Rs338618851 site SNP molecular marker related to pig meat production efficiency and application of rs338618851 site SNP molecular marker

Abstract

The invention discloses an rs338618851 site SNP (Single Nucleotide Polymorphism) molecular marker related to the meat production efficiency of pigs and application of the rs338618851 site SNP molecular marker. The genetic marker is cloned from a 93991071th site of a pig chromosome 6. The method comprises the following steps: selecting American-series large white pigs as test materials, extracting whole genome DNA from pig blood, and designing primers according to a pig genome sequence NC010448.4 published by an NCBI (National Center of Biotechnology Information) database; a base substitution of T or C exists at the 172nd site of the primer amplification sequence, and the substitution causes the generation of polymorphism at the position. According to the present invention, the SNP site is subjected to typing through the direct sequencing technology, and the correlation analysis results show that compared with other gene individuals, the 172nd TT genotype individual has characteristics of major birth, large eye muscle area, short time of 100 kg day age, and the like; the invention provides a new marker for molecular breeding of pig meat traits.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology and molecular marker technology, and specifically relates to a SNP molecular marker in the promoter region of the FHL3 gene related to pig meat production efficiency, and also relates to an application of a SNP molecular marker in the promoter region of the FHL3 gene related to pig meat production efficiency. The genetic marker is cloned from the 93991071 base of chromosome 6 of the pig. Background Art

[0002] In animal genetics and breeding, the control mechanisms of traits can be divided into two categories: simple traits controlled by a single gene and complex traits controlled by multiple genes [1] Lander, ES, & Schork, NJ (1994). Genetic dissection of complex traits. Science, 265 (5181), 2037-2048. Traits controlled by a single gene are usually dominated by one or a few genes, which show simple Mendelian inheritance patterns in the form of dominant or recessive alleles, such as flower color of peas or certain genetic diseases. However, traits with important economic value in agriculture, such as milk production of dairy cows, back fat thickness and eye muscle area of ​​pigs, are usually controlled by multiple genes. These complex traits do not follow simple Mendelian inheritance laws, but are caused by the combined effects of multiple genes [2] Flint, J., & Mott, R. (2001). Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics, 2 (6), 437-445. Each gene has a small effect on the trait, resulting in continuous phenotypic variation. Such genes are usually called quantitative trait loci (QTL) [3] Mackay, TFC (2001). The genetic architecture of quantitative traits. Annual Review of Genetics, 35 (1), 303-339. Compared with single-gene traits, the inheritance pattern of polygenic traits is more complex, involving multiple genes and their interactions with the environment.Studying the genetic mechanisms of these complex traits usually requires the use of complex statistical models and genome-wide association studies (GWAS) [4] Dekkers, JCM, & Hospital, F. (2002). The use of molecular genetics in the improvement of agricultural populations. Nature Reviews Genetics, 3 (1), 22-32. [5] Meuwissen, TH, Hayes, BJ, & Goddard, ME (2001). Prediction of total genetic value using genome-wide dense marker maps. Genetics, 157 (4), 1819-1829.

[0003] A key reason for conducting GWAS studies in livestock is to select better livestock using validated markers through marker-assisted selection (MAS). MAS is a breeding method that selects individuals with desired traits using marker genotypes that are closely linked to the target gene [6] Goddard, ME, & Hayes, BJ (2009). Mapping genes for complex traits in domestic animals and their use in breeding programmes. Nature Reviews Genetics, 10(6), 381-391. Traditionally, selection for economically valuable traits relies on phenotypic records of individuals and their relatives, and breeding values ​​are estimated by best linear unbiased prediction (BLUP) [7] Zhao, Y., Zhao, H., Wang, C., Lan, H., & Chen, L. (2021). Integrating GWAS and GBLUP to Improve Genomic Prediction Accuracy for Complex Traits in Livestock. Frontiers in Genetics, 12, 645800. However, this approach generally ignores the direct identification of relevant genes and is less efficient for selection of traits that are difficult to measure, such as milk production, meat quality, and lifespan.

[0004] MAS technology significantly improves these traits by identifying and selecting individuals carrying ideal alleles, thereby shortening the breeding cycle. MAS includes two main types: one is to use the pathogenic mutations in the identified genes or regulatory regions, which usually have a significant effect on the traits; the other is to use single nucleotide polymorphisms (SNPs) that are in linkage disequilibrium (LD) with QTLs [8] Li, X., Huang, Y., & Cheng, Y. (2022). Advances in Marker-Assisted Selection and Genomic Selection in Animal Breeding: Current Status and Future Prospects. Animal Frontiers, 12 (2), 50-57. The latter estimates the breeding value of selection candidates by combining pedigree, marker and phenotypic information. This type of MAS has been successfully used to improve several important traits of livestock, such as reproduction rate, feed intake, growth rate and meat quality characteristics [9] Wang, X., Zhang, Y., Li, J., & Liu, L. (2021). Recent Advances in Quantitative Trait Loci Mapping and Genome-Wide Association Study in Livestock. Biomolecules, 11(10), 1516.

[0005] The porcine FHL3 gene (Four and a Half LIM Domains Protein 3) is a gene widely involved in muscle development and regulation. Its expression level may directly affect the growth performance of pigs

[10] Bai, W., Zhang, Y., Ma, J., Du, M., Xu, H., Wang, J., Zhang, L., Li, W., Hou, Y., Liu, X., Zhang, X., Peng, Y., Li, J., Zhan, X., Jiang, W., Liu, S., Liu, X., Li, Q., Miao, Y., Sui, M., Yang, Y., Zhang, S., Xu, Z., & Zuo, B. (2023). FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism. Cellular and Molecular Life Sciences, 80(1), 2023. Therefore, the functional variation of the FHL3 gene is an important part of studying the genetic basis of pig meat production traits. Summary of the invention

[0006] The purpose of the present invention is to provide a SNP molecular marker at the rs338618851 site related to pig meat production efficiency. The genetic marker is cloned from the 93991071 site of pig chromosome 6, and a direct sequencing method is used to find the SNP site and a genotyping method to analyze its association with the pig meat production trait, thereby establishing a new marker-assisted selection site for the pig meat production trait.

[0007] Another object of the present invention is to provide an application of a rs338618851 locus SNP molecular marker in improving the meat production efficiency of pigs. In view of the important role of rs338618851 in pig growth and meat production traits, the SNP can be used as an effective molecular marker in the genetic improvement of pigs. By using the SNP for molecular marker-assisted selection, the breeding efficiency can be significantly improved, and breeding pigs with excellent growth performance and meat quality characteristics can be bred, providing an efficient and accurate genetic improvement tool for pork production. This discovery provides a new target for molecular breeding of pigs, which has broad application prospects and important economic value. Incorporating rs338618851 into the breeding strategy can further optimize the genetic structure of pigs and enhance the competitiveness of the pork industry.

[0008] The present invention is achieved through the following technical solutions:

[0009] In this study, the inventors of the present application discovered a SNP site rs338618851 located in the promoter region of the FHL3 gene. Through statistical analysis and experimental verification, this SNP site is significantly associated with the growth rate and meat production of pigs. Specifically, different genotypes of rs338618851 are significantly different from birth weight, lean meat rate and growth rate. This SNP may affect the growth and differentiation process of muscle cells by changing the expression level of the FHL3 gene.

[0010] The goal of the present invention is to screen genetic markers associated with pig meat production traits. By cloning the gene sequence of the 939990900-93991758 segment of pig chromosome 6, and using direct sequencing to find SNP sites and genotyping methods, the association with pig meat production traits is analyzed, thereby establishing new marker-assisted selection sites for pig meat production traits and improving pig muscle yield.

[0011] The present invention obtains the gene sequence of the 939990900-93991758 segment of pig chromosome 6, the fragment length is 859 bp, and the nucleotide sequence is shown in SEQ ID NO.1. By performing BLAST comparison on the NCBI website, it is found that there is a nucleotide polymorphism (SNP) site in the amplified fragment, specifically as follows Figure 2 The mutation of this SNP site is specifically at the 93991071 base of chromosome 6, where the base changes from T to C. According to the naming rules of the Ensembl database, the mutation site is named rs338618851.

[0012] The experimental material was American Large White pigs. Whole genome DNA was extracted from the blood of American Large White pigs, and primer pairs were designed based on the pig gene sequence (NC_010448.4) published in the NCBI database. The sequences of the primer pairs are as follows:

[0013] Forward primer (SEQ ID NO. 2): 5'-CTACCATTCCTGTTCCTTATCT-3',

[0014] Reverse primer (SEQ ID NO. 3): 5'-ACATCCACCGCCTATCAG-3'.

[0015] The above primer pair can detect and type the SNP sites in the gene region of the 939990900-93991758 segment of pig chromosome 6.

[0016] After PCR amplification, purification of PCR products, cloning and sequencing, and sequence comparison analysis using the above primer pair, a genetic marker associated with pig meat production traits was screened. The nucleotide sequence of the genetic marker is shown below, wherein the mutation site is located at position 172 of the sequence, and the specific sequence is as described in SEQ ID NO.1: CTACCATTCCTGTTCCTTATCTTGTGGTGGAAGGGGGCTTGCTTGGGGTCTCCCAGCTCTTCTT TCACTTTGGCAGTGTTTTCAAAAGGAGGCCCTGGGTGACTGAAGGCTGGCAGGCCTCTCGT GGTTTCCTCTGGGTGCTGAATCACTCCTGATGCTTGTAACCACAAGR(T / C)CCTCCCCCTCCCCC CCAGTGAGAAAACTTCCTTCTTTCTCTGGGTGTATTGCTCACTCTTATCCACTGGGCTGAATACAGCCCCTGCAGTCCTCCTGGCTAAGCAGACACCCTCTTTCAGATTGCCCAGAAGCACTTTCCTTGTGAGCCCAAGCCTGGCATTGGGTCTGTGGGTGCAGAATGT TAAGTGAGTGACTTCTACAGAGTGTGGGGAGGAATGGTAGAGGGAAAATAACCTATGGTTTGGGTTTTTTTCATCTTTTTGCCATTTTCTTGGGCCACTCCCACGGCATATGGAGGTTCCCAGGCTAGAGGTCTAATCGGAGCTGTAGGCACCGGCCTACGCCAGAGC CACAGCAATGCAGGTTCCGAGCCGCGTCTGCGACCTACACCACAGCTCATGGCAATGCCGGATCCTTAACCCACTGAGCAAGACCAGGGATCGAACCTGCAACCTCACGGTTCCTAGTCGGATTCATTAATCACTGCGCCACGACAGGAACTCCACCTATGGTTAAAT GCCAGCTACATGCATGGTACAATGCTAAGTAACAGTCATTCCTTCCCTCAGTTCTCACAAAAGCCGTAAGAAATGCTTATTATATTATTGCTATTTTACAGAGTAGGATATGGGGCTCAGAAGGTTTGACAGTGTGGCCCTAAATCACAAGCTGATAGGCGGTGGATGT

[0017] A method for screening genetic markers associated with pig meat production traits, the steps of which are:

[0018] 1. Extract genomic DNA from the blood of American Large White pigs.

[0019] 2. Design primers based on the genomic sequence from +2332 to +3190 bp upstream of the FHL3 transcription start site. Use the above primers to perform PCR amplification on pig genomic DNA, and obtain the nucleotide sequence from +2332 to +3190 upstream of the FHL3 transcription start site by direct sequencing (see SEQ ID NO.1 for details), which contains 1 SNP site.

[0020] 3. This mutation site can be used as a genetic marker to conduct association analysis on the meat production and growth rate traits of American Large White pigs.

[0021] A genotyping method for detecting SNP sites in the above sequence.

[0022] The present invention further provides an application of using direct sequencing to determine the association analysis between individuals with different genotypes and meat production and growth rate.

[0023] An application of a rs338618851 site SNP molecular marker in improving pig meat production efficiency comprises the following steps:

[0024] 1. Determine the correlation between SNPs in the 939990900-93991758 region of chromosome 6 and pig phenotypic differences, and select American Large White pigs as the experimental material.

[0025] 2. Direct sequencing was used to detect polymorphisms and analyze the correlation between polymorphic loci and pig meat production traits. Mixed linear models (Mixed) in SAS statistical software were used to analyze the association between genotype and phenotypic values.

[0026] Sequence SEQ ID NO.1 is the nucleotide sequence of the 939990900-93991758 segment of the porcine chromosome 6, and this sequence is used as the nucleotide sequence of the genetic marker of the present invention. There is an allele mutation site at the 172nd base of the sequence, that is, a mutation from "T" to "C". The base at the mutation site in the sequence is the base before the mutation, and the mutation method is shown in this specification.

[0027] Sequence SEQ ID NO.2 is a primer pair sequence for amplifying the 939990900-93991758 segment of porcine chromosome 6, and the primer pair is used to detect the genetic marker of the present invention.

[0028] For more detailed technical solutions, please see the "Specific Implementation Methods".

[0029] Compared with the prior art, the present invention has the following advantages and effects:

[0030] Through the analysis of omics data and other related data conducted in the laboratory in the early stage, a SNP site rs338618851 located in the promoter region of the FHL3 gene was discovered. Through statistical analysis and experimental verification, the polymorphic site rs338618851 was significantly correlated with the birth weight, eye muscle area and the age of reaching 100kg in American Large White pigs (P<0.05). Among them, the birth weight and eye muscle area of ​​individuals with TT genotype were significantly higher than those of individuals with CC genotype (P<0.01); in terms of the age of reaching 100kg body weight, the age of individuals with TT genotype reaching 100kg body weight was significantly shorter than that of individuals with CC genotype (P<0.01). From the perspective of genetic stability and genetic progress, the TT genotype has obvious advantages in shortening the age of reaching 100kg body weight and increasing the birth weight and eye muscle area. Based on the above results, the polymorphic site rs338618851 can be used as a molecular breeding marker to increase the meat production traits of pigs. The present invention aims to discover and identify SNP sites related to pig meat production traits, thereby providing important guidance for pig genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 : The present invention clones and detects the segment 939990900-93991758 of porcine chromosome 6. The concentration of agarose gel is 1.5%. Explanation of reference numerals: Lanes 1-4: PCR amplification products, Lane M: DL2000Maker.

[0032] Figure 2 : The nucleotide sequence of the segment 939990900-93991758 of porcine chromosome 6. Explanation of the reference numerals: There is one mutation site in the sequence shown, which is a specific site causing polymorphism in this segment.

[0033] Figure 3 : The sequencing result of the genetic marker sequence of the present invention. There is a double peak pattern, where the base "T" is mutated into "C". DETAILED DESCRIPTION

[0034] Example 1: Obtaining DNA fragments from the 939990900-93991758 region of pig chromosome 6 and establishing a SNP detection method.

[0035] A method for screening genetic markers associated with pig meat production traits comprises the following steps:

[0036] 1. The American Large White pigs were selected for the test, and the primer pairs were designed based on the genome sequence of the 939990900-93991758 segment of chromosome 6 of the pig. The specific sequences are as follows:

[0037] Forward primer: 5'-CTACCATTCCTGTTCCTTATCT-3',

[0038] Reverse primer: 5′-ACATCCACCGCCTATCAG-3′.

[0039] 2. Use the above primer pairs to perform PCR amplification in the genomic DNA of pigs from different experimental groups.

[0040] The PCR reaction system is shown in Table 1.

[0041] Table 1 PCR reaction system

[0042]

[0043] The PCR reaction conditions are shown in Table 2.

[0044] Table 2 PCR reaction conditions

[0045]

[0046] After the obtained PCR product was purified and cloned, it was commissioned to Wuhan Hece Gene Technology Co., Ltd. for sequence determination. BLAST comparison analysis revealed a T / C base mutation at the 172nd base of the sequence.

[0047] Example 2: Association analysis and application of the genetic marker of the present invention with the meat production traits of American Large White pigs. An application of a rs338618851 site SNP molecular marker in improving the meat production efficiency of pigs comprises the following steps:

[0048] 1. In order to determine the correlation between SNPs in the 939990900-93991758 region of chromosome 6 and pig phenotypic differences, this example selected American Large White pigs (640 heads) as test materials.

[0049] 2. Direct sequencing was used to detect polymorphisms and analyze the correlation between polymorphic loci and pig meat production traits. Mixed linear models (Mixed) in SAS statistical software were used to analyze the association between genotype and phenotypic values.

[0050] Among them, the analysis model of American Large White Pig is as follows: ijkl =u+G i +F j +S k +B l +ε ijklm , where Y ijkl is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; F j , Sk , B l are fixed effects, namely family, gender, and batch effects; ε ijklm is a random error, assuming that it obeys N(0, σ 2 )distributed.

[0051] After polymorphism detection of the rs338618851 locus in the 939990900-93991758 region of chromosome 6, three genotypes were detected in the above American Large White pig population. The genotype frequencies and their distribution are shown in Table 3.

[0052] Table 3 Genotype frequency and allele frequency of polymorphic site rs338618851 in Large White pig population

[0053]

[0054] It can be concluded from Table 3 that the C allele frequency of the polymorphic site rs338618851 in the American Large White pig population is higher than the T allele frequency.

[0055] Table 4 Association analysis between polymorphic site rs338618851 and meat production traits

[0056]

[0057] Note: The above values ​​are least squares mean ± standard error. In each pig breed, the same letters in the same column indicate no significant difference (P>0.05), different letters indicate significant difference (P<0.05), and no mark indicates no significant difference (P>0.05). The numbers in brackets indicate the number of pigs.

[0058] The analysis in Table 4 showed that the polymorphic site rs338618851 was significantly correlated with birth weight, eye muscle area and age at 100 kg in American Large White pigs (P<0.05). Among them, the birth weight and eye muscle area of ​​individuals with TT genotype (non-mutant genotype) were significantly higher than those of individuals with CC genotype (mutant genotype) (P<0.01); in terms of age at 100 kg, the age at which individuals with TT genotype reached 100 kg was significantly shorter than that of individuals with CC genotype (P<0.01). From the perspective of genetic stability and genetic progress, the TT genotype has obvious advantages in shortening the age at 100 kg and increasing birth weight and eye muscle area. Based on the above results, the polymorphic site rs338618851 can be used as a molecular breeding marker to increase pig meat production traits.

Claims

1. A SNP molecular marker at the rs338618851 locus associated with pig meat production efficiency, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein there is an allele mutation site at the 172nd base of the sequence, which mutates from T to C.

2. The rs338618851 SNP molecular marker associated with pig meat production efficiency according to claim 1, characterized in that: The pigs are American Large White pigs.

3. The rs338618851 site SNP molecular marker associated with pig meat production efficiency according to claim 1, characterized in that: The primer pair sequences of the SNP molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. According to claim 1, the use of a SNP molecular marker at the rs338618851 site associated with pig meat production efficiency in improving pig meat production efficiency comprises the following steps: 1) To determine the correlation between SNPs in the 939990900-93991758 region of chromosome 6 and pig phenotypic differences, American Large White pigs were selected as the experimental material. 2) Direct sequencing was used to detect polymorphisms and analyze the correlation between polymorphic loci and pig meat production traits; mixed linear models in SAS statistical software were used to analyze the association between genotype and phenotypic values.

5. The use according to claim 4, characterized in that: The birth weight and eye muscle area of ​​individuals with non-mutation genotype were higher than those with mutation genotype, P<0.

01. In terms of the age at reaching 100kg body weight, the age at reaching 100kg body weight was shorter in individuals with non-mutation genotype than in individuals with mutation genotype, P<0.

01. The characteristics of non-mutation genotype included: shortened age at reaching 100kg body weight, increased birth weight and eye muscle area.

Images