70 results about "Large white pig" patented technology

The invention relates to the technical field of molecular markers and animal genetic breeding, in particular to an SNP marker influencing the content of porcine inosine and application of the SNP marker. The 10 SNP molecular markers closely related to the porcine inosine content are researched and determined on the basis of American-series purebred landrace, American-series purebred large white pigs and American-series purebred duroc, the dominant allele frequency can be increased generation by generation by optimizing the dominant allele of the SNP, the inosine content can be reduced, and the molecular markers can be used for identifying the porcine inosine content. The pig genetic improvement progress is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.

The invention relates to the technical field of molecular markers and animal genetic breeding, in particular to an SNP marker influencing pig UMP content and application thereof. Whole genome re-sequencing and GWAS analysis are adopted, American-series purebred landrace pigs, American-series purebred large white pigs and American-series purebred duroc are used as research objects, seven SNP markers related to the pig UMP content are researched and determined, by optimizing dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the UMP content can be increased, and the pig UMP content can be improved. The pig genetic improvement progress is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker associated with a pig backfat thickness character and application. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1; one SNP molecular marker site A / G is arranged at the 254bp position of the sequence of the SNP molecular marker. Genetic typing is carried out by utilizing a gene chip technology, whole genome association analysis is carried out in combination with the character of correcting the 100 kg backfat thickness of a large white pig, one SNP molecular marker remarkably related to the character is screened out, and a new marker resource is provided for molecular breeding of the growth character of the breeding pig.

The invention is suitable for the technical field of molecular genetics, and provides an SNP molecular marker related to pig backfat thickness and application thereof. The invention studies and determines that the pig backfat thickness related molecular marker is located at the 95583333rd site (corresponding to the 701st basic group A / G mutation of SEQ ID NO: 1) of the No.18 chromosome of the international pig reference genome version 11.1, and verifies the influence effect of the molecular marker on the pig backfat thickness character. And when the basic group at the site is A, the pig has lower back fat thickness. On the basis, a molecular marker-assisted selection breeding technology for rapidly improving the backfat thickness character of the pig is established, the frequency can be increased generation by generation by optimizing the dominant allele (A), the backfat thickness of the breeding pig is remarkably reduced, the genetic improvement process of commercial pig herds containing landrace and large white pig blood lineage is accelerated, and the breeding efficiency is improved; the sales profit is increased for enterprises, the core competitiveness is improved, and the economic benefits of commercial pigs are improved.

The invention belongs to the technical field of animal genetic breeding, and provides an application of an SNP molecular marker related to a pig backfat thickness character. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 7, wherein the polymorphism of the eleventh basic group is C / T. The key gene SLC26A3 related to the backfat thickness of the large white pig is identified through whole genome deep sequencing, the genotype of the backfat thickness character of the large white pig is further detected through an SLC26A3 gene molecular marker, and the backfat thickness of the CC genotype large white pig is obviously higher than that of a CT / TT genotype pig. Therefore, the breeding of the CT / TT genotype individuals is beneficial to meeting the continuous demand of large-scale production on high-efficiency utilization of feed energy. The detection method provided by the invention is simple and easy to operate, can efficiently and quickly identify the back fat thickness character of the large white pig, improves the uniformity of the back fat thickness of the pig, and provides a scientific basis for early breeding of the pig.

The invention belongs to the technical field of molecular biology, particularly relates to a pig chromosome 3 TMC7 gene as a meat-producing character molecular breeding marker and application, and aims to provide a new marker and technical support for meat-producing character molecular breeding of pigs. The molecular marker is located at the 26346502 base in a pig chromosome 3 TMC7 gene, and allele G / T polymorphism exists at the site. A correlation analysis result shows that in American and French large white pig populations, the eye muscle area of a GG genotype individual is remarkably higher than that of other genotype individuals (plt; 0.05), and it is indicated that the genotype is a favorable genotype of the eye muscle area character. The SNP marker provided by the invention provides a new molecular tool for genetic breeding of pig eye muscle area characters, and can be used for auxiliary screening of breeding pigs with excellent meat production performance, so that the breeding process of pig breeds with high lean meat percentage is accelerated.

The invention discloses a CHRM3 gene InDel molecular marker associated with growth and reproduction traits of a large white pig and application of the CHRM3 gene InDel molecular marker, a 62bp deletion variation is identified in a second intron of the CHRM3 gene, and a breakpoint is positioned in a second intron 521426525142713bp (a pig chromosome 14 reference sequence NC010456.5) of ENSSSCT00000082112.1. The application for detecting / identifying the growth and reproduction traits of the large white pigs is developed on the basis of the molecular marker, and the detection method is simple, rapid and low in cost and can be used for accurately screening individuals with better traits such as backfat thickness, primary birth litter weight, total multiparous litter size and gestation period of multiparous sows in the early stage, so that genetic improvement is carried out on the growth and reproduction traits of the pigs, and the economic benefit is increased. Multiple characters such as growth and reproduction can be selected at the same time, the breeding period of excellent boars can be shortened, and the breeding efficiency and progress are accelerated.

The application belongs to the technical field of pig molecular marker, and particularly discloses a SNP molecular marker related to the litter size of sows and application thereof. SLC22A12 A SNP site significantly related to the litter size of Landrace sows is screened out by using second-generation gene sequencing and gene chip technology for genotyping and whole genome association analysis of 732 Landrace sows, the SNP site is located on the upstream of a gene on chromosome 2 of pigs, corresponding to the 7565970th nucleotide on chromosome 2 of the international pig 11.1 version reference genome, and can be used for predicting or assisting breeding of the litter size of sows.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the back fat thickness character of a large white pig and application of the SNP molecular marker. The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. DNA (deoxyribonucleic acid) samples of 5253 large white pigs are collected, a pig 80K SNP (single nucleotide polymorphism) high-density functional site chip is used for genetic typing, a molecular marker related to the back fat thickness character of the pigs is obtained by means of whole genome association analysis and screening, the registration number of the marker in an Ensepbl database is rs332090971, a polymorphic site is located at the 7932236th site of a chromosome 11, an A / C allele mutation exists, and the molecular marker is a molecular marker related to the back fat thickness character of the pigs. When the polymorphic site is C, the pig has a thinner back fat thickness character.

The invention provides an SNP (Single Nucleotide Polymorphism) marker primer pair related to pig multirib traits and application of the SNP marker primer pair. The SNP site is a nucleotide site of chromosome 7 rs701714758 of a reference sequence of an international pig genome version 11.1, has G / A polymorphism, is located in a protein coding region of an ABCD4 gene, and is remarkably associated with rib number characters of Duroc pigs, landrace pigs, large white pigs and Pietrain pigs through verification of whole genome association analysis and meta analysis. The invention further provides a primer pair for detecting the SNP marker, an upstream primer of the primer pair is SEQ ID NO: 2, and a downstream primer of the primer pair is SEQ ID NO: 3. The SNP marker can be applied to marker-assisted selection and whole genome selection of rib number characters of multiple varieties of pigs, can accurately screen a multi-rib number pig group, improves character prediction accuracy, increases pork and rib row yield, meets consumption demands, and has both social and economic benefits.

The present invention discloses a SNP molecular marker related to the feed conversion rate of Large White pigs and its application, belonging to the technical field of molecular marker-assisted selection. The present invention discloses a SNP molecular marker related to the feed conversion rate of Large White pigs. The DNA samples of 5256 Large White pigs were genotyped using the Porcine 80K SNP high-density chip, and a SNP site significantly correlated with the feed conversion rate of pigs was finally screened out through genome-wide association analysis (GWAS). The site genomic version of the SNP molecular marker corresponds to position 263045504 on chromosome 1 of the Ensembl Sscrofa 11.1 reference genome. The polymorphic site is G or A. When the genotype of the site is G / G, the pig has a higher feed utilization rate.

The present invention belongs to the field of molecular biology technology and relates to a SNP marker of the FRMD4A gene associated with the teat number trait of Large White pigs, a detection method thereof, and an application thereof. The SNP marker is located on the nucleotide sequence of the FRMD4A gene on pig chromosome 10. The site of the SNP marker is the g.48019215 nucleotide site on pig chromosome 10 in the International Porcine Genome Version 11.1 reference sequence, and has a C / T polymorphism. The SNP marker is significantly associated with the teat number trait. The SNP marker provided by the present invention is associated with the teat number trait of pigs. By identifying the SNP marker, pig strains with a high teat number can be screened. The resulting high-fertility strains with a high teat number have important economic benefits and social value.

The invention belongs to the technical field of animal molecular breeding, and particularly relates to application of a haplotype molecular marker for improving the utilization efficiency of large white pig feed, and the haplotype molecular marker comprises a haplotype 1 and / or a haplotype 2; the haplotype 1 comprises 8 sites of SNP2-SNP9 in total, and the haplotype 2 comprises 26 sites of SNP10-SNP35 in total; the application refers to any one of the following steps: identifying the feed conversion rate of the large white pigs; the feed utilization rate of large white pig offspring is improved. The haplotype H002 individuals and the haplotype H004 individuals are individuals with low feed conversion rate in each LDblock haplotype module, and the haplotype H002 individuals and the haplotype H004 individuals are individuals with low feed conversion rate in each LDblock haplotype module. In the actual breeding process, H002 and H004 haplotype individuals are reserved, screening of individuals with high feed utilization efficiency and seed reserving are facilitated, the accuracy of early-stage seed selection of the feed utilization efficiency character of the large white pigs is improved, and good economic benefits and wide application prospects are achieved.

The application relates to a product of a SNP molecular marker related to the litter weight trait of Large White pigs, wherein the SNP molecular marker is an A>G base mutation at a nucleic acid site of 116767089 of chromosome 2 in the international pig genome Sscrofa 11.1 version, and the nucleotide sequence is shown as SEQ ID No. 1; the product at least comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3. The SNP molecular marker can be used for breeding, cultivation and evaluation of multi-species high-reproduction-performance sows.

The application belongs to the technical field of animal molecular breeding, and particularly relates to application of a SNP haplotype molecular marker related to average daily weight gain of Large White pigs, wherein the SNP haplotype molecular marker comprises 12 loci of SNP1-SNP12, when the combination of SNP1-SNP12 is TTGCCCCACAGT in turn, the average daily weight gain of the Large White pig is higher than that of the combination of TCATATTTTGGC; the application refers to any one of the following: identifying the average daily weight gain of the Large White pig; improving the average daily weight gain of offspring of the Large White pig. Based on the application, in the actual breeding process, the H001 (TTGCCCCACAGT) haplotype individual is reserved, which is beneficial to screening of the high average daily weight gain individual and breeding, and improves the accuracy of early selection of the average daily weight gain trait of the Large White pig, and has good economic benefits and wide application prospect.

The invention belongs to the technical field of molecular biology, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker of an HTR2A gene related to a pig backfat thickness character and application of the SNP molecular marker. The molecular marker is from the 20563279 basic group in a pig 11 # chromosome HTR2A gene. A large white pig is selected as a test material, whole genome DNA is extracted from pig blood, and primers are designed according to a pig genome sequence (NC010449.5) published by an NCBI database. And a C or T base substitution exists at the 316th site, so that polymorphism is caused. According to the present invention, the SNP site is subjected to typing, and the association analysis on the American line big white and the French line big white shows that the back fat thickness of the CC genotype individual is significantly thin compared with the back fat thickness of the other genotype individuals; the invention provides a new marker for pig molecular marker-assisted selection, and the new marker is applied to genetic improvement of pig backfat thickness to accelerate the breeding improvement process of high-quality pigs.

The invention relates to the technical field of molecular markers and animal genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) marker capable of influencing the content of IMP or GMP (Good Manufacturing Practice) of pigs and application of the SNP marker. According to the invention, based on three test swinery of American-series purebred landrace, American-series purebred large white pig and American-series purebred Duroc, pig whole genome re-sequencing and GWAS analysis are adopted, 15 SNP markers related to the content of IMP or GMP are researched and determined, and by optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the content of IMP or GMP can be increased, and the number of SNP markers related to the content of IMP or GMP can be increased. The pig genetic improvement progress is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.

According to the application of the product of the SNP molecular marker related to the birth litter weight character of the large white pig, the SNP molecular marker is as follows: A > G base mutation located at the 116767089 nucleic acid site of the second chromosome of the international pig genome Sscrofa 11.1 version, and the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID No.1; the product at least comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is as shown in SEQ ID No.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.3. The SNP molecular marker provided by the invention can be used for breeding, breeding and evaluating multi-variety sows with high reproductive performance.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to pig fast growth character and application thereof, and relates to the technical field of molecular markers. The SNP molecular marker is located at a 55754471bp site of a No.17 chromosome of an international pig reference genome Sscrofa 10.2 version, and the nucleotide sequence of the site is C or T and is marked as Cgt; t is located in the SULF2 gene, and T is an excellent allele related to high growth speed. The SNP site provided by the invention is used for breeding pig breeds with high growth speed, and pigs with excellent growth performance can be effectively and accurately screened through combined use of primers and kits designed for the SNP molecular marker and a method for carrying out rapid-growth pig breeding or auxiliary breeding based on the marker. According to the method, accurate prediction and efficient screening of fast-growing individuals of large white pigs can be achieved, the breeding efficiency of excellent breeding pigs is remarkably improved, and the population improvement process is accelerated.

The present application relates to a SNP marker primer pair related to the number of teats of pig chromosome 7 and its application. The SNP marker is located at the rs3470144376 nucleotide site of pig chromosome 7, the site of the SNP marker is the molecular marker of the rs3470144376 nucleotide site of the international pig genome 11.1 version reference sequence pig chromosome 7, and has G / A polymorphism, the SNP marker is extremely significantly related to the number of teats of large white pigs (P<0.01). A primer pair for detecting the SNP marker, the upstream primer is SEQ ID NO: 2, and the downstream primer is SEQ ID NO: 3. The SNP marker provided by the present application is extremely significantly related to the number of teats of large white pigs, and the genotype of the SNP marker is identified to screen large white pig strains with multiple teats. The establishment of the strain can improve the reproductive efficiency of large white pigs and produce more social and economic benefits.

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an InDel molecular marker for identifying the production performance of large white pigs and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is GTTGCTGTGGCTGTGTTGTAGGTCGAAGACATGGCTGGC, and the InDel molecular marker is located at the 261th base to the 306th base of the nucleotide sequence shown in SEQ ID NO.1; a pig individual containing the InDel molecular marker sequence has relatively better growth traits and / or breeding traits compared with a pig individual without the InDel molecular marker sequence. The InDel molecular marker provided by the invention provides an effective way for efficiently and accurately predicting or identifying the growth rate and the reproductive capacity of the large white pigs on the molecular level, early breeding of multiple traits can be simultaneously carried out aiming at the molecular marker site, and the breeding period of excellent boars is greatly shortened.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig backfat thickness character. DNA (deoxyribonucleic acid) samples of 5253 large white pigs are collected, a pig 80K SNP (single nucleotide polymorphism) high-density functional site chip is used for genetic typing, a molecular marker related to the back fat thickness character of the pigs is obtained through whole-genome association analysis and screening, the login number of the SNP molecular marker in an Ensepmbl database is rs701714758, a polymorphic site is located at the 97575068th site of a No.7 chromosome, an A / G allele mutation exists, and the SNP molecular marker is a molecular marker related to the back fat thickness character of the pigs. And when nucleotide mutates into G, the pig has a thinner back fat thickness character.

The application discloses a SNP molecular marker of a site rs338618851 related to pork production efficiency of pigs and application. The genetic marker is cloned from a 93991071 site of a chromosome 6 of pigs. American Landrace pigs are selected as test materials, whole genome DNA is extracted from blood of the pigs, and a primer is designed according to a pig genome sequence NC_010448.4 published in an NCBI database. A base substitution of T or C exists at a 172th position of a primer amplification sequence, the substitution causes polymorphism at the position. The SNP site is typed through a direct sequencing technology, and correlation analysis shows that, compared with other gene individuals, a TT genotype individual at the 172th position is large in birth weight, large in eye muscle area and short in time to reach 100 kg at a certain age. The application provides a new marker for molecular breeding of pork production traits of pigs.

The application provides a SNP molecular marker related to pig teat number and backfat thickness and application thereof. The marker is obtained through whole genome association analysis of total teat number of large white pigs. The marker is from the 97377902th site of pig chromosome 7. Large white pigs are selected as test materials, whole genome DNA is extracted from pig blood, and primers are designed according to the pig genome sequence (NC_010449.5) published in the NCBI database. There is a base substitution of C or T at the 376th site, resulting in polymorphism. The SNP site is typed, and association analysis shows that, compared with other gene individuals, the TT genotype individuals have more total teat number, left and right teat number, and thinner backfat thickness. The application provides a new marker for pig molecular marker assisted selection, and the marker is applied to genetic improvement of pig teat number and backfat thickness, and the breeding improvement process of high-quality pigs is accelerated.

The invention belongs to the field of molecular biotechnology and livestock breeding, and discloses an rs323970378 site SNP molecular marker related to pig birth litter weight and application of the rs323970378 site SNP molecular marker. According to the invention, DNA samples of 617 large white pigs are subjected to genetic typing by using a low-depth (1 *) whole genome re-sequencing technology, and an SNP site significantly related to the litter weight character of the pigs is finally screened out through GWAS (whole genome association analysis). The SNP molecular marker is located at the 26902856th nucleotide of a chromosome 14 in an Ensembl Sscrofa11.1 reference genome version, and Cgt exists in the SNP molecular marker; g is subjected to base mutation. A research result shows that when the genotype of the locus is C / C, the birth litter weight of a large white pig individual is the highest. The invention provides a new marker for genetic improvement and molecular marker-assisted breeding in the aspect of pig birth litter weight traits.

The invention provides a gene influencing sexual precocity of deep-county pigs and a screening method thereof, and belongs to the field of research on sexual maturity of pigs, the gene influencing sexual precocity of deep-county pigs comprises an SRD5A1 gene and / or a CYP11B2 gene, testicular tissues of deep-county pigs before and after sexual maturity are subjected to transcriptome sequencing, differential expression gene functions are analyzed, and the sexual precocity of deep-county pigs before and after sexual maturity is obtained. And screening out candidate genes related to the sexual maturity of the deep county pigs. And then performing transcriptome sequencing on testis tissues of the sexually mature deep county pig and the hybrid pig of the sexually mature deep county pig and the large white pig, analyzing functions of differential expression genes, and screening specific expression genes of the sexual maturity of the deep county pig. Integrating the results of the two times of transcriptome sequencing, analyzing the functions of the coincident genes, and screening candidate genes SRD5A1 and CYP11B2 which influence the sexual precocity of the pigs in the deep county according to the gene functions; and a foundation is laid for subsequent research on precocious puberty of pigs in deep county.

The application discloses a binary pig efficient breeding method based on hybridization advantage and application, relates to the technical field of livestock breeding, and comprises the following steps: acquiring phenotype data of pure line Landrace pigs, pure line Large White pigs and historical hybrid offspring, setting the weight of reproduction traits, growth traits and feed efficiency traits in combination with external environment parameters, and generating comprehensive heterosis evaluation indexes; performing high-density genotyping on candidate Landrace pigs and candidate Large White pigs, constructing a genetic effect prediction model based on the genotyping results and the phenotype data, predicting the hybridization effect of a pairing combination of Landrace pigs and Large White pigs by using the genetic effect prediction model, screening the pairing combination meeting the comprehensive heterosis evaluation indexes according to the hybridization effect, and implementing artificial insemination to obtain first-generation binary pigs; and performing whole life cycle performance determination on the first-generation binary pigs, and calculating the measured comprehensive heterosis evaluation indexes.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP molecular marker associated with the average daily gain and backfat thickness character of a large white pig and application of the SNP molecular marker. The SNP molecular marker jointly related to the average daily gain character and the backfat thickness character of the large white pig is screened out through GWAS and SNP correlation analysis, the SNP site is located on the 161160798th basic group of a chromosome 1 of a reference genome of the 11.1 version of the pig, and when the login number in an NCBI database is rs334769214 and the polymorphic site is G, the large white pig has higher average daily gain and backfat thickness.

The invention belongs to the technical field of pig molecular markers, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a large white pig backfat thickness character. DNA samples of 5 and 253 large white pigs are collected, a pig 80K SNP high-density functional site chip is used for genetic typing, a molecular marker related to the pig backfat thickness character is obtained through whole genome association analysis and screening, the SNP molecular marker is located at the 160773437 site of a first chromosome with the Ensepbl login number being rs81219178, the polymorphic site is located at the 160773437 site of the first chromosome, a G / A allele mutation exists, and the SNP molecular marker is located at the 160773437 site of the second chromosome. When the nucleotide is mutated into A, the large white pig has a thinner back fat thickness character.

The application relates to the fields of molecular biological technology and livestock breeding technology, in particular to a SNP molecular marker related to a total number of piglets character, a detection primer pair, a kit and application of the SNP molecular marker in a method for breeding large white pigs with high number of piglets, the SNP molecular marker is located on a pig 9th chromosome, a physical position is located at chr9:65633096 of a genome version Ensembl Sscrofa11.1, a polymorphism site is C or A, and the C allele is positively correlated with the high number of piglets character; through genotype discrimination, selection breeding can be carried out: an individual with a genotype of C / C is preferentially selected or reserved as a breeding pig, because the total number of piglets has the highest potential, so that the genetic improvement speed of a population breeding performance is accelerated.