44 results about "Large white" patented technology

The invention belongs to the technical field of animal genetic breeding, and provides an application of an SNP molecular marker related to a pig backfat thickness character. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 7, wherein the polymorphism of the eleventh basic group is C / T. The key gene SLC26A3 related to the backfat thickness of the large white pig is identified through whole genome deep sequencing, the genotype of the backfat thickness character of the large white pig is further detected through an SLC26A3 gene molecular marker, and the backfat thickness of the CC genotype large white pig is obviously higher than that of a CT / TT genotype pig. Therefore, the breeding of the CT / TT genotype individuals is beneficial to meeting the continuous demand of large-scale production on high-efficiency utilization of feed energy. The detection method provided by the invention is simple and easy to operate, can efficiently and quickly identify the back fat thickness character of the large white pig, improves the uniformity of the back fat thickness of the pig, and provides a scientific basis for early breeding of the pig.

The invention discloses a CHRM3 gene InDel molecular marker associated with growth and reproduction traits of a large white pig and application of the CHRM3 gene InDel molecular marker, a 62bp deletion variation is identified in a second intron of the CHRM3 gene, and a breakpoint is positioned in a second intron 521426525142713bp (a pig chromosome 14 reference sequence NC010456.5) of ENSSSCT00000082112.1. The application for detecting / identifying the growth and reproduction traits of the large white pigs is developed on the basis of the molecular marker, and the detection method is simple, rapid and low in cost and can be used for accurately screening individuals with better traits such as backfat thickness, primary birth litter weight, total multiparous litter size and gestation period of multiparous sows in the early stage, so that genetic improvement is carried out on the growth and reproduction traits of the pigs, and the economic benefit is increased. Multiple characters such as growth and reproduction can be selected at the same time, the breeding period of excellent boars can be shortened, and the breeding efficiency and progress are accelerated.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the back fat thickness character of a large white pig and application of the SNP molecular marker. The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. DNA (deoxyribonucleic acid) samples of 5253 large white pigs are collected, a pig 80K SNP (single nucleotide polymorphism) high-density functional site chip is used for genetic typing, a molecular marker related to the back fat thickness character of the pigs is obtained by means of whole genome association analysis and screening, the registration number of the marker in an Ensepbl database is rs332090971, a polymorphic site is located at the 7932236th site of a chromosome 11, an A / C allele mutation exists, and the molecular marker is a molecular marker related to the back fat thickness character of the pigs. When the polymorphic site is C, the pig has a thinner back fat thickness character.

The present application relates to a method for identifying a sex antagonistic hotspot region on a pig autosomal chromosome and application thereof. The method provided by the present application comprises the following specific steps: constructing a hybrid population F0, F1, F2 three generations, genome sequencing and SNP identification, transmission tracking of genetic material in the hybrid population pedigree, and identifying a sex antagonistic hotspot region. The method of the present application identifies that the Chr3:121M window is a sex ratio directional regulation molecular marker that is beneficial to the generation of male offspring in the Large White / Mini pig genotype individual. According to the method of the present application, the pig population sex can be predicted and regulated, and by screening and optimal mating of the genotype of the parent before mating, a plurality of generations is obtained by continuous cross without introducing exogenous blood relationship, so that the maximum value of the proportion of the genotype beneficial to the male or female is achieved under the condition that all genotypes of each generation are retained at the population level, and then the dynamic regulation of the sex ratio of the offspring pig population is achieved.

The present invention discloses a SNP molecular marker related to the feed conversion rate of Large White pigs and its application, belonging to the technical field of molecular marker-assisted selection. The present invention discloses a SNP molecular marker related to the feed conversion rate of Large White pigs. The DNA samples of 5256 Large White pigs were genotyped using the Porcine 80K SNP high-density chip, and a SNP site significantly correlated with the feed conversion rate of pigs was finally screened out through genome-wide association analysis (GWAS). The site genomic version of the SNP molecular marker corresponds to position 263045504 on chromosome 1 of the Ensembl Sscrofa 11.1 reference genome. The polymorphic site is G or A. When the genotype of the site is G / G, the pig has a higher feed utilization rate.

The present invention belongs to the field of molecular biology technology and relates to a SNP marker of the FRMD4A gene associated with the teat number trait of Large White pigs, a detection method thereof, and an application thereof. The SNP marker is located on the nucleotide sequence of the FRMD4A gene on pig chromosome 10. The site of the SNP marker is the g.48019215 nucleotide site on pig chromosome 10 in the International Porcine Genome Version 11.1 reference sequence, and has a C / T polymorphism. The SNP marker is significantly associated with the teat number trait. The SNP marker provided by the present invention is associated with the teat number trait of pigs. By identifying the SNP marker, pig strains with a high teat number can be screened. The resulting high-fertility strains with a high teat number have important economic benefits and social value.

The invention belongs to the technical field of animal molecular breeding, and particularly relates to application of a haplotype molecular marker for improving the utilization efficiency of large white pig feed, and the haplotype molecular marker comprises a haplotype 1 and / or a haplotype 2; the haplotype 1 comprises 8 sites of SNP2-SNP9 in total, and the haplotype 2 comprises 26 sites of SNP10-SNP35 in total; the application refers to any one of the following steps: identifying the feed conversion rate of the large white pigs; the feed utilization rate of large white pig offspring is improved. The haplotype H002 individuals and the haplotype H004 individuals are individuals with low feed conversion rate in each LDblock haplotype module, and the haplotype H002 individuals and the haplotype H004 individuals are individuals with low feed conversion rate in each LDblock haplotype module. In the actual breeding process, H002 and H004 haplotype individuals are reserved, screening of individuals with high feed utilization efficiency and seed reserving are facilitated, the accuracy of early-stage seed selection of the feed utilization efficiency character of the large white pigs is improved, and good economic benefits and wide application prospects are achieved.

The application relates to a product of a SNP molecular marker related to the litter weight trait of Large White pigs, wherein the SNP molecular marker is an A>G base mutation at a nucleic acid site of 116767089 of chromosome 2 in the international pig genome Sscrofa 11.1 version, and the nucleotide sequence is shown as SEQ ID No. 1; the product at least comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3. The SNP molecular marker can be used for breeding, cultivation and evaluation of multi-species high-reproduction-performance sows.

The application belongs to the technical field of animal molecular breeding, and particularly relates to application of a SNP haplotype molecular marker related to average daily weight gain of Large White pigs, wherein the SNP haplotype molecular marker comprises 12 loci of SNP1-SNP12, when the combination of SNP1-SNP12 is TTGCCCCACAGT in turn, the average daily weight gain of the Large White pig is higher than that of the combination of TCATATTTTGGC; the application refers to any one of the following: identifying the average daily weight gain of the Large White pig; improving the average daily weight gain of offspring of the Large White pig. Based on the application, in the actual breeding process, the H001 (TTGCCCCACAGT) haplotype individual is reserved, which is beneficial to screening of the high average daily weight gain individual and breeding, and improves the accuracy of early selection of the average daily weight gain trait of the Large White pig, and has good economic benefits and wide application prospect.

The invention belongs to the technical field of molecular biology, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker of an HTR2A gene related to a pig backfat thickness character and application of the SNP molecular marker. The molecular marker is from the 20563279 basic group in a pig 11 # chromosome HTR2A gene. A large white pig is selected as a test material, whole genome DNA is extracted from pig blood, and primers are designed according to a pig genome sequence (NC010449.5) published by an NCBI database. And a C or T base substitution exists at the 316th site, so that polymorphism is caused. According to the present invention, the SNP site is subjected to typing, and the association analysis on the American line big white and the French line big white shows that the back fat thickness of the CC genotype individual is significantly thin compared with the back fat thickness of the other genotype individuals; the invention provides a new marker for pig molecular marker-assisted selection, and the new marker is applied to genetic improvement of pig backfat thickness to accelerate the breeding improvement process of high-quality pigs.

The invention belongs to the technical field of molecular marker-assisted breeding in modern livestock breeding, and relates to a pig backfat thickness character related LOC102164422 gene SNP (Single Nucleotide Polymorphism) molecular marker and application thereof. The molecular marker is from the 8736070th basic group in the LOC102164422 gene of the porcine 10 # chromosome. A or G base substitution exists at the 134 site, and polymorphism is caused. According to the present invention, the SNP site is subjected to typing, and the association analysis on the American line big white and the French line big white shows that the AA genotype individual has significantly thin backfat thickness compared to other genotype individuals; the invention provides a new marker for pig molecular marker-assisted selection, and the new marker is applied to genetic improvement of pig backfat thickness to accelerate the breeding improvement process of high-quality pigs.

The present application relates to a SNP marker primer pair related to the number of teats of pig chromosome 7 and its application. The SNP marker is located at the rs3470144376 nucleotide site of pig chromosome 7, the site of the SNP marker is the molecular marker of the rs3470144376 nucleotide site of the international pig genome 11.1 version reference sequence pig chromosome 7, and has G / A polymorphism, the SNP marker is extremely significantly related to the number of teats of large white pigs (P<0.01). A primer pair for detecting the SNP marker, the upstream primer is SEQ ID NO: 2, and the downstream primer is SEQ ID NO: 3. The SNP marker provided by the present application is extremely significantly related to the number of teats of large white pigs, and the genotype of the SNP marker is identified to screen large white pig strains with multiple teats. The establishment of the strain can improve the reproductive efficiency of large white pigs and produce more social and economic benefits.

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an InDel molecular marker for identifying the production performance of large white pigs and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is GTTGCTGTGGCTGTGTTGTAGGTCGAAGACATGGCTGGC, and the InDel molecular marker is located at the 261th base to the 306th base of the nucleotide sequence shown in SEQ ID NO.1; a pig individual containing the InDel molecular marker sequence has relatively better growth traits and / or breeding traits compared with a pig individual without the InDel molecular marker sequence. The InDel molecular marker provided by the invention provides an effective way for efficiently and accurately predicting or identifying the growth rate and the reproductive capacity of the large white pigs on the molecular level, early breeding of multiple traits can be simultaneously carried out aiming at the molecular marker site, and the breeding period of excellent boars is greatly shortened.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. DNA (deoxyribonucleic acid) samples of 5253 large white pigs are collected, a pig 80K SNP (single nucleotide polymorphism) high-density functional site chip is used for genetic typing, a molecular marker related to the back fat thickness character of the pigs is obtained through whole-genome association analysis and screening, the login number of the SNP molecular marker in an Ensepmbl database is rs701714758, a polymorphic site is located at the 97575068th site of a No.7 chromosome, an A / G allele mutation exists, and the SNP molecular marker is a molecular marker related to the back fat thickness character of the pigs. And when nucleotide mutates into G, the pig has a thinner back fat thickness character.

The application provides a SNP molecular marker related to pig teat number and backfat thickness and application thereof. The marker is obtained through whole genome association analysis of total teat number of large white pigs. The marker is from the 97377902th site of pig chromosome 7. Large white pigs are selected as test materials, whole genome DNA is extracted from pig blood, and primers are designed according to the pig genome sequence (NC_010449.5) published in the NCBI database. There is a base substitution of C or T at the 376th site, resulting in polymorphism. The SNP site is typed, and association analysis shows that, compared with other gene individuals, the TT genotype individuals have more total teat number, left and right teat number, and thinner backfat thickness. The application provides a new marker for pig molecular marker assisted selection, and the marker is applied to genetic improvement of pig teat number and backfat thickness, and the breeding improvement process of high-quality pigs is accelerated.

The application discloses a binary pig efficient breeding method based on hybridization advantage and application, relates to the technical field of livestock breeding, and comprises the following steps: acquiring phenotype data of pure line Landrace pigs, pure line Large White pigs and historical hybrid offspring, setting the weight of reproduction traits, growth traits and feed efficiency traits in combination with external environment parameters, and generating comprehensive heterosis evaluation indexes; performing high-density genotyping on candidate Landrace pigs and candidate Large White pigs, constructing a genetic effect prediction model based on the genotyping results and the phenotype data, predicting the hybridization effect of a pairing combination of Landrace pigs and Large White pigs by using the genetic effect prediction model, screening the pairing combination meeting the comprehensive heterosis evaluation indexes according to the hybridization effect, and implementing artificial insemination to obtain first-generation binary pigs; and performing whole life cycle performance determination on the first-generation binary pigs, and calculating the measured comprehensive heterosis evaluation indexes.

The invention relates to an SNP (Single Nucleotide Polymorphism) marker primer pair related to pig nipple number character and application thereof. The SNP marker is located on a nucleotide sequence of a PUM1 gene on a pig chromosome 6, a site of the SNP marker is a molecular marker of a nucleotide site rs326400175 of a pig chromosome 6 of a reference sequence of an international pig genome version 11.1, the SNP marker has G / C polymorphism, and the SNP marker is remarkably related to the number of papilla of a French large white pig (Plt: 0.01). According to a primer pair for detecting the SNP marker, an upstream primer is SEQ ID NO: 2, and a downstream primer is SEQ ID NO: 3. The SNP marker provided by the invention is remarkably related to the nipple number of the French large white pig, and the French large white pig strain with multiple nipples is screened by identifying the genotype of the SNP marker. By establishing the strain, the reproductive performance of the French large white pigs can be improved, and more social and economic benefits can be generated.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a large white pig backfat thickness character. DNA samples of 5 and 253 large white pigs are collected, a pig 80K SNP high-density functional site chip is used for genetic typing, a molecular marker related to the pig backfat thickness character is obtained through whole genome association analysis and screening, the SNP molecular marker is located at the 160773437 site of a first chromosome with the Ensepbl login number being rs81219178, the polymorphic site is located at the 160773437 site of the first chromosome, a G / A allele mutation exists, and the SNP molecular marker is located at the 160773437 site of the second chromosome. When the nucleotide is mutated into A, the large white pig has a thinner back fat thickness character.

The application relates to the fields of molecular biological technology and livestock breeding technology, in particular to a SNP molecular marker related to a total number of piglets character, a detection primer pair, a kit and application of the SNP molecular marker in a method for breeding large white pigs with high number of piglets, the SNP molecular marker is located on a pig 9th chromosome, a physical position is located at chr9:65633096 of a genome version Ensembl Sscrofa11.1, a polymorphism site is C or A, and the C allele is positively correlated with the high number of piglets character; through genotype discrimination, selection breeding can be carried out: an individual with a genotype of C / C is preferentially selected or reserved as a breeding pig, because the total number of piglets has the highest potential, so that the genetic improvement speed of a population breeding performance is accelerated.

The application relates to the technical field of pig breeding improvement, and particularly relates to a method for evaluating backfat of large white pigs based on a USP16 gene, determining SNP molecular markers of the large white pigs, and judging whether the SNP molecular markers are one of the following SNP molecular markers, specifically, a g.192401821G>A site located in an intron region of the USP16 gene, a g.192407026G>A site located in a downstream regulation region of the USP16 gene, a g.192407237A>G site located in the downstream regulation region of the USP16 gene, a g.192408287T>C site located in the downstream regulation region of the USP16 gene, and a g.192408499C>T site located in the downstream regulation region of the USP16 gene. The evaluation method and the SNP molecular markers used in the method provide good theoretical support and effective guidance for breeding and improvement of growth traits of pigs.

The present application relates to the fields of molecular biology technology and livestock breeding technology, and particularly to a large white pig low back fat selection method based on SNP marker rs340365542, the SNP molecular marker is located at the 10107037th nucleotide of the 3rd chromosome of pig genome version Ensembl Sscrofa11.1, and the polymorphism is T or G; application of the SNP molecular marker rs340365542 related to pig back fat thickness in the large white pig low back fat selection method, and particularly includes application in identifying or screening low back fat pig breeds and application in genetic improvement of pig breeds for reducing pig back fat thickness; the present application adopts a specific strain-large white pig core group, a specific low-depth sequencing strategy, a customized quality control process and a population structure control model to perform whole genome correlation analysis on the back fat thickness trait, and carries out targeted technical optimization for screening out sites with dominant and universal characteristics in large white pigs.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. The login number of the SNP molecular marker is rs336800275, DNA samples of 5253 large white pigs are collected, a pig 80K SNP high-density functional site chip is used for genetic typing, whole genome association analysis is utilized for screening to obtain the molecular marker related to the pig backfat thickness character, the polymorphic site of the marker is located at the 97618186 site of a No.7 chromosome, a C / T allele mutation exists, and the molecular marker related to the pig backfat thickness character is obtained. And when the polymorphic site is mutated into T, the pig has a thinner back fat thickness character.

This invention relates to the fields of molecular markers and animal genetic breeding technology, and particularly to a SNP marker that affects porcine inosine content and its application. Based on purebred American Landrace, purebred American Large White, and purebred American Duroc pigs, this invention studies and identifies 10 SNP molecular markers closely related to porcine inosine content. By optimizing the dominant alleles of these SNPs, the frequency of dominant alleles can be increased generation by generation, reducing inosine content, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of pig breeding.

The invention discloses an EIF4E-SV288 molecular marker for distinguishing a fragrant pig from a large white pig and a detection technology of the molecular marker, and belongs to the field of livestock molecular biology detection. The molecular marker SV288 is located in a pig reference genome Sscrofa 11.1 chr8: 121455580-121455867, the length of the molecular marker SV288 is 288bp, and the molecular marker SV288 is contained in a fourth intron of an EIF4E gene, has two types of a deletion type (allele D) and a non-deletion type (allele I), and corresponds to three genotypes of DD, ID and II. The invention also provides a primer for specifically detecting the molecular marker, a PCR detection method and an application method for distinguishing the fragrant pig from the large white pig. The detection result shows that the fragrant pig only contains the DD genotype, and the frequency of the D allele is 100%; large white pigs are mainly composed of II and ID genotypes, the frequency of D allele is 30.93%, and the difference between II and ID genotypes is very significant (Plt; the molecular marker is not limited by age, gender and feeding conditions of pigs, the detection method is accurate and reliable, the operation is simple and convenient, and variety distinguishing of fragrant pigs and large white pigs can be efficiently realized.

The invention belongs to the technical field of animal genetic breeding, and provides application of an SNP molecular marker associated with a pig backfat thickness character. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 7, wherein the polymorphism of the 88th basic group is T / C. The method comprises the following steps: performing deep sequencing on individual genomes with different backfat thicknesses of large white pigs, and finding that mononucleotide mutation Tgt exists at the 88th basic group of the 15th exon of the GLB1 gene; and C, inter-group difference exists. According to the present invention, the pig population is further expanded, the genome DNA is subjected to PCR amplification sequencing, the mutation site typing is performed, the correlation analysis with the corrected 100 kg backfat thickness of the large white pig is performed, and the correlation with the pig backfat thickness is determined, such that the reference data can be provided for the molecular marker-assisted breeding of the large white pig, and the continuous requirement of the large-scale production on the efficient feed energy utilization can be easily met.

The application belongs to the technical field of animal molecular breeding, and particularly relates to application of a SNP haplotype molecular marker related to feed conversion efficiency of large white pigs, wherein the SNP haplotype molecular marker comprises at least one of haplotype H002, haplotype H005, haplotype H007, haplotype H010 and haplotype H012. The application accurately identifies the haplotype related to the feed utilization efficiency of large white pigs in local breeding through GWAS screening and identification, haplotype association analysis and other means, enriches the number of genetic markers related to the feed utilization efficiency of large white pigs, and lays an important foundation for carrying out local molecular breeding and genome selection of large white pigs in China.

The application discloses a molecular marker related to daily weight gain of large white pigs in a fattening period and application thereof, relates to the technical field of biology, and corresponds to a SNP site at position 270461314 on a chromosome 1 in a pig reference genome Sus_scrofa.Sscrofa11.1, the site corresponding to a nucleotide at position 87 in a sequence of SEQ ID NO:1, and the nucleotide type being A or G. The molecular marker related to daily weight gain of large white pigs in a fattening period and application thereof discover that the A / G site at position 270461314 on a chromosome 1 in a pig reference genome Sus_scrofa.Sscrofa11.1 has a significant influence on daily weight gain of large white pigs in a fattening period; a method for identifying or assisting in identifying daily weight gain of large white pigs in a fattening period is provided based on the SNP site; and a new molecular breeding marker is provided for marker-assisted breeding of daily weight gain of large white pigs in a fattening period.

1. Name of the product in this design: Teether (Big White Goose). 2. Purpose of this design: for soothing, teething, and playing with infants and young children. 3. The key design feature of this product is its shape. 4. The image or photograph that best illustrates the design's key points: 3D view 1.

The invention discloses a TJAP1 gene molecular marker related to growth traits of large white pigs and application of the TJAP1 gene molecular marker, and belongs to the technical field of molecular genetics. According to the invention, a mutation site g.38501283 (Ggt; C) in a 3'regulation region of a TJAP1 gene is preliminarily screened from a large white pig population, wherein the mutation site g.38501283 (Ggt; C) is obviously associated with the backfat thickness of a pig with the weight of 100 kg and the day age of the pig with the weight of 100 kg. Based on the mutation site g.38501283 (Ggt; C), a TJAP1 gene molecular marker and a detection primer pair related to the growth traits of the large white pigs are designed, pig individuals with excellent growth performance such as low backfat thickness, 100 kg weight, short day age and the like can be efficiently screened out, and technical support is provided for rapid breeding of good varieties of the large white pigs.

The present invention belongs to the field of molecular biology technology, and discloses a molecular marker of the PPIL4 gene related to the residual feed intake trait of Large White pigs, and a detection method and application thereof. The SNP marker is located on the nucleotide sequence of the peptidyl proline isomerase-like protein-4 gene (PPIL4) on pig chromosome 1, and the site is the g.16442886 nucleotide site on pig chromosome 1 of the international pig genome version 11.1 reference sequence, and has a C / T polymorphism. The SNP marker is significantly correlated with the residual feed intake trait of Large White pigs. The SNP marker provided by the present invention is related to the residual feed intake trait of pigs, and pig strains with low residual feed intake can be screened by identifying the SNP marker. The resulting pig strains with low feed-to-meat ratio and high growth rate have important economic benefits and social value.