Method for identifying pig backfat thickness based on rs80995809 locus genotyping and its application
A genotype and backfat technology used in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1. A method for identifying live pig backfat thickness based on the rs80995809 locus
[0056] 1. Screening of rs80995809 site
[0057] 1. Extraction of DNA from pig ear tissue samples
[0058] Genomic DNA was extracted from ear tissue samples of 1758 Large White pigs from Sichuan Tianzhao Pig Industry Co., Ltd. and Chifengjia Breeding Pig Ecological Technology Group Co., Ltd. respectively.
[0059] 2. Amplification of the target fragment
[0060] (1) PCR amplification
[0061] Using the genomic DNA obtained in step 1 as a template, PCR amplification was performed using primers F1 and R1, respectively, to obtain PCR amplification products. The primer sequences are as follows:
[0062] F1: CCTGTTGTGGTGCAGTGAAG (sequence 2);
[0063] R1: GTGAGGCCAGGGATCAAACC (SEQ ID NO: 3).
[0064] (2) Recovery, purification and sequencing of PCR products
[0065] The agarose gel purification and recovery kit is used to recover and purify the PCR amplification product to ob...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap