46 results about "Large white pig" patented technology

The invention belongs to the technical field of animal genetic breeding, and provides an application of an SNP molecular marker related to a pig backfat thickness character. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 7, wherein the polymorphism of the eleventh basic group is C / T. The key gene SLC26A3 related to the backfat thickness of the large white pig is identified through whole genome deep sequencing, the genotype of the backfat thickness character of the large white pig is further detected through an SLC26A3 gene molecular marker, and the backfat thickness of the CC genotype large white pig is obviously higher than that of a CT / TT genotype pig. Therefore, the breeding of the CT / TT genotype individuals is beneficial to meeting the continuous demand of large-scale production on high-efficiency utilization of feed energy. The detection method provided by the invention is simple and easy to operate, can efficiently and quickly identify the back fat thickness character of the large white pig, improves the uniformity of the back fat thickness of the pig, and provides a scientific basis for early breeding of the pig.

The invention belongs to the technical field of molecular biology, particularly relates to a pig chromosome 3 TMC7 gene as a meat-producing character molecular breeding marker and application, and aims to provide a new marker and technical support for meat-producing character molecular breeding of pigs. The molecular marker is located at the 26346502 base in a pig chromosome 3 TMC7 gene, and allele G / T polymorphism exists at the site. A correlation analysis result shows that in American and French large white pig populations, the eye muscle area of a GG genotype individual is remarkably higher than that of other genotype individuals (plt; 0.05), and it is indicated that the genotype is a favorable genotype of the eye muscle area character. The SNP marker provided by the invention provides a new molecular tool for genetic breeding of pig eye muscle area characters, and can be used for auxiliary screening of breeding pigs with excellent meat production performance, so that the breeding process of pig breeds with high lean meat percentage is accelerated.

The invention discloses a CHRM3 gene InDel molecular marker associated with growth and reproduction traits of a large white pig and application of the CHRM3 gene InDel molecular marker, a 62bp deletion variation is identified in a second intron of the CHRM3 gene, and a breakpoint is positioned in a second intron 521426525142713bp (a pig chromosome 14 reference sequence NC010456.5) of ENSSSCT00000082112.1. The application for detecting / identifying the growth and reproduction traits of the large white pigs is developed on the basis of the molecular marker, and the detection method is simple, rapid and low in cost and can be used for accurately screening individuals with better traits such as backfat thickness, primary birth litter weight, total multiparous litter size and gestation period of multiparous sows in the early stage, so that genetic improvement is carried out on the growth and reproduction traits of the pigs, and the economic benefit is increased. Multiple characters such as growth and reproduction can be selected at the same time, the breeding period of excellent boars can be shortened, and the breeding efficiency and progress are accelerated.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the back fat thickness character of a large white pig and application of the SNP molecular marker. The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. DNA (deoxyribonucleic acid) samples of 5253 large white pigs are collected, a pig 80K SNP (single nucleotide polymorphism) high-density functional site chip is used for genetic typing, a molecular marker related to the back fat thickness character of the pigs is obtained by means of whole genome association analysis and screening, the registration number of the marker in an Ensepbl database is rs332090971, a polymorphic site is located at the 7932236th site of a chromosome 11, an A / C allele mutation exists, and the molecular marker is a molecular marker related to the back fat thickness character of the pigs. When the polymorphic site is C, the pig has a thinner back fat thickness character.

The invention provides an SNP (Single Nucleotide Polymorphism) marker primer pair related to pig multirib traits and application of the SNP marker primer pair. The SNP site is a nucleotide site of chromosome 7 rs701714758 of a reference sequence of an international pig genome version 11.1, has G / A polymorphism, is located in a protein coding region of an ABCD4 gene, and is remarkably associated with rib number characters of Duroc pigs, landrace pigs, large white pigs and Pietrain pigs through verification of whole genome association analysis and meta analysis. The invention further provides a primer pair for detecting the SNP marker, an upstream primer of the primer pair is SEQ ID NO: 2, and a downstream primer of the primer pair is SEQ ID NO: 3. The SNP marker can be applied to marker-assisted selection and whole genome selection of rib number characters of multiple varieties of pigs, can accurately screen a multi-rib number pig group, improves character prediction accuracy, increases pork and rib row yield, meets consumption demands, and has both social and economic benefits.

The invention belongs to the technical field of animal molecular breeding, and particularly relates to application of a haplotype molecular marker for improving the utilization efficiency of large white pig feed, and the haplotype molecular marker comprises a haplotype 1 and / or a haplotype 2; the haplotype 1 comprises 8 sites of SNP2-SNP9 in total, and the haplotype 2 comprises 26 sites of SNP10-SNP35 in total; the application refers to any one of the following steps: identifying the feed conversion rate of the large white pigs; the feed utilization rate of large white pig offspring is improved. The haplotype H002 individuals and the haplotype H004 individuals are individuals with low feed conversion rate in each LDblock haplotype module, and the haplotype H002 individuals and the haplotype H004 individuals are individuals with low feed conversion rate in each LDblock haplotype module. In the actual breeding process, H002 and H004 haplotype individuals are reserved, screening of individuals with high feed utilization efficiency and seed reserving are facilitated, the accuracy of early-stage seed selection of the feed utilization efficiency character of the large white pigs is improved, and good economic benefits and wide application prospects are achieved.

The application relates to a product of a SNP molecular marker related to the litter weight trait of Large White pigs, wherein the SNP molecular marker is an A>G base mutation at a nucleic acid site of 116767089 of chromosome 2 in the international pig genome Sscrofa 11.1 version, and the nucleotide sequence is shown as SEQ ID No. 1; the product at least comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3. The SNP molecular marker can be used for breeding, cultivation and evaluation of multi-species high-reproduction-performance sows.

The application belongs to the technical field of animal molecular breeding, and particularly relates to application of a SNP haplotype molecular marker related to average daily weight gain of Large White pigs, wherein the SNP haplotype molecular marker comprises 12 loci of SNP1-SNP12, when the combination of SNP1-SNP12 is TTGCCCCACAGT in turn, the average daily weight gain of the Large White pig is higher than that of the combination of TCATATTTTGGC; the application refers to any one of the following: identifying the average daily weight gain of the Large White pig; improving the average daily weight gain of offspring of the Large White pig. Based on the application, in the actual breeding process, the H001 (TTGCCCCACAGT) haplotype individual is reserved, which is beneficial to screening of the high average daily weight gain individual and breeding, and improves the accuracy of early selection of the average daily weight gain trait of the Large White pig, and has good economic benefits and wide application prospect.

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an InDel molecular marker for identifying the production performance of large white pigs and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is GTTGCTGTGGCTGTGTTGTAGGTCGAAGACATGGCTGGC, and the InDel molecular marker is located at the 261th base to the 306th base of the nucleotide sequence shown in SEQ ID NO.1; a pig individual containing the InDel molecular marker sequence has relatively better growth traits and / or breeding traits compared with a pig individual without the InDel molecular marker sequence. The InDel molecular marker provided by the invention provides an effective way for efficiently and accurately predicting or identifying the growth rate and the reproductive capacity of the large white pigs on the molecular level, early breeding of multiple traits can be simultaneously carried out aiming at the molecular marker site, and the breeding period of excellent boars is greatly shortened.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. DNA (deoxyribonucleic acid) samples of 5253 large white pigs are collected, a pig 80K SNP (single nucleotide polymorphism) high-density functional site chip is used for genetic typing, a molecular marker related to the back fat thickness character of the pigs is obtained through whole-genome association analysis and screening, the login number of the SNP molecular marker in an Ensepmbl database is rs701714758, a polymorphic site is located at the 97575068th site of a No.7 chromosome, an A / G allele mutation exists, and the SNP molecular marker is a molecular marker related to the back fat thickness character of the pigs. And when nucleotide mutates into G, the pig has a thinner back fat thickness character.

The application discloses a SNP molecular marker of a site rs338618851 related to pork production efficiency of pigs and application. The genetic marker is cloned from a 93991071 site of a chromosome 6 of pigs. American Landrace pigs are selected as test materials, whole genome DNA is extracted from blood of the pigs, and a primer is designed according to a pig genome sequence NC_010448.4 published in an NCBI database. A base substitution of T or C exists at a 172th position of a primer amplification sequence, the substitution causes polymorphism at the position. The SNP site is typed through a direct sequencing technology, and correlation analysis shows that, compared with other gene individuals, a TT genotype individual at the 172th position is large in birth weight, large in eye muscle area and short in time to reach 100 kg at a certain age. The application provides a new marker for molecular breeding of pork production traits of pigs.

The application provides a SNP molecular marker related to pig teat number and backfat thickness and application thereof. The marker is obtained through whole genome association analysis of total teat number of large white pigs. The marker is from the 97377902th site of pig chromosome 7. Large white pigs are selected as test materials, whole genome DNA is extracted from pig blood, and primers are designed according to the pig genome sequence (NC_010449.5) published in the NCBI database. There is a base substitution of C or T at the 376th site, resulting in polymorphism. The SNP site is typed, and association analysis shows that, compared with other gene individuals, the TT genotype individuals have more total teat number, left and right teat number, and thinner backfat thickness. The application provides a new marker for pig molecular marker assisted selection, and the marker is applied to genetic improvement of pig teat number and backfat thickness, and the breeding improvement process of high-quality pigs is accelerated.

The invention belongs to the field of molecular biotechnology and livestock breeding, and discloses an rs323970378 site SNP molecular marker related to pig birth litter weight and application of the rs323970378 site SNP molecular marker. According to the invention, DNA samples of 617 large white pigs are subjected to genetic typing by using a low-depth (1 *) whole genome re-sequencing technology, and an SNP site significantly related to the litter weight character of the pigs is finally screened out through GWAS (whole genome association analysis). The SNP molecular marker is located at the 26902856th nucleotide of a chromosome 14 in an Ensembl Sscrofa11.1 reference genome version, and Cgt exists in the SNP molecular marker; g is subjected to base mutation. A research result shows that when the genotype of the locus is C / C, the birth litter weight of a large white pig individual is the highest. The invention provides a new marker for genetic improvement and molecular marker-assisted breeding in the aspect of pig birth litter weight traits.

The invention provides a gene influencing sexual precocity of deep-county pigs and a screening method thereof, and belongs to the field of research on sexual maturity of pigs, the gene influencing sexual precocity of deep-county pigs comprises an SRD5A1 gene and / or a CYP11B2 gene, testicular tissues of deep-county pigs before and after sexual maturity are subjected to transcriptome sequencing, differential expression gene functions are analyzed, and the sexual precocity of deep-county pigs before and after sexual maturity is obtained. And screening out candidate genes related to the sexual maturity of the deep county pigs. And then performing transcriptome sequencing on testis tissues of the sexually mature deep county pig and the hybrid pig of the sexually mature deep county pig and the large white pig, analyzing functions of differential expression genes, and screening specific expression genes of the sexual maturity of the deep county pig. Integrating the results of the two times of transcriptome sequencing, analyzing the functions of the coincident genes, and screening candidate genes SRD5A1 and CYP11B2 which influence the sexual precocity of the pigs in the deep county according to the gene functions; and a foundation is laid for subsequent research on precocious puberty of pigs in deep county.

The application discloses a binary pig efficient breeding method based on hybridization advantage and application, relates to the technical field of livestock breeding, and comprises the following steps: acquiring phenotype data of pure line Landrace pigs, pure line Large White pigs and historical hybrid offspring, setting the weight of reproduction traits, growth traits and feed efficiency traits in combination with external environment parameters, and generating comprehensive heterosis evaluation indexes; performing high-density genotyping on candidate Landrace pigs and candidate Large White pigs, constructing a genetic effect prediction model based on the genotyping results and the phenotype data, predicting the hybridization effect of a pairing combination of Landrace pigs and Large White pigs by using the genetic effect prediction model, screening the pairing combination meeting the comprehensive heterosis evaluation indexes according to the hybridization effect, and implementing artificial insemination to obtain first-generation binary pigs; and performing whole life cycle performance determination on the first-generation binary pigs, and calculating the measured comprehensive heterosis evaluation indexes.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a large white pig backfat thickness character. DNA samples of 5 and 253 large white pigs are collected, a pig 80K SNP high-density functional site chip is used for genetic typing, a molecular marker related to the pig backfat thickness character is obtained through whole genome association analysis and screening, the SNP molecular marker is located at the 160773437 site of a first chromosome with the Ensepbl login number being rs81219178, the polymorphic site is located at the 160773437 site of the first chromosome, a G / A allele mutation exists, and the SNP molecular marker is located at the 160773437 site of the second chromosome. When the nucleotide is mutated into A, the large white pig has a thinner back fat thickness character.

The application relates to the fields of molecular biological technology and livestock breeding technology, in particular to a SNP molecular marker related to a total number of piglets character, a detection primer pair, a kit and application of the SNP molecular marker in a method for breeding large white pigs with high number of piglets, the SNP molecular marker is located on a pig 9th chromosome, a physical position is located at chr9:65633096 of a genome version Ensembl Sscrofa11.1, a polymorphism site is C or A, and the C allele is positively correlated with the high number of piglets character; through genotype discrimination, selection breeding can be carried out: an individual with a genotype of C / C is preferentially selected or reserved as a breeding pig, because the total number of piglets has the highest potential, so that the genetic improvement speed of a population breeding performance is accelerated.

The application relates to the technical field of pig breeding improvement, and particularly relates to a method for evaluating backfat of large white pigs based on a USP16 gene, determining SNP molecular markers of the large white pigs, and judging whether the SNP molecular markers are one of the following SNP molecular markers, specifically, a g.192401821G>A site located in an intron region of the USP16 gene, a g.192407026G>A site located in a downstream regulation region of the USP16 gene, a g.192407237A>G site located in the downstream regulation region of the USP16 gene, a g.192408287T>C site located in the downstream regulation region of the USP16 gene, and a g.192408499C>T site located in the downstream regulation region of the USP16 gene. The evaluation method and the SNP molecular markers used in the method provide good theoretical support and effective guidance for breeding and improvement of growth traits of pigs.

The present application relates to the fields of molecular biology technology and livestock breeding technology, and particularly to a large white pig low back fat selection method based on SNP marker rs340365542, the SNP molecular marker is located at the 10107037th nucleotide of the 3rd chromosome of pig genome version Ensembl Sscrofa11.1, and the polymorphism is T or G; application of the SNP molecular marker rs340365542 related to pig back fat thickness in the large white pig low back fat selection method, and particularly includes application in identifying or screening low back fat pig breeds and application in genetic improvement of pig breeds for reducing pig back fat thickness; the present application adopts a specific strain-large white pig core group, a specific low-depth sequencing strategy, a customized quality control process and a population structure control model to perform whole genome correlation analysis on the back fat thickness trait, and carries out targeted technical optimization for screening out sites with dominant and universal characteristics in large white pigs.

The application belongs to the technical field of molecular genetics, and provides a SNP molecular marker related to pig backfat thickness and application thereof. The application studies and determines that the pig backfat thickness related molecular marker is located at the 9558333th site of chromosome 18 in the international pig reference genome 11.1 version (corresponding to the 701th base A / G mutation of SEQ ID NO:1), and verifies the influence effect on the pig backfat thickness. When the base of the site is A, the pig has lower backfat thickness. Based on this, the application establishes a molecular marker assisted selection breeding technology for rapidly improving the pig backfat thickness, and the frequency of the advantageous allele (A) can be increased generation by generation, the backfat thickness of the breeding pig is significantly reduced, the genetic improvement process of the commercial pig population containing the bloodline of the Landrace pig and the Large White pig is accelerated, the breeding efficiency is improved, the sales profit of the enterprise is increased, the core competitiveness is improved, and the economic benefit of the commercial pig is improved.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. The login number of the SNP molecular marker is rs336800275, DNA samples of 5253 large white pigs are collected, a pig 80K SNP high-density functional site chip is used for genetic typing, whole genome association analysis is utilized for screening to obtain the molecular marker related to the pig backfat thickness character, the polymorphic site of the marker is located at the 97618186 site of a No.7 chromosome, a C / T allele mutation exists, and the molecular marker related to the pig backfat thickness character is obtained. And when the polymorphic site is mutated into T, the pig has a thinner back fat thickness character.

The invention discloses an EIF4E-SV288 molecular marker for distinguishing a fragrant pig from a large white pig and a detection technology of the molecular marker, and belongs to the field of livestock molecular biology detection. The molecular marker SV288 is located in a pig reference genome Sscrofa 11.1 chr8: 121455580-121455867, the length of the molecular marker SV288 is 288bp, and the molecular marker SV288 is contained in a fourth intron of an EIF4E gene, has two types of a deletion type (allele D) and a non-deletion type (allele I), and corresponds to three genotypes of DD, ID and II. The invention also provides a primer for specifically detecting the molecular marker, a PCR detection method and an application method for distinguishing the fragrant pig from the large white pig. The detection result shows that the fragrant pig only contains the DD genotype, and the frequency of the D allele is 100%; large white pigs are mainly composed of II and ID genotypes, the frequency of D allele is 30.93%, and the difference between II and ID genotypes is very significant (Plt; the molecular marker is not limited by age, gender and feeding conditions of pigs, the detection method is accurate and reliable, the operation is simple and convenient, and variety distinguishing of fragrant pigs and large white pigs can be efficiently realized.

The application discloses a SNP molecular marker related to a middle and rear section body length of a pig, a primer pair and application thereof, the SNP molecular marker is located at a rs80965549 nucleotide site of a chromosome 17 of a large white pig and has A / G polymorphism. The primer pair for detecting the SNP marker has an upstream primer sequence as shown in SEQ ID NO:2 and a downstream primer sequence as shown in SEQ ID NO:3. By determining the rs80965549 site genotype of the large white pig, AG or GG individuals are selected for breeding, and the evaluation accuracy of the middle and rear section body length can be improved in an early stage.

The present application belongs to the field of molecular biological technology and molecular marker technology, and relates to a SNP molecular marker related to pork yield efficiency of pigs and application thereof, which is from the 93707553th site of chromosome 15 of pigs. Large white pigs and long white pigs are selected as test materials, whole genome DNA is extracted from blood of the pigs, and primers are designed according to the pig genome sequence (NC_010457.5) published by NCBI database. There is a base substitution of A or G at the 306th site, resulting in polymorphism. The SNP site is typed, and correlation analysis shows that, compared with other gene individuals, the AA genotype individuals have the traits of thin backfat in vivo, large eye muscle area and the like. The present application provides a new marker for pig molecular marker assisted selection, and the marker is applied to genetic improvement of pork yield efficiency of pigs, so that the breeding improvement process of high-quality pigs is accelerated.

The invention belongs to the technical field of animal genetic breeding, and provides application of an SNP molecular marker associated with a pig backfat thickness character. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 7, wherein the polymorphism of the 88th basic group is T / C. The method comprises the following steps: performing deep sequencing on individual genomes with different backfat thicknesses of large white pigs, and finding that mononucleotide mutation Tgt exists at the 88th basic group of the 15th exon of the GLB1 gene; and C, inter-group difference exists. According to the present invention, the pig population is further expanded, the genome DNA is subjected to PCR amplification sequencing, the mutation site typing is performed, the correlation analysis with the corrected 100 kg backfat thickness of the large white pig is performed, and the correlation with the pig backfat thickness is determined, such that the reference data can be provided for the molecular marker-assisted breeding of the large white pig, and the continuous requirement of the large-scale production on the efficient feed energy utilization can be easily met.

The invention provides a large white pig whole genome low-density 5k liquid phase chip and application thereof, the 5k liquid phase chip comprises 6511 molecular markers, the 6511 molecular markers are composed of 6496 SNP sites, 14 indels and 1 segment, and chromosome positions and numbers of the molecular markers on a pig reference genome suScr11.1 are shown in a specification table 1. The detection rate of the liquid phase chip ranges from 98.879% to 99.908%, and the average detection rate of the liquid phase chip is 99.761%. It is shown that the large white pig whole genome low-density 5k liquid phase chip also has high precision, can be applied to the aspects of large white pig genetic typing detection, whole genome selective breeding, gene clustering analysis, molecular marker-assisted selection, genetic relationship and pedigree reconstruction and the like, and can also reduce the use cost.

The invention provides a large white pig skeletal muscle fiber space transcriptional map and an acquisition method thereof, and the space transcriptional map shows that the proportions of STI type and STII type muscle fibers in lumbar major muscles are respectively about 34% and 66%, the proportions of STI type and STII type muscle fibers in semi-membrane muscles are respectively about 11% and 89%, the proportions of STI type and STII type muscle fibers in flatfish muscles are respectively about 14% and 66%, and the proportions of STI type and STII type muscle fibers in flatfish muscles are respectively about 14% and 66%. The proportions of STI-type muscle fibers and STII-type muscle fibers in gastrocnemius muscle are respectively about 27% and 73%, and two subtypes of STII-type muscle fibers of four skeletal muscles are different. The spatial distribution of I-type, IIA-type and IIB-type muscle fibers of four skeletal muscle tissues of a large white pig is displayed, functional difference of I-type, IIA-type and IIB-type muscle fiber genes is proved, and detailed skeletal muscle fiber heterogeneity data support is provided for pig variety improvement.

The invention belongs to the technical field of gene detection, and relates to a detection method of nucleic acid, in particular to a pig breed identification method based on a liquid chip technology and application of the pig breed identification method. According to the invention, a specific SNP marker combination aiming at 73 pig varieties is established for the first time, the specific SNP marker combination is used for constructing a liquid phase chip for pig variety identification, and targeted capture and high-throughput sequencing are combined, so that the distinguishing accuracy of 95% or more among the 73 pig varieties is successfully realized. The method disclosed by the invention has the advantages of wide variety types, high cost performance, high accuracy and short detection period, and can be used for identifying the variety of landrace, large white pig, duroc, 28 wild boars and 42 domestic pigs.

The application belongs to the technical field of animal molecular breeding, and particularly relates to application of a SNP haplotype molecular marker related to feed conversion efficiency of large white pigs, wherein the SNP haplotype molecular marker comprises at least one of haplotype H002, haplotype H005, haplotype H007, haplotype H010 and haplotype H012. The application accurately identifies the haplotype related to the feed utilization efficiency of large white pigs in local breeding through GWAS screening and identification, haplotype association analysis and other means, enriches the number of genetic markers related to the feed utilization efficiency of large white pigs, and lays an important foundation for carrying out local molecular breeding and genome selection of large white pigs in China.

The invention discloses a disease-resistant cell strain, a section of amino acid sequence of M130 protein expressed in the cell strain is deleted to generate a new M130p.Ser1028Gly1041del protein type, the amino acid sequence of the M130p.Ser1028Gly1041del protein type is as shown in SEQ ID No: 28, and the cell strain has the capability of resisting PRRSV (Porcine Reproductive and Respiratory Syndrome Virus). The cell nucleus of the cell strain can be used as a donor to produce a disease-resistant cloned pig, and complete resistance to the current PRRSV epidemic strain is obtained. Through molecular design and a new editing method, natural mutation of animal endogenous genes is modified under the condition that the M130 endogenous protein space structure and the biological function are not affected, and the generated gene editing pig is better in health degree, high in cloning efficiency and higher in biological safety, and can be used for preparing the M130 endogenous protein. The method provided by the invention can be applied to the creation of novel materials for resisting the porcine reproductive and respiratory syndrome, such as large white pigs, landrace pigs, duroc pigs, Berkshire pigs, Hanpshire pigs and Pietrain pigs of different strains, and local pigs in China, and lays a foundation for breeding and popularization of porcine reproductive and respiratory syndrome resisting varieties.