human skin squamous cell carcinoma as well as innovative drug development and screening.
Owner:KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI

SV molecular marker related to chicken tailless character and application of SV molecular marker

The invention provides an SV molecular marker related to a chicken tailless character and application of the SV molecular marker. According to the invention, a 4.1 kb structure variation on a positive-sense strand of a No.2 chromosome of a chicken genome is found, and the identification of a tailless character genotype can be realized through the structure variation. The specific primer provided by the invention is used for performing PCR (Polymerase Chain Reaction) amplification on the genome of a sample to be detected, then agarose gel electrophoresis detection is performed, and the genotype of an individual can be judged according to the strip size of a PCR amplification product. The method is convenient and quick, can quickly lock the no-tail character in the ladle chicken group, saves the breeding cost and time, increases the variety benefit, provides convenience for the breeding work of the no-tail chicken, and plays a great role in the breeding of the no-tail chicken.
Owner:CHINA AGRI UNIV

Primers and methods for detecting structural variations in cotton mon531 transgenic sequences

ActiveCN119799949BBiotechnologyNucleotide
This invention relates to the field of biotechnology, specifically to primers and methods for detecting transgenic sequence structural variations in cotton MON531. Primer combinations for screening transgenic sequence structural variations in cotton MON531 are provided, including primer pairs P0 / P1, P0 / P2, P0 / P3, P0 / P4, P0 / P5, P0 / P6, P0 / P7, P0 / P8, and P0 / P9, whose nucleotide sequences are shown in SEQ ID NO:7 to SEQ ID NO:16. A method for screening transgenic sequence structural variations in cotton MON531 using the above primer pairs is also provided. The primer combinations and methods of this invention enable continuous monitoring of transgenic sequence structural variations during the cultivation of cotton MON531, laying the foundation for assessing the safety of its long-term application.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Application of cattle LRP5 gene SV marker in identification of varieties of common cattle and tumor cattle

The invention discloses a method for rapidly identifying common cattle and tumor cattle by using a deleted large-fragment rapid structure variation marker in a tumor cattle LRP5 gene and an application of the method. Specific high-frequency SV of the common cattle and the tumor cattle is identified through whole genome data analysis. Based on a PCR (Polymerase Chain Reaction) technology, a blood genome DNA (Deoxyribonucleic Acid) pool of Xinjiang brown cattle and Wenshan cattle is used as a template, specific upstream and downstream primers are used for amplifying structural variation of large fragment deletion of cattle LRP5 genes, then agarose gel electrophoresis is carried out, and different individuals are divided into a non-deletion type, a deletion type and a heterozygous type according to electrophoresis results. A correlation analysis result shows that different genotypes of the LRP5 gene are remarkably related to the cattle variety, so that the detection method disclosed by the invention can be applied to variety identification and marker-assisted selection breeding of common cattle and tumor cattle, an excellent cattle genetic resource group is quickly established, and the breeding cost is reduced.
Owner:SHIHEZI UNIVERSITY

Specific gene structure variation combination remarkably related to thousand seed weight of brassica napus, primer and application of specific gene structure variation combination

The invention provides a specific gene structure variation combination remarkably related to the thousand seed weight of brassica napus, a primer and application of the specific gene structure variation combination and the primer, and belongs to the technical field of plant molecular breeding. The specific gene structure variation combination comprises DEL00005089 gene structure variation, INS00023318 gene structure variation and / or INS00099306 gene structure variation; the nucleotide sequence of the DEL00005089 gene structure variation, the nucleotide sequence of the INS00023318 gene structure variation and the nucleotide sequence of the INS00099306 gene structure variation are respectively as shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3. As a novel molecular marker combination, the specific gene structure variation combination provided by the invention can more comprehensively and accurately analyze the thousand seed weight genetic basis and promote the efficiency and accuracy of high-yield breeding of brassica napus.
Owner:ZHEJIANG UNIV +1

Structural variation markers in apple (malus domestica) resistance breeding and their applications

The application discloses a structural variation marker in apple scab resistance breeding and application thereof. The application claims the application of a specific fragment as a molecular marker in detection or assisted detection of apple plant resistance to scab; the nucleotide sequence of the specific fragment is as shown in SEQ ID No. 1 or positions 393-1166 of SEQ ID No. 1. Experiments prove that the absence and presence of the SCAB-R fragment (SEQ ID No. 1) can be used to quickly screen the scab resistance potential of natural plants or hybrid offspring, which is of great significance to the scab resistance breeding of apple plants.
Owner:CHINA AGRI UNIV

An enhancer sv molecular marker for regulating sheep body size, a detection method thereof and breeding application

PendingCN122629214AInsertion sequenceLuciferases
The application discloses an enhancer SV molecular marker for regulating sheep body size, a detection method thereof and breeding application. F ST The selection signal analysis is combined with gene and site annotation to screen out a key SV site molecular marker affecting the body size. The marker is located at 77414842 bp of an IGFBP3 gene on a sheep chromosome 4, and is a 51 bp insertion variation. Sheep individuals carrying the insertion sequence are small in body size, and sheep individuals not carrying the insertion sequence are large in body size. The application adopts a double luciferase reporter system to detect and verify the functional effect of the variation, and the result shows that the luciferase activity of a recombinant vector containing the insertion fragment is significantly higher than that of an empty control, and the relative expression amount is 2.4, which indicates that the insertion variation has a regulating influence on the sheep body size by significantly enhancing the transcription activity of the IGFBP3 gene. The molecular marker can be applied to early body size selection of sheep, and can accelerate the breeding process of meat sheep.
Owner:LANZHOU UNIV